Next Article in Journal
Biomarkers and Pathogenesis of Infectious and Autoimmune Diseases
Next Article in Special Issue
Nested PCR-Based Rapid Detection of Phytoplasma Leaf Wilt Disease of Coconut in Sri Lanka and Systemic Movement of the Pathogen
Previous Article in Journal
Investigation of the Virome and Characterization of Issyk-Kul Virus from Swedish Myotis brandtii Bats
Previous Article in Special Issue
Antagonism of Rhizosphere Streptomyces yangpuensis CM253 against the Pathogenic Fungi Causing Corm Rot in Saffron (Crocus sativus L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 1
10.3390/pathogens12010013
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Potential Biocontrol Activities of Populus Endophytes against Several Plant Pathogens Using Different Inhibitory Mechanisms

by
Sharon L. Doty
1,*,
Pierre M. Joubert
1,2,
Andrea Firrincieli
1,3,
Andrew W. Sher
1,
Robert Tournay
1,
Carina Kill
1,4,
Shruti S. Parikh
1,5 and
Patricia Okubara
6
1
School of Environmental and Forest Sciences, College of the Environment, University of Washington, Seattle, WA 98195, USA
2
Department of Plant & Microbial Biology, University of California, Berkeley, CA 94720, USA
3
Department for Innovation in Biological, Agro-Food and Forest Systems, University of Tuscia, 01100 Viterbo, Italy
4
Native Roots School, Taos, NM 87571, USA
5
Department of Food Science and Technology, University of California, Davis, CA 95616, USA
6
Department of Plant Pathology, Washington State University, Pullman, WA 99164, USA
*
Author to whom correspondence should be addressed.
Pathogens 2023, 12(1), 13; https://doi.org/10.3390/pathogens12010013
Submission received: 21 September 2022 / Revised: 17 December 2022 / Accepted: 19 December 2022 / Published: 22 December 2022
(This article belongs to the Special Issue Biological Control of Phytopathogens: Mechanisms and Applications)
Browse Figures
Review Reports Versions Notes

Abstract

:
The plant microbiome can be used to bolster plant defense against abiotic and biotic stresses. Some strains of endophytes, the microorganisms within plants, can directly inhibit the growth of plant fungal pathogens. A previously isolated endophyte from wild Populus (poplar), WPB of the species Burkholderia vietnamiensis, had robust in vitro antifungal activity against pathogen strains that are highly virulent and of concern to Pacific Northwest agriculture: Rhizoctonia solani AG-8, Fusarium culmorum 70110023, and Gaemannomyces graminis var. tritici (Ggt) ARS-A1, as well as activity against the oomycete, Pythium ultimum 217. A direct screening method was developed for isolation of additional anti-fungal endophytes from wild poplar extracts. By challenging pathogens directly with dilute extracts, eleven isolates were found to be inhibitory to at least two plant pathogen strains and were therefore chosen for further characterization. Genomic analysis was conducted to determine if these endophyte strains harbored genes known to be involved in antimicrobial activities. The newly isolated Bacillus strains had gene clusters for production of bacillomycin, fengicyn, and bacillibactin, while the gene cluster for the synthesis of sessilin, viscosin and tolaasin were found in the Pseudomonas strains. The biosynthesis gene cluster for occidiofungin (ocf) was present in the Burkholderia vietnamiensis WPB genome, and an ocf deletion mutant lost inhibitory activity against 3 of the 4 pathogens. The new isolates lacked the gene cluster for occidiofungin implying they employ different modes of action. Other symbiotic traits including nitrogen fixation, phosphate solubilization, and the production of auxins and siderophores were investigated. Although it will be necessary to conduct in vivo tests of the candidates with pathogen-infected agricultural crops, the wild poplar tree microbiome may be a rich source of beneficial endophyte strains with potential for biocontrol applications against a variety of pathogens and utilizing varying modes of action.

