A-Type Natriuretic Peptide Alters the Impact of Azithromycin on Planktonic Culture and on (Monospecies and Binary) Biofilms of Skin Bacteria Kytococcus schroeteri and Staphylococcus aureus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains and Cultivation
2.2. Active Compounds
2.3. Growth of Bacteria on the Polytetrafluoroethylene Cubes
2.4. Growth of Biofilms on the Glass Microfiber Filters
2.5. Growth Kinetics Study
2.6. Confocal Microscopy and Fluorescence Hybridization In Situ
2.7. Quantitative PCR
2.8. Data Processing and Statistics
3. Results
3.1. Test of Azithromycin Concentration Range and Work Concentration Selections
3.2. The Effect of ANP and Azithromycin Combination
3.3. Study of Binary Biofilms by CFU Counting
3.4. Study of the Metabolic Activity of Monospecies and Binary Biofilms
3.5. Study of Cell Aggregation Strength in Biofilms after Physical Disruption
3.6. Confocal Microscopy of Biofilms
3.7. Study of Growth Kinetics
3.8. Gene Expression Study
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, B.; Yao, M.; Lv, L.; Ling, Z.; Li, L. The human microbiota in health and disease. Engineering 2017, 3, 71–82. [Google Scholar] [CrossRef]
- Lyte, M. Microbial endocrinology in the microbiome-gut-brain axis: How bacterial production and utilization of neurochemicals influence behavior. PLoS Pathog. 2013, 9, e1003726. [Google Scholar] [CrossRef] [PubMed]
- Sauer, K.; Stoodley, P.; Goeres, D.M.; Hall-Stoodley, L.; Burmølle, M.; Stewart, P.S.; Bjarnsholt, T. The biofilm life cycle: Expanding the conceptual model of biofilm formation. Nat. Rev. Microbiol. 2022, 20, 608–620. [Google Scholar] [CrossRef] [PubMed]
- Boukerb, A.M.; Robert, M.; Teteneva, N.A.; Danilova, N.D.; Zhurina, M.V.; Mart’yanov, S.V.; Plakunov, V.K.; Feuilloley, M.G.J.; Gannesen, A.V. Draft genome sequence of Kytococcus schroeteri strain h01, isolated from human skin. Microbiol. Resour. Announc. 2019, 8, e01081-19. [Google Scholar] [CrossRef] [PubMed]
- Bagelman, S.; Zvigule-Neidere, G. Insight into Kytococcus schroeteri infection management: A case report and review. Infect. Dis. Rep. 2021, 13, 230–238. [Google Scholar] [CrossRef]
- Szczerba, I. Occurrence and number of bacteria from the Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus genera on skin and mucous membranes in humans. Med. Dośw. Mikrobiol. 2003, 55, 67–74. [Google Scholar]
- Le Brun, C.; Bouet, J.; Gautier, P.; Avril, J.L.; Gaillot, O. Kytococcus schroeteri endocarditis. Emerg. Infect. Dis. 2005, 11, 179–180. [Google Scholar] [CrossRef]
- Makovcova, J.; Babak, V.; Kulich, P.; Masek, J.; Slany, M.; Cincarova, L. Dynamics of mono-and dual-species biofilm formation and interactions between Staphylococcus aureus and Gram-negative bacteria. Microb. Biotechnol. 2017, 10, 819–832. [Google Scholar] [CrossRef]
- Reigada, I.; San-Martin-Galindo, P.; Gilbert-Girard, S.; Chiaro, J.; Cerullo, V.; Savijoki, K.; Nyman, T.A.; Fallarero, A.; Miettinen, I. Surfaceome and exoproteome dynamics in dual-species Pseudomonas aeruginosa and Staphylococcus aureus biofilms. Front. Microbiol. 2021, 12, 672975. [Google Scholar] [CrossRef]
