Improvements to the Rapid Detection of the Marine Pathogenic Bacterium, Vibrio harveyi, Using Loop-Mediated Isothermal Amplification (LAMP) in Combination with SYBR Green
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling and Isolation of Genomic DNA
2.2. Primer Design for PCR and LAMP Assays
2.3. Preparation of DNA Template
2.4. Recombinant Plasmid Construction for PCR and LAMP Analyses
2.5. Optimization of LAMP Reaction Condition with UV Analysis
2.6. Visualization of Amplification Products for LAMP Reaction Using SYBR Green
2.7. Sensitivity Test for the Detection of V. harveyi Using PCR and UV Analyses
2.8. Sensitivity Test for the Detection of V. harveyi Using LAMP-UV Analysis and LAMP-SYBR Green
2.9. Specificity Test of LAMP with UV Analysis for the Detection of Vibrio harveyi
2.10. Evaluation of LAMP-SYBR Green Assay with Grouper Infected with Vibrio harveyi
3. Results
3.1. LAMP Reaction Condition
3.2. Visual Detection of Amplification Products of LAMP by SYBR Green
3.3. Sensitivity Test of PCR-UV Analysis, LAMP-UV Analysis and LAMP-SYBR Green for the Detection of V. harveyi
3.4. Specificity Test of LAMP and UV Analysis
3.5. In Vivo Evaluation of Infected Grouper Using LAMP-SYBR Green
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
No | Sequence Description | Identities | Max identical | Accession Number |
---|---|---|---|---|
1 | V. harveyi strain ATCC 35084 | 245/245 | 100% | JF930599 |
2 | V. harveyi strain VIB 645 | 245/245 | 100% | DQ640259 |
3 | V. harveyi strain CAIM 363 | 245/245 | 100% | DQ640256 |
4 | V. harveyi strain CAIM 79 | 245/245 | 100% | DQ640255 |
5 | V. harveyi strain CAIM 520 | 245/245 | 100% | DQ517446 |
6 | V. harveyi strain 7207 | 244/245 | 99% | JF930600 |
7 | V. harveyi strain LPD 1-3-12 | 244/245 | 99% | FR719019 |
8 | V. harveyi strain VIB 572 | 244/245 | 99% | DQ640258 |
9 | V. harveyi strain CAIM 1792 | 244/245 | 99% | DQ640257 |
10 | V. harveyi strain M028 | 243/245 | 99% | JF930597 |
11 | V. harveyi strain ATCC 43516 | 243/245 | 99% | JF930595 |
12 | V. harveyi strain ATCC 33868 | 243/245 | 99% | JF930596 |
13 | V. harveyi strain LMG 4044 | 243/245 | 99% | JF930594 |
14 | V. harveyi strain LPD 1-3-31 | 243/245 | 99% | FR719020 |
15 | V. harveyi strain LPD 1-3-11 | 243/245 | 99% | FR719018 |
16 | V. harveyi strain LPD 1-3-10 | 243/245 | 99% | FR719017 |
17 | V. harveyi strain LPD 1-1-79 | 243/245 | 99% | FR719015 |
18 | V. harveyi strain LPD 1-1-39 | 243/245 | 99% | FR719014 |
19 | V. harveyi strain SA F3s 55 | 243/245 | 99% | FR719011 |
20 | V. harveyi strain SA F3s 38 | 243/245 | 99% | FR719010 |
21 | V. harveyi strain DPD 4-1-7 | 243/245 | 99% | FR719009 |
22 | V. harveyi strain LPD 1-3-35 | 243/245 | 99% | FM202687 |
23 | V. harveyi strain LPD 1-3-27 | 243/245 | 99% | FM202686 |
24 | V. harveyi strain LPD 1-1-10 | 243/245 | 99% | FM202684 |
25 | V. harveyi strain LPD 1-3-1 | 243/245 | 99% | FM202685 |
26 | V. harveyi strain DL F5 57 | 243/245 | 99% | FM202681 |
27 | V. harveyi strain H2 | 243/245 | 99% | FM202680 |
28 | V. harveyi strain SA F3s 40 | 243/245 | 99% | FM202679 |
29 | V. harveyi strain culture collection | 243/245 | 99% | FM202678 |
30 | V. harveyi strain VIB 658 | 243/245 | 99% | DQ640261 |
31 | V. harveyi strain VIB 653 | 243/245 | 99% | DQ640260 |
32 | V. harveyi strain CAIM 512 | 243/259 | 99% | DQ503438 |