- Stewart, E.J.; Payne, D.E.; Ma, T.M.; VanEpps, J.S.; Boles, B.R.; Younger, J.G.; Solomon, M.J. Effect of antimicrobial and physical treatments on growth of multispecies staphylococcal biofilms. Appl. Environ. Microbiol. 2017, 83, e03483-16. [Google Scholar] [CrossRef]
- Ch’ng, J.H.; Muthu, M.; Chong, K.K.L.; Wong, J.J.; Tan, C.A.Z.; Koh, Z.J.S.; Lopez, D.; Matysik, A.; Nair, Z.J.; Barkham, T.; et al. Heme cross-feeding can augment Staphylococcus aureus and Enterococcus faecalis dual species biofilms. ISME J. 2022, 16, 2015–2026. [Google Scholar] [CrossRef] [PubMed]
- Short, B.; Delaney, C.; McKloud, E.; Brown, J.L.; Kean, R.; Litherland, G.J.; Williams, C.; Martin, S.L.; MacKay, W.G.; Ramage, G. Investigating the Transcriptome of Candida albicans in a Dual-Species Staphylococcus aureus Biofilm Model. Front. Cell. Infect. Microbiol. 2021, 11, 791523. [Google Scholar] [CrossRef]
- Sakr, A.; Brégeon, F.; Mège, J.L.; Rolain, J.M.; Blin, O. Staphylococcus aureus nasal colonization: An update on mechanisms, epidemiology, risk factors, and subsequent infections. Front. Microbiol. 2018, 9, 2419. [Google Scholar] [CrossRef] [PubMed]
- Samia, N.I.; Robicsek, A.; Heesterbeek, H.; Peterson, L.R. Methicillin-resistant staphylococcus aureus nosocomial infection has a distinct epidemiological position and acts as a marker for overall hospital-acquired infection trends. Sci. Rep. 2022, 12, 17007. [Google Scholar] [CrossRef] [PubMed]
- Lyte, M. Microbial endocrinology: Host-microbiota neuroendocrine interactions influencing brain and behavior. Gut. Microbes. 2014, 5, 381–389. [Google Scholar] [CrossRef] [PubMed]
- Luqman, A. The orchestra of human bacteriome by hormones. Microb. Pathog. 2023, 180, 106125. [Google Scholar] [CrossRef] [PubMed]
- Parijs, I.; Steenackers, H.P. Competitive inter-species interactions underlie the increased antimicrobial tolerance in multispecies brewery biofilms. ISME J. 2018, 12, 2061–2075. [Google Scholar] [CrossRef] [PubMed]
- Kiseleva, A.A.; Solovyeva, T.V.; Ovcharova, M.A.; Geras’kina, O.V.; Mart’yanov, S.V.; Cherdyntseva, T.A.; Danilova, N.D.; Zhurina, M.V.; Botchkova, E.A.; Feofanov, A.V.; et al. Effect of β-estradiol on mono-and mixed-species biofilms of human commensal bacteria Lactobacillus paracasei AK508 and Micrococcus luteus C01 on different model surfaces. Coatings 2022, 12, 436. [Google Scholar] [CrossRef]
- Diuvenji, E.V.; Nevolina, E.D.; Mart’Yanov, S.V.; Zhurina, M.A.; Kalmantaeva, O.V.; Makarova, M.A.; Botchkova, E.A.; Firstova, V.V.; Plakunov, V.K.; Gannesen, A.V. Binary biofilms of Staphylococcus aureus 209P and Kytococcus schroeteri H01: Dualistic role of kytococci and cell adhesion alterations in the presence of the A-type natriuretic peptide. Microbiology 2022, 91, 563–576. [Google Scholar] [CrossRef]
- Ovcharova, M.A.; Schelkunov, M.I.; Geras’kina, O.V.; Makarova, N.E.; Sukhacheva, M.V.; Martyanov, S.V.; Nevolina, E.D.; Zhurina, M.V.; Feofanov, A.V.; Botchkova, E.A.; et al. C-type natriuretic peptide acts as a microorganism-activated regulator of the skin commensals Staphylococcus epidermidis and Cutibacterium acnes in dual-species biofilms. Biology 2023, 12, 436. [Google Scholar] [CrossRef]
- World Health Organisation. Available online: https://www.who.int/news-room/fact-sheets/detail/antibiotic-resistance (accessed on 19 October 2023).