33 | V. harveyi strain CAIM NBRC 15634 | 243/259 | 99% | DQ403146 |
34 | V. harveyi ToxR (toxR) | 243/245 | 99% | AY247418 |
35 | V. harveyi strain C259 | 242/245 | 99% | JF930598 |
36 | V. harveyi strain LPD 1-1-7 | 242/245 | 99% | FR719012 |
37 | V. harveyi strain SA F 4s 17 | 241/245 | 98% | FM202683 |
38 | V. harveyi strain SA F 1s 10 | 241/245 | 98% | FM202682 |
39 | V. harveyi strain H050704-1 | 241/245 | 98% | EF645830 |
References
- Montánchez, I.; Kaberdin, V.R. Vibrio harveyi: A brief survey of general characteristics and recent epidemiological traits associated with climate change. Mar. Environ. Res. 2020, 154, 104850. [Google Scholar] [CrossRef] [PubMed]
- Colwell, R.R.; Chun, J. The genus Vibrio and related genera. In Practical Handbook of Microbiology, 2nd ed.; Goldman, E., Green, L.H., Eds.; CRC Press: London, UK, 2008; pp. 287–294. [Google Scholar] [CrossRef]
- Yu, G.; Yu, H.; Yang, Q.; Wang, J.; Fan, H.; Liu, G.; Wang, L.; Bello, B.K.; Zhao, P.; Zhang, H.; et al. Vibri o harveyi infections induce production of proinflammatory cytokines in murine peritoneal macrophages via activation of p38 MAPK and NF-κB pathways, but reversed by PI3K/AKT pathways. Dev. Comp. Immunol. 2022, 127, 104292. [Google Scholar] [CrossRef] [PubMed]
- Mohd Yazid, S.H.; Mohd Daud, H.; Azmai, M.N.A.; Mohamad, N.; Mohd Nor, N. Estimating the Economic Loss Due to Vibriosis in Net-Cage Cultured Asian Seabass (Lates calcarifer): Evidence From the East Coast of Peninsular Malaysia. Front. Vet. Sci. 2021, 8, 644009. [Google Scholar] [CrossRef] [PubMed]
- Cano-Gomez, A.; Bourne, D.G.; Hall, M.R.; Owens, L.; Høj, L. Molecular identification, typing and tracking of Vibrio harveyi in aquaculture systems: Current methods and future prospects. Aquaculture 2009, 287, 1–10. [Google Scholar] [CrossRef]
- Zhang, X.H.; He, X.; Austin, B. Vibrio harveyi: A serious pathogen of fish and invertebrates in mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef] [Green Version]
- Tendencia, E.A. Vibrio harveyi isolated from cage-cultured seabass Lates calcarifer Bloch in the Philippines. Aquac. Res. 2002, 33, 455–458. [Google Scholar] [CrossRef]
- Ruwandeepika, H.A.D.; Jayaweera, T.S.P.; Bhowmick, P.P.; Karunasagar, I.; Bossier, P.; Defoirdt, T. Pathogenesis, virulence factors and virulence regulation of vibrios belonging to the Harveyi clade. Rev. Aquac. 2012, 4, 59–74. [Google Scholar] [CrossRef]
- Ransangan, J.; Lal, T.M.; Al-Harbi, A.H. Characterization and experimental infection of Vibrio harveyi isolated from diseased Asian seabass (Lates calcarifer). Malays. J. Microbiol. 2012, 8, 104–115. [Google Scholar] [CrossRef]
- Diggles, B.K.; Moss, G.A.; Carson, J.; Anderson, C.D. Luminous vibriosis in rock lobster Jasus verreauxi (Decapoda: Palinuridae) phyllosoma larvae associated with infection by Vibrio harveyi. Dis. Aquat. Org. 2000, 43, 127–137. [Google Scholar] [CrossRef]
- Austin, B.; Zhang, X.H. Vibrio harveyi: A significant pathogen of marine vertebrates and invertebrates. Lett. Appl. Microbiol. 2006, 43, 119–124. [Google Scholar] [CrossRef]
- Abdelsalam, M.; Elgendy, M.Y.; Elfadadny, M.R.; Ali, S.S.; Sherif, A.H.; Abolghait, S.K. A review of molecular diagnoses of bacterial fish diseases. Aquacult. Int. 2022. [Google Scholar] [CrossRef]