- Sanchez-Vizuete, P.; Orgaz, B.; Aymerich, S.; Le Coq, D.; Briandet, R. Pathogens protection against the action of disinfectants in multispecies biofilms. Front. Microbiol. 2015, 6, 705. [Google Scholar] [CrossRef]
- Veron, W.; Lesouhaitier, O.; Pennanec, X.; Rehel, K.; Leroux, P.; Orange, N.; Feuilloley, M.G. Natriuretic peptides affect Pseudomonas aeruginosa and specifically modify lipopolysaccharide biosynthesis. FEBS J. 2007, 274, 5852–5864. [Google Scholar] [CrossRef] [PubMed]
- Rosay, T.; Bazire, A.; Diaz, S.; Clamens, T.; Blier, A.S.; Mijouin, L.; Hoffmann, B.; Sergent, J.A.; Bouffartigues, E.; Boireau, W.; et al. Pseudomonas aeruginosa expresses a functional human natriuretic peptide receptor ortholog: Involvement in biofilm formation. MBio 2015, 6, e01033-15. [Google Scholar] [CrossRef] [PubMed]
- Desriac, F.; Clamens, T.; Rosay, T.; Rodrigues, S.; Tahrioui, A.; Enault, J.; Roquigny, L.; Racine, P.J.; Taupin, L.; Bazire, A.; et al. Different Dose-Dependent Modes of Action of C-Type Natriuretic Peptide on Pseudomonas aeruginosa Biofilm Formation. Pathogens 2018, 7, 47. [Google Scholar] [CrossRef] [PubMed]
- Louis, M.; Clamens, T.; Tahrioui, A.; Desriac, F.; Rodrigues, S.; Rosay, T.; Harmer, N.; Diaz, S.; Barreau, M.; Racine, P.J.; et al. Pseudomonas aeruginosa biofilm dispersion by the human atrial natriuretic peptide. Adv. Sci. 2022, 9, e2103262. [Google Scholar] [CrossRef] [PubMed]
- Louis, M.; Tahrioui, A.; Tremlett, C.J.; Clamens, T.; Leprince, J.; Lefranc, B.; Kipnis, E.; Grandjean, T.; Bouffartigues, E.; Barreau, M.; et al. The natriuretic peptide receptor agonist osteocrin disperses Pseudomonas aeruginosa biofilm. Biofilm 2023, 5, 100131. [Google Scholar] [CrossRef] [PubMed]
- Gannesen, A.V.; Lesouhaitier, O.; Racine, P.J.; Barreau, M.; Netrusov, A.I.; Plakunov, V.K.; Feuilloley, M.G. Regulation of monospecies and mixed biofilms formation of skin Staphylococcus aureus and Cutibacterium acnes by human natriuretic peptides. Front. Microbiol. 2018, 9, 2912. [Google Scholar] [CrossRef]
- Ovcharova, M.A.; Geraskina, O.V.; Danilova, N.D.; Botchkova, E.A.; Martyanov, S.V.; Feofanov, A.V.; Plakunov, V.K.; Gannesen, A.V. Atrial natriuretic peptide affects skin commensal Staphylococcus epidermidis and Cutibacterium acnes dual-species biofilms. Microorganisms 2021, 9, 552. [Google Scholar] [CrossRef]
- Drugs.com. Available online: https://www.drugs.com/monograph/azithromycin.html (accessed on 19 October 2023).
- Jaradat, Z.W.; Ababneh, Q.O.; Sha’aban, S.T.; Alkofahi, A.A.; Assaleh, D.; Al Shara, A. Methicillin resistant Staphylococcus aureus and public fomites: A review. Pathog. Glob. Health 2020, 114, 426–450. [Google Scholar] [CrossRef]
- Zhurina, M.V.; Gannesen, A.V.; Mart’Yanov, S.V.; Teteneva, N.A.; Shtratnikova, V.Y.; Plakunov, V.K. Niclosamide as a promising antibiofilm agent. Microbiology 2017, 86, 455–462. [Google Scholar] [CrossRef]
- Danilova, N.D.; Geraskina, O.V.; Diuvenji, E.V.; Feofanov, A.V.; Plakunov, V.K.; Gannesen, A.V. Inhibitory effect of norepinephrine on biofilm growth of the human skin commensal Kytococcus schroeteri H01. Microbiology 2021, 90, 666–669. [Google Scholar] [CrossRef]
- Lawson, T.S.; Connally, R.E.; Iredell, J.R.; Vemulpad, S.; Piper, J.A. Detection of Staphylococcus aureus with a fluorescence in situ hybridization that does not require lysostaphin. J. Clin. Lab. Anal. 2011, 25, 142–147. [Google Scholar] [CrossRef] [PubMed]
- 3SPCM Data Acquisition Software. Available online: https://www.becker-hickl.com/products/spcm-data-acquisition-software/ (accessed on 6 December 2023).