- Montánchez, I.; Ogayar, E.; Plágaro, A.H.; Esteve-Codina, A.; Gomez-Farrido, J.; Orruno, M.; Arana, I.; Kaberdin, V.R. Analysis of Vibrio harveyi adaptation in sea water microcosms at elevated temperature provides insights into the putative mechanisms of its persistence and spread in the time of global warming. Sci. Rep. 2019, 9, 289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, Y.; Zhang, Y.; Qi, G.; Ren, H.; Gao, G.; Jin, X.; Fang, H. Isolation, identification, and resistance gene detection of Vibrio harveyi from Scophthalmus maximus. Aquacult. Int. 2021, 29, 2357–2368. [Google Scholar] [CrossRef]
- Wei, Z.; Xin, L.; Zhang, W.; Bai, C.; Wang, C.; Li, C. Isolation and characterization of Vibrio harveyi as a major pathogen associated with mass mortalities of ark clam, Scapharca broughtonii, in summer. Aquaculture 2019, 511, 734248. [Google Scholar] [CrossRef]
- Xie, J.; Bu, L.; Jin, S.; Wang, X.; Zhao, Q.; Zhou, S.; Xu, Y. Outbreak of vibriosis caused by Vibrio harveyi and Vibrio alginolyticus in farmed seahorse Hippocampus kuda in China. Aquaculture 2020, 523, 735168. [Google Scholar] [CrossRef]
- Kim, K.I.; Won, K.M.; Lee, E.S.; Cho, M.; Jung, S.H.; Kim, M.S. Detection of Vibrio and ten Vibrio species in cage-cultured fish by multiplex polymerase chain reaction using house-keeping genes. Aquaculture 2019, 506, 417–423. [Google Scholar] [CrossRef]
- Hernandez, G.; Olmos, J. Molecular identification of pathogenic and nonpathogenic strains of Vibrio harveyi using PCR and RAPD. Appl. Microbiol. Biotechnol. 2004, 63, 722–727. [Google Scholar] [CrossRef]
- Costa, C.; Ferreira, G.D.; Simões, M.; Silva, J.L.; Campos, M.J. Real-Time PCR Protocol for Detection and Quantification of Three Pathogenic Members of the Vibrionaceae Family. Microorganisms 2022, 10, 2060. [Google Scholar] [CrossRef]
- Xiao, Y.; Huang, Z.; Yu, K.; Wang, M.; Gao, H.; Bai, X.; Jiang, M.; Wang, D. Distribution and Molecular Characteristics of Vibrio Species Isolated from Aquatic Environments in China, 2020. Microorganisms 2022, 10, 2007. [Google Scholar] [CrossRef]
- Mougin, J.; Roquigny, R.; Travers, M.A.; Grard, T.; Bonnin-Jusserand, M.; Le Bris, C. Development of a mreB-targeted real-time PCR method for the quantitative detection of Vibrio harveyi in seawater and biofilm from aquaculture systems. Aquaculture 2020, 525, 735337. [Google Scholar] [CrossRef]
- Loo, K.Y.; Law, J.W.F.; Tan, L.T.H.; Pusparajah, P.; Letchumanan, V.; Lee, L.H. Diagnostic techniques for rapid detection of Vibrio species. Aquaculture 2022, 561, 738628. [Google Scholar] [CrossRef]
- Garg, N.; Ahmad, F.J.; Kar, S. Recent advances in loop-mediated isothermal amplification (LAMP) for rapid and efficient detection of pathogens. Curr. Res. Microbial Sci. 2022, 3, 100120. [Google Scholar] [CrossRef] [PubMed]
- Pang, J.; Wang, Q.; Fei, Y.; Zhu, P.; Qiao, L.; Huang, H.; Dang, C.; Gao, W. A real-time recombinase polymerase amplification assay for the rapid detection of Vibrio harveyi. Mol. Cell. Probes 2019, 44, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Yuan, N.; Yang, H.; Zhang, Y.; Xu, H.; Lu, X.; Xu, H.; Zhang, W. Development of real-time fluorescence saltatory rolling circle amplification for rapid detection of Vibrio parahaemolyticus in seafood. Int. J. Food Sci. Technol. 2022, 57, 610–618. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, K.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated Isothermal Amplification of DNA. Nucleic Acid Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Teng, Y.; Xie, X.; Li, H.; Lv, J.; Gao, L.; Tian, F.; Jiang, Y. Development and evaluation of a one-step loop isothermal amplification for detection of spring viraemia of carp virus. J. Appl. Microbiol. 2008, 105, 1220–1226. [Google Scholar] [CrossRef]