- The Fundamental Package for Scientific Computing with Python. Available online: https://numpy.org/ (accessed on 6 December 2023).
- General-Purpose Open Repository Zenodo. Available online: https://zenodo.org/records/6795861 (accessed on 6 December 2023).
- Heydorn, A.; Nielsen, A.T.; Hentzer, M.; Sternberg, C.; Givskov, M.; Ersbøll, B.K.; Molin, S. Quantification of biofilm structures by the novel computer program COMSTAT. Microbiology 2000, 146, 2395–2407. [Google Scholar] [CrossRef] [PubMed]
- Vorregaard, M. Comstat2-a Modern 3D Image Analysis Environment for Biofilms. DTU, DK-2800 Kgs. Master’s Thesis, Technical University of Denmark, Lyngby, Denmark, 2008. [Google Scholar]
- The Comprehensive Antibiotic Resistance Database. Available online: https://card.mcmaster.ca/ (accessed on 19 October 2023).
- Okonechnikov, K.; Golosova, O.; Fursov, M.; Ugene Team. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
- Bikandi, J.; Millán, R.S.; Rementeria, A.; Garaizar, J. In silico analysis of complete bacterial genomes: PCR, AFLP–PCR and endonuclease restriction. Bioinformatics 2004, 20, 798–799. [Google Scholar] [CrossRef] [PubMed]
- Yim, G.; Wang, H.H.; Davies, J. Antibiotics as signalling molecules. Philos. Trans. R. Soc. B 2007, 362, 1195–1200. [Google Scholar] [CrossRef] [PubMed]
- Romero, D.; Traxler, M.F.; López, D.; Kolter, R. Antibiotics as signal molecules. Chem. Rev. 2011, 111, 5492–5505. [Google Scholar] [CrossRef]
- ThermoFisher Scientific. Traditional Methods of Cell Lysis for Protein Extraction. Available online: https://www.thermofisher.com/ru/ru/home/life-science/protein-biology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/traditional-methods-cell-lysis.html (accessed on 19 October 2023).
- Zhou, L.; Li, T.; An, J.; Liao, C.; Li, N.; Wang, X. Subminimal inhibitory concentration (sub-MIC) of antibiotic induces electroactive biofilm formation in bioelectrochemical systems. Water Res. 2017, 125, 280–287. [Google Scholar] [CrossRef]
- Srinivasan, V.B.; Rajamohan, G.; Gebreyes, W.A. Role of AbeS, a novel efflux pump of the SMR family of transporters, in resistance to antimicrobial agents in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2009, 53, 5312–5316. [Google Scholar] [CrossRef]
- Szczepanowski, R.; Krahn, I.; Bohn, N.; Pühler, A.; Schlüter, A. Novel macrolide resistance module carried by the IncP-1β resistance plasmid pRSB111, isolated from a wastewater treatment plant. Antimicrob. Agents Chemother. 2007, 51, 673–678. [Google Scholar] [CrossRef]
- Poole, T.L.; Callaway, T.R.; Bischoff, K.M.; Warnes, C.E.; Nisbet, D.J. Macrolide inactivation gene cluster mphA-mrx-mphR adjacent to a class 1 integron in Aeromonas hydrophila isolated from a diarrhoeic pig in Oklahoma. J. Antimicrob. Chemother. 2006, 57, 31–38. [Google Scholar] [CrossRef]
- Hooper, D.C.; Jacoby, G.A. Topoisomerase inhibitors: Fluoroquinolone mechanisms of action and resistance. Cold Spring Harb. Perspect. Med. 2016, 6, a025320. [Google Scholar] [CrossRef] [PubMed]
- Li, X.Z.; Zhang, L.; Poole, K. SmeC, an outer membrane multidrug efflux protein of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2002, 46, 333–343. [Google Scholar] [CrossRef]
- Allard, J.D.; Bertrand, K.P. Membrane topology of the pBR322 tetracycline resistance protein. TetA-PhoA gene fusions and implications for the mechanism of TetA membrane insertion. J. Biol. Chem. 1992, 267, 17809–17819. [Google Scholar] [CrossRef] [PubMed]
- Nishino, K.; Latifi, T.; Groisman, E.A. Virulence and drug resistance roles of multidrug efflux systems of Salmonella enterica serovar Typhimurium. Mol. Microbiol. 2006, 59, 126–141. [Google Scholar] [CrossRef] [PubMed]
- Truong-Bolduc, Q.C.; Dunman, P.M.; Strahilevitz, J.; Projan, S.J.; Hooper, D.C. MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J. Bacteriol. 2005, 187, 2395–2405. [Google Scholar] [CrossRef] [PubMed]
- Truong-Bolduc, Q.C.; Strahilevitz, J.; Hooper, D.C. NorC, a new efflux pump regulated by MgrA of Staphylococcus aureus. Antimicrob. Agents Chemother. 2006, 50, 1104–1107. [Google Scholar] [CrossRef] [PubMed]
- McKessar, S.J.; Berry, A.M.; Bell, J.M.; Turnidge, J.D.; Paton, J.C. Genetic characterization of vanG, a novel vancomycin resistance locus of Enterococcus faecalis. Antimicrob. Agents Chemother. 2000, 44, 3224–3228. [Google Scholar] [CrossRef]
- Pettersson, A.; Hedner, J.; Hedner, T.; Held, P.; Swedberg, K.; Towle, A.C. Increased plasma levels of atrial natriuretic peptide in patients with congestive heart failure. Eur. Heart J. 1986, 7, 693–696. [Google Scholar] [CrossRef]
- Dietzen, D.J. Amino acids, peptides, and proteins. In Principles and Applications of Molecular Diagnostics; Rifai, N., Horwath, A.R., Wittwer, C.T., Eds.; Elsevier: Amsterdam, The Netherlands, 2018; pp. 345–380. [Google Scholar]
Gene | Primer | Sequence 5′–3′ |
---|---|---|
K. schrtoeteri | ||
FomB (phosphonic acid antibiotic) | Forvard | CCTGGTGAAGGGTGATCCTG |
Reverse | CGTAGACGTGCGTAGAGGAG | |
MecA (meropenem) | Forvard | GGAGATGATGGTGTCCGTGG |
Reverse | CTCTTCCATCATCGAGCGGG | |
AbeS (macrolides, aminocoumarins) | Forvard | CCGGATTCACCAACCCTCTC |
Reverse | AACCCCTTGATCAGCGTCAG | |
OleC (macrolides) | Forvard | CAGAGTTGATGGCCCTGGAG |
Reverse | CCGCTCGTAGAAGGGAATCG | |
NovA (aminocoumarins) | Forvard | GAACTTCCTGCCCTCGTTGG |
Reverse | CCGAGATGGTCGAGAGAAGC | |
Mrx (macrolides) | Forvard | CTGGTGGTCTTCAAGGTGCT |