- Wei, Z.; Wang, X.; Feng, H.; Ji, F.; Bai, D.; Dong, X.; Huang, W. Isothermal nucleic acid amplification technology for rapid detection of virus. Crit. Rev. Biotechnol. 2022, 1–18. [Google Scholar] [CrossRef]
- Yamazaki, W.; Ishibashi, M.; Kawahara, R.; Inoue, K. Development of a loop mediated isothermal amplification assay for sensitive and rapid detection of Vibrio parahaemolyticus. BMC Microbiol. 2008, 8, 163. [Google Scholar] [CrossRef] [Green Version]
- Thekisoe, O.M.M.; Kuboki, N.; Nambota, A.; Fujiksaki, K.; Sugimoto, C.; Igarashi, I.; Yasuda, J.; Inoue, N. Species-specific loop-mediated isothermal amplification (LAMP) for diagnosis of trypanosomosis. Acta Trop. 2007, 102, 182–189. [Google Scholar] [CrossRef]
- Tomlinson, J.; Barker, I.; Boonham, N. Faster, simpler, more-specific methods for improved molecular detection of Phytophthora ramorum in the field. Appl. Environ. Microbiol. 2007, 73, 4040–4047. [Google Scholar] [CrossRef] [Green Version]
- Parida, M.; Sannarangaiah, S.; Dash, P.K.; Rao, P.V.L.; Morita, K. Loop mediated isothermal amplification (LAMP): A new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 2008, 18, 407–421. [Google Scholar] [CrossRef]
- Kim, J.H.; Kang, M.; Park, E.; Chung, D.R.; Kim, J.; Hwang, S.S. A simple and multiplex loop-mediated isothermal amplification (LAMP) assay for rapid detection of SARS-CoV. BioChip J. 2019, 13, 341–351. [Google Scholar] [CrossRef] [Green Version]
- Eftekhari, A.; Alipour, M.; Chodari, L.; Dizaj, S.M.; Ardalan, M.; Samiei, M.; Sharifi, S.; Vahed, S.Z.; Huseynova, I.; Khalilov, R.; et al. A Comprehensive Review of Detection Methods for SARS-CoV-2. Microorganisms 2021, 9, 232. [Google Scholar] [CrossRef] [PubMed]
- Fellner, M.; Bonaventura, R.; Basiletti, J.; Avaro, M.; Benedetti, E.; Campos, A.; Dattero, M.; Russo, M.; Vladmirsky, S.; Molina, V.; et al. Evaluation of RT-qPCR and Loop-Mediated Isothermal Amplification (LAMP) Assays for the Detection of SARS-CoV-2 in Argentina. Genes 2021, 12, 659. [Google Scholar] [CrossRef]
- Biswas, G.; Sakai, M. Loop-mediated isothermal amplification (LAMP) assays for detection and identification of aquaculture pathogens: Current state and perspectives. Appl. Microbiol. Biotechnol. 2014, 98, 2881–2895. [Google Scholar] [CrossRef]
- Chen, D.; Liang, Z.; Ren, S.; Alali, W.; Chen, L. Rapid and Visualized Detection of Virulence-Related Genes of Vibrio cholerae in Water and Aquatic Products by Loop-Mediated Isothermal Amplification. J. Food Prot. 2022, 85, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.T.; Wu, Z.H.; Jian, J.C.; Lu, Y.S. Evaluation of a loop-mediated isothermal amplification method for the rapid detection of Vibrio harveyi in cultured marine shellfish. Lett. Appl. Microbiol. 2010, 51, 24–29. [Google Scholar] [CrossRef]
- Caipang, C.M.A.; Pakingking Jr, R.V.; Apines-Amar, M.J.S. Screening of vibriosis in Asian seabass, Lates calcarifer using loop-mediated isothermal amplification (LAMP) assay. Hum. Vet. Med. 2012, 4, 52–57. [Google Scholar]