Reverse | CGAGGAAGCCGATGACGTAG | |
MdtK (fluoroquinolones) | Forvard | TGTTCGTCTTCCTCGCCTAC |
Reverse | GATGCGTAGGTAGGTGACCC | |
ArlR (fluoroquinolones) | Forvard | GTGAACCAGACCCAGACCG |
Reverse | GAAGGGCTTGGTGACGTAGT | |
BaeR (aminoglycosides, fluoroquinolones) | Forvard | GGAGGGTGACAGCATCGAC |
Reverse | GAAGGTCAGGTCCAGCGTG | |
SmeS (aminoglycozides, cephalosporines) | Forvard | ATCCAGAGTCCGATCAACGC |
Reverse | TCACGGTGGATAAACGGGTG | |
TetA (tetracyclines) | Forvard | CGTCCCAGCAAGACCTACTC |
Reverse | GCTCGTCCAGGAAGATGACC | |
16 s rRNA | Forvard | TCAACCGTGGAGGGTCATTG |
Reverse | TGCACCACCTGTCACTTTGT | |
S. aureus | ||
MepR (tetracyclines) | Forvard | GCATTACAACGAACAGGTCCA |
Reverse | TCCCAGAGGTAGTCAGCCC | |
MgrA (peptide antibiotics, tetracyclines, cephalosporines) | Forvard | AGCGTGAACGTTCCGAAGTC |
Reverse | GAAGCTGAAGCGACTTTGTCA | |
NorC (fluoroquinolones) | Forvard | TTGTTGTTGGAGCAGGTGGT |
Reverse | CAGGCGTCCCTTTGATGAGT | |
VanTG (glycopeptides) | Forvard | CTTTGCCTGTGCTGACGAAC |
Reverse | ACCTCTACCGACTGTGGACT | |
LmrS (oxazolidine, macrolides, phenicols, aminoglycosides) | Forvard | TGGACCTGCGCTGCTTATAC |
Reverse | AGCCGTGCCATGTGAGATTT | |
SdrM (fluoroquinolones) | Forvard | TGGGCATAGTTGGCAGTGTT |
Reverse | ATGGCAATGATCGCAATCGG | |
16 s rRNA | Forvard | TCAACCGTGGAGGGTCATTG |
Reverse | TGCACCACCTGTCACTTTGT |
Gene | Amount of Amplification Product in Relation to Control Sample, 2−ΔΔCt | ||||
---|---|---|---|---|---|
ANP | Az 0.001 µg/mL | Az 4 µg/mL | Az 0.001 µg/mL + ANP | Az 4 µg/mL + ANP | |
fomB (phosphonic acid antibiotic) | 2.1 | 1.9 | −1.9 | 0 | 1.8 |
0 | −97.6 | 23.3 | −6.9 | −1.9 | |
1.4 | −1.7 | −1.4 | 1.7 | −64 | |
mecA (meropenem) | −4.5 | −2.7 | 3.1 | −6.6 | 1 |
3.7 | 1.6 | −1.2 | 19 | 4 | |
12.5 | −1.4 | 1.2 | 1.9 | −1.4 | |
abeS (macrolides, aminocoumarins) | 4.6 | 0 | 0 | 0 | 6.7 |
−3.8 | −76.1 | −19.2 | −7.2 | 5.4 | |
1.2 | 2.8 | 2 | 4.2 | 2 | |
oleC (macrolides) | −4.9 | −2.9 | 0 | −4.4 | −2.5 |
1.4 | −29.4 | −5.9 | −1.2 | −2.4 | |
0 | 2.1 | 1.3 | 3 | 12.2 | |
novA (aminocoumarins) | 1.7 | 0 | 3.8 | 0 | 2.5 |
1.7 | 1.1 | −1.6 | 6.8 | 10.9 | |
0 | −6.3 | 2.5 | −3.6 | −3.5 | |
mrx (macrolides) | −5.5 | 1.1 | −2 | −1.2 | 6.7 |
1.3 | −2 | 1.8 | 3.1 | 1.6 | |
1.1 | 2.5 | 1.3 | 1.8 | 1.6 | |
mdtK (fluoroquinolones) | −1 | −3.4 | −1.1 | −2.7 | 2.8 |
1.7 | −1.7 | 1.4 | −1.9 | −1.5 | |
1.1 | −1.7 | 1.8 | 2.3 | −6.6 | |
arlR (fluoroquinolones) | −2.2 | −4.8 | −1.3 | −1.6 | −3.5 |
−1.1 | −6.8 | −2.8 | −1.8 | −2.4 | |
−6.3 | −8.5 | −1.2 | −2.9 | 7.8 | |
baeR (aminoglycosides, fluoroquinolones) | −5.3 | 1.8 | −1.7 | −1.7 | −1.3 |
−5.3 | −4.3 | −4.3 | 1.6 | 1.6 | |
−2 | 1.7 | 1.6 | −1.5 | 16.2 | |