- Yu, L.P.; Hu, Y.H.; Zhang, Z.H.; Sun, B.G. Development of a triplex loop-mediated isothermal amplification method for rapid on-site detection of three Vibrio species associated with fish diseases. Aquaculture 2013, 414–415, 267–273. [Google Scholar] [CrossRef]
- Thongkao, K.; Longyant, S.; Silprasit, K.; Sithigorngul, P.; Chaivisuthangkura, P. Rapid and sensitive detection of Vibrio harveyi by loop-mediated isothermal amplification combined with lateral flow dipstick targeted to vhhP2 gene. Aquac. Res. 2015, 46, 1122–1131. [Google Scholar] [CrossRef]
- Park, J.W. Principles and Applications of Loop-Mediated Isothermal Amplification to Point-of-Care Tests. Biosensors 2022, 12, 857. [Google Scholar] [CrossRef] [PubMed]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR? Cells 2021, 10, 1931. [Google Scholar] [CrossRef]
- Ransangan, J.; Mustafa, S. Identification of Vibrio harveyi isolated from diseased Asian seabass Lates calcarifer by use of 16S ribosomal DNA sequencing. J. Aquat. Anim. Health 2009, 21, 150–155. [Google Scholar] [CrossRef]
- Arunrut, N.; Prombun, P.; Saksmerprome, V.; Flegel, T.W.; Kiatpathomchai, W. Rapid and sensitive detection of infectious hypodermal and hematopoietic necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 2011, 171, 21–25. [Google Scholar] [CrossRef] [PubMed]
- Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem. Biophys. Res. Commun. 2001, 289, 15–154. [Google Scholar] [CrossRef] [PubMed]
- Soliman, H.; El-Matbouli, M. An inexpensive and rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplification. Virol. J. 2005, 2, 83. [Google Scholar] [CrossRef] [Green Version]
- Fukuta, S.; Nagai, H.; Suzuki, R.; Matsumoto, Y.; Kato, S.; Saka, N.; Horikawa, H.; Kato, S.; Miyake, N. Detection of Fomitiporia torreyae and Fulviformes umbrinellus by multiplex loop-mediated isothermal amplification (mLAMP) for diagnosis of Japanese pear dwarf. Ann. Appl. Biol. 2017, 170, 170–178. [Google Scholar] [CrossRef]
- Yao, Y.; Zhou, Q.; Feng, Y.; Leptihn, S.; Yu, Y.; Hua, X. Complete genome sequence of Vibrio harveyi strain ATCC 33866. Microbiol. Resour. Announc. 2022, 11, 7. [Google Scholar] [CrossRef]
- Yang, A.; Li, W.; Tao, Z.; Ye, H.; Xu, Z.; Li, Y.; Gao, Y.; Yan, X. Vibrio harveyi isolated from marine aquaculture species in eastern China and virulence to the large yellow croaker (Larimichthys crocea). J. Appl. Microbiol. 2021, 131, 1710–1721. [Google Scholar] [CrossRef] [PubMed]
- Pavlinec, Ž.; Zupičić, I.G.; Oraić, D.; Lojkić, I.; Fouz, B.; Zrnčić, S. Biochemical and molecular characterization of three serologically different Vibrio harveyi strains isolated from farmed Dicentrarchus labrax from the Adriatic Sea. Sci. Rep. 2022, 12, 7309. [Google Scholar] [CrossRef] [PubMed]
- Nimitphak, T.; Meemetta, W.; Arunrut, N.; Senapin, S.; Kiatpathomchai, W. Rapid and sensitive detection of Penaeus monodon nucleopolyhedrovirus (PemoNPV) by loop-mediated isothermal amplification combined with a lateral-flow dipstick. Mol. Cell. Probes 2010, 24, 1–5. [Google Scholar] [CrossRef]
- Eiken Chemical Co., Ltd. A Guide to LAMP Primer Designing (Primer Explorer V4). 2009. Available online: https://primerexplorer.jp/e/v4_manual/index.html (accessed on 1 February 2020).
- Ding, W.C.; Chen, J.; Shi, Y.H.; Lu, X.J.; Li, M.Y. Rapid and sensitive detection of infectious spleen and kidney necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Arch. Virol. 2010, 155, 385–389. [Google Scholar] [CrossRef] [PubMed]
- Rigano, A.L.; Marano, M.R.; Castagnaro, P.A.; Amaral, A.M.D.; Vojnov, A.A. Rapid and sensitive detection of Citrus Bacterial Cancer by loop mediated isothermal amplification combined with simple visual evaluation methods. BMC Microbiol. 2010, 10, 176–184. [Google Scholar] [CrossRef] [Green Version]
- Zeng, Y.; Wu, C.; He, Y. Loop-Mediated Isothermal Amplification–Based Microfluidic Platforms for the Detection of Viral Infections. Curr. Infect. Dis. Rep. 2022, 1–11. [Google Scholar] [CrossRef]
- Ren, X.F.; Li, P.C. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of porcine epidemic diarrhea virus. Virus Genes 2011, 42, 229–235. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, T.C.; Ferrari, H.F.; Bregano, L.C.; Silva-Frade, C.; Rosa, A.C.; Andrade, A.L. Visual detection of turkey coronavirus RNA in tissues and feces by reverse-transcription loop-mediated isothermal amplification (RT-LAMP) with hydroxynaphthol blue dye. Mol. Cell. Probes 2010, 24, 415–417. [Google Scholar] [CrossRef] [PubMed]
- Nzelu, C.O.; Gomez, E.A.; Cáceres, A.G.; Sakurai, T.; Martini-Robles, L.; Uezato, H.; Mimori, T.; Katakura, K.; Hashiguchi, Y.; Kato, H. Development of a loop-mediated isothermal amplification method for rapid mass-screening of sand flies for Leishmania infection. Acta Trop. 2014, 132, 1–6. [Google Scholar] [CrossRef]
- Wassermann, M.; Mackenstedt, U.; Romig, T. A loop-mediated isothermal amplification (LAMP) method for the identification of species within the Echinococcus granulosus complex. Vet. Pathol. 2014, 200, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.Y.; Wang, Y.L.; Meng, K.; Zhang, Y.X.; Xu, H.Y.; Ai, W. LAMP real-time turbidity detection for fowl adenovirus. BMC Vet. Res. 2019, 15, 256. [Google Scholar] [CrossRef]
- Toubanaki, D.K.; Margaroni, M.; Prapas, A.; Karagouni, E. Development of a nanoparticle-based lateral flow strip biosensor for visual detection of whole Nervous Necrosis Virus particles. Sci. Rep. 2020, 10, 529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, N.; Xiong, Y.; Wang, Y.; Lu, S.; Zhang, R.; Kang, Y.; Du, Y. A novel surface-enhanced Raman scattering method for detecting fish pathogenic bacteria with Fe3O4@PEI nanocomposite and concentrated Au@Ag. J. Raman Spectrosc. 2022, 53, 211–221. [Google Scholar] [CrossRef]
- Zhou, Q.; Lu, J.; Su, X.; Jin, J.; Li, S.; Zhou, Y.; Wang, L.; Shao, X.; Wang, Y.; Yan, M.; et al. Simultaneous detection of multiple bacterial and viral aquatic pathogens using a fluorogenic loop-mediated isothermal amplification-based dual-sample microfluidic chip. J. Fish Dis. 2021, 44, 401–413. [Google Scholar] [CrossRef] [PubMed]