smeS (aminoglycozides, cephalosporines) | −11.1 | −5.4 | −1.6 | −1.6 | 33.4 |
−11.1 | 5 | −5.4 | 2 | −1.1 | |
−2.1 | 1.9 | 2 | −1 | 11.1 | |
tetA (tetracyclines) | −1.9 | −4.5 | −5.2 | −1.3 | 0 |
−1.4 | 2.1 | 0 | 15 | 15.6 | |
−1.3 | 5.3 | 2.4 | 0 | −3.9 |
Gene | Amount of Amplification Product in Relation to Control Sample, 2−ΔΔCt | ||||
---|---|---|---|---|---|
ANP | Az 0.001 µg/mL | Az 4 µg/mL | Az 0.001 µg/mL + ANP | Az 4 µg/mL + ANP | |
mepR (tetracyclines) | −1.25 | −11.55 | −1.1 | −1.67 | 2.45 |
−45.25 | 2.91 | −11.96 | 5.71 | −1.82 | |
1.37 | 1.1 | 3.32 | 1.59 | 1.79 | |
mgrA (peptide antibiotics, tetracyclines, cephalosporines) | 1.42 | 2.25 | 1 | 1.51 | 1.91 |
−4.56 | −2.89 | −5.82 | 8.44 | 1.83 | |
1.02 | −1.14 | 2.87 | 3.51 | 1.78 | |
norC (fluoroquinolones) | 4.17 | 20.25 | 4.47 | 3.81 | 4.17 |
−3.46 | −2.06 | −2.81 | 1.27 | −3.71 | |
−2.48 | 1.53 | 2.08 | 8.75 | −1.17 | |
vanTG (glycopeptides) | −17.39 | −1.73 | 1.37 | 1.51 | 0 |
−18.25 | −11.24 | −5.54 | 1.84 | −2.93 | |
1.62 | 1.43 | 5.78 | 15.89 | 1.11 | |
lmrS (oxazolidine, macrolides, phenicols, aminoglycosides) | −1.28 | 1.77 | −1.64 | −3.46 | 2.13 |
−74.03 | −24.59 | −8.11 | 3.39 | −2 | |
1.42 | 1.69 | 16.11 | 14.62 | 3.63 | |
sdrM (fluoroquinolones) | −1.19 | 4.69 | 1.04 | −3.07 | 2.28 |
−28.05 | −15.67 | −20.68 | 1.97 | −1.38 | |
1 | 1.09 | 5.74 | 32.67 | 4.23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Diuvenji, E.V.; Nevolina, E.D.; Solovyev, I.D.; Sukhacheva, M.V.; Mart’yanov, S.V.; Novikova, A.S.; Zhurina, M.V.; Plakunov, V.K.; Gannesen, A.V. A-Type Natriuretic Peptide Alters the Impact of Azithromycin on Planktonic Culture and on (Monospecies and Binary) Biofilms of Skin Bacteria Kytococcus schroeteri and Staphylococcus aureus. Microorganisms 2023, 11, 2965. https://doi.org/10.3390/microorganisms11122965
Diuvenji EV, Nevolina ED, Solovyev ID, Sukhacheva MV, Mart’yanov SV, Novikova AS, Zhurina MV, Plakunov VK, Gannesen AV. A-Type Natriuretic Peptide Alters the Impact of Azithromycin on Planktonic Culture and on (Monospecies and Binary) Biofilms of Skin Bacteria Kytococcus schroeteri and Staphylococcus aureus. Microorganisms. 2023; 11(12):2965. https://doi.org/10.3390/microorganisms11122965
Chicago/Turabian StyleDiuvenji, Ekaterina V., Ekaterina D. Nevolina, Ilya D. Solovyev, Marina V. Sukhacheva, Sergey V. Mart’yanov, Aleksandra S. Novikova, Marina V. Zhurina, Vladimir K. Plakunov, and Andrei V. Gannesen. 2023. "A-Type Natriuretic Peptide Alters the Impact of Azithromycin on Planktonic Culture and on (Monospecies and Binary) Biofilms of Skin Bacteria Kytococcus schroeteri and Staphylococcus aureus" Microorganisms 11, no. 12: 2965. https://doi.org/10.3390/microorganisms11122965