- Hash, S.; Martinez-Viedma, M.P.; Fung, F.; Han, J.E.; Yang, P.; Wong, C.; Doraisamy, L.; Menon, S.; Lightner, D. Nuclear magnetic resonance biosensor for rapid detection of Vibrio parahaemolyticus. Biomed. J. 2019, 42, 187–192. [Google Scholar] [CrossRef] [PubMed]
- Zhao, N.; Zhang, B.; Xu, Z.; Jia, L.; Li, M.; He, X.; Bao, B. Detecting Cynoglossus semilaevis infected with Vibrio harveyi using micro RNAs from mucous exosomes. Mol. Immunol. 2020, 128, 268–276. [Google Scholar] [CrossRef]
- Zhao, N.; Jia, L.; Li, G.; He, X.; Zhu, C.; Zhang, B. Comparative mucous miRomics in Cynoglossus semilaevis related to Vibrio harveyi caused infection. Mar. Biotechnol. 2021, 23, 766–776. [Google Scholar] [CrossRef] [PubMed]
- Zhao, N.; Zhang, B.; Jia, L.; He, X.; Bao, B. Extracellular vesicles piwi-interacting RNAs from skin mucus for identification of infected Cynoglossus semilaevis with Vibrio harveyi. Fish Shellfish Immunol. 2021, 111, 170–178. [Google Scholar] [CrossRef]
- Zhao, N.; Deng, Q.; Zhu, C.; Zhang, B. Mucus piRNAs profiles of Vibrio harveyi-infected Cynoglossus semilaevis: A hint for fish disease monitoring. J. Fish Dis. 2022, 45, 165–175. [Google Scholar] [CrossRef]
- Zhao, N.; Jia, L.; He, X.; Zhang, B. Proteomics of mucosal exosomes of Cynoglossus semilaevis altered when infected by Vibrio harveyi. Dev. Comp. Immunol. 2021, 119, 104045. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′-3′) | Length (bp) |
---|---|---|
ToxR2-FIP | ATGGTTGAGCTGTCGGTGCTTGTTTCAGAGCCCACTGCTGAGA | 43 |
ToxR2-BIP | TCATCGTGTTAGTTGCCCTGCTTTTTTGTGATTCTGCAGGGTTGG | 45 |
ToxR2-F3 | GAAGCTCCAGTCGTTGACTT | 20 |
ToxR2-B3 | CATCACTGGCACGTTGTGA | 19 |
ToxR2-LF | TCGACGGCTGTTTCTGCTTTT | 21 |
ToxR2-LB | TCCTGTTGGCGTGTTAATGCT | 21 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rahman, A.M.A.; Ransangan, J.; Subbiah, V.K. Improvements to the Rapid Detection of the Marine Pathogenic Bacterium, Vibrio harveyi, Using Loop-Mediated Isothermal Amplification (LAMP) in Combination with SYBR Green. Microorganisms 2022, 10, 2346. https://doi.org/10.3390/microorganisms10122346
Rahman AMA, Ransangan J, Subbiah VK. Improvements to the Rapid Detection of the Marine Pathogenic Bacterium, Vibrio harveyi, Using Loop-Mediated Isothermal Amplification (LAMP) in Combination with SYBR Green. Microorganisms. 2022; 10(12):2346. https://doi.org/10.3390/microorganisms10122346
Chicago/Turabian StyleRahman, Ahmad Mukhlis Abdul, Julian Ransangan, and Vijay Kumar Subbiah. 2022. "Improvements to the Rapid Detection of the Marine Pathogenic Bacterium, Vibrio harveyi, Using Loop-Mediated Isothermal Amplification (LAMP) in Combination with SYBR Green" Microorganisms 10, no. 12: 2346. https://doi.org/10.3390/microorganisms10122346