1. Introduction

Pathogenic microorganisms cause crop losses equivalent to billions of dollars annually worldwide. There has been an alarming trend of increasing numbers of new fungal and oomycete plant pathogens [1], with fungal pathogens accounting for nearly 15% of worldwide crop losses each year [2]. The plant pathogens Rhizoctonia solani, Fusarium culmorum, Gaeumannomyces graminis var. tritici (Ggt), and the oomycete, Pythium ultimum, are widespread pathogens of economically important crops including wheat, rice and barley, grain, legumes, and brassicas worldwide, causing root rot, take-all disease, and damping off [3,4]. Resistant plant varieties take decades to develop and pathogens often develop resistance within several years [5]. Commercial growers rely on a variety of chemicals to control the plant pathogens. However, widespread use of these chemicals comes at high economic and environmental costs such as potentially harming beneficial microorganisms and insects. Additionally, organic farmers are not permitted to use synthetic chemicals. An alternative method is biocontrol that involves the use of non-pathogenic microbial strains to combat the pathogens [5]. Specific strains of bacteria and fungi are known to suppress growth of soilborne fungal pathogens of crop plants under controlled conditions [6,7], but commercialization for the field involves additional criteria [8]. These include targeted (pathogen-specific) activity, durability of activity in a range of soil types and environmental conditions, and application method [9,10]. As such, bio-based products have developed more slowly than synthetic products but represent a growing proportion of the pesticide industry. For soil-borne pathogens, seed treatment is considered to be the application method of choice. Selection of biocontrol microbial isolates or their metabolites for commercialization purposes should ideally be based on multiple pathogen isolates of the same species because genotypes of the plant, pathogen and biocontrol microbe appear to condition the biocontrol interaction [11,12]. Understanding the mode of action of biocontrol metabolites and their impact on the rhizosphere microbiome also will help in the development of a successful bio-based product. The limited number of biocontrol strains in use, however, is largely from the rhizosphere or soil, and as such, could easily be out-competed by other soil microorganisms [13].
Endophytes, the non-pathogenic microorganisms within plants, represent a largely untapped portion of the plant microbiome. In a screen of endophytes isolated from plants growing on the west side of the Washington State Cascade Mountain Range, 21 percent of cultured isolates from poplar (Populus) and willow (Salix) had in vitro antimicrobial activity against at least 1 pathogen out of 4 tested [14]. This high frequency of anti-microbial activity likely reflects the strong selective pressure in natural systems for resistance to a broad array of pathogens. Because of this pressure towards mutualism with their host, endophytes have developed a number of other traits that increase plant health, growth, yield, and stress tolerance [15,16,17,18]. Bacterial endophytes can systemically colonize plants [19], giving them a key advantage over rhizospheric strains and some fungal endophyte strains which can be highly localized. Endophytes may therefore offer a more stable option for biocontrol compared to existing methods, defending their host from pathogens from within.
Previous studies on potential biocontrol strains from poplar were based on endophytes that had been isolated for other purposes such as nitrogen fixation [14]. For example, several of the Burkholderia endophytes exhibited particularly robust inhibition in vitro against several plant pathogens despite the original selection method being growth on nitrogen-limited medium. A particularly robust antimicrobial strain, WPB, described herein, is a strain of B. vietamiensis, a member of the Burkholderia cepacia complex (BCC), a group found in a variety of ecological niches including soil, plants and animals but has mambers which present health hazards [20].
With the hypothesis that direct screening for antifungal activity of poplar endophytes would allow for the isolation of a wider variety of potential biocontrol strains, a novel method for screening plant extracts for antifungal endophytes was developed, without any pre-screening or isolation steps required. Using this method, we isolated a variety of new endophyte strains from wild poplar with in vitro antifungal activities and report the genomic analysis on the potential inhibitory mechanisms. Genomic analysis of B. vietnamiensis strain WPB indicated that occidiofungin, a known antimicrobial compound, could be key to its effectiveness. Using targeted mutagenesis and phenotypical and biochemical confirmation, it was shown that WPB inhibits pathogens through multiple modes of action. Here, we also report on the genomic analysis of additional endophytes isolated from poplar that inhibited selected pathogen strains in vitro. The goal of this study was to isolate strains that employ different mechanisms of antimicrobial activities, reducing the risk of pathogens developing resistance.

2. Results

2.1. Antimicrobial Activities of Strain WPB

Burkholderia vietnamiensis strain WPB was originally isolated in a screen for nitrogen-fixing endophytes of wild poplar [21]. The strain produces auxin and promotes plant growth under nitrogen-limited conditions [22]. To determine if the strain also had potential biocontrol activity against plant pathogens, the dual plate inhibition assay was used against four virulent strains of agricultural pathogens of concern in the Pacific Northwest. In vitro assays indicated that WPB strongly inhibited the growth of Rhizoctonia solani AG-8, Fusarium culmorum 70110023, and Ggt ARS-A1 while the oomycete Pythium ultimum 217 was inhibited by WPB minimally (Figure 1, Table 1).

2.2. Isolation and Screening of New Anti-Fungal Endophytes

Strain WPB and our other previously isolated endophyte strains with in vitro antifungal activities [14] had been selected based on other plant symbiotic traits. To more directly isolate strains with potential biocontrol activity, hundreds of endophytes were isolated from wild poplar trees and screened specifically for in vitro antifungal activity against R.solani AG-8. The active strains were then tested against the other plant pathogens using the dual plate assay. Measurements of the zone of inhibition were recorded and then converted into a qualitative scale for ease of comparison between the different fungal assays (Table 2). All of the endophytes had some level of activity against at least two plant pathogen strains, but the strength of the inhibitory response varied from pathogen to pathogen. For example, strain AFE8 demonstrated a strong inhibitory effect on R. solani AG-8 but a weaker effect on the growth of F. culmorum 70110023 or Ggt ARS-A1. The oomycete, P. ultimum 217, appeared to be more resistant to endophyte-induced inhibition, with none of the strains being capable of strong inhibition. Ggt, on the other hand, was strongly inhibited by 7 of the 11 endophytes. Only two endophytes, AFE4A and AFE5 inhibited all four of the pathogen strains tested. The eleven most active endophyte strains were selected for strain identification by rDNA sequencing (Table 2).

2.3. Analyses for Potential Antimicrobial Mechanisms

2.3.1. In silico Analysis of Antimicrobial Biosynthetic Gene Clusters in Strain WPB

The antiSMASH analysis predicted several biosynthetic gene clusters (BGCs) with antimicrobial activities in WPB, including clusters for occidiofungin A, the polyketide cepacin A, and the siderophore ornibactin (Table 3). The antiSMASH analysis did not identify any BGCs for other antifungal compounds, such as pyrrolnitrin, cepacidine A, and the putative lipopeptide AFC-BC11, that have been identified in other members of the BCC [23]. Occidiofungin, originally isolated from Burkholderia contaminans MS14, has broad-spectrum antifungal activity against plant and animal pathogens [24]. WPB contains an occidiofungin A cluster with 94% similarity to the MIBiG reference gene cluster from Burkholderia pyrrocinia Lyc2 (Figure 2), a plant-associated strain showing strong antifungal activity against Aspergillus flavus, Cladosporium sp, Cochliobolus heterostrophus, Colletotrichum acutatum, Gaeumannomyces graminis var. tritici, Geotrichum candidum, Glomerella cingulata and Thielaviopsis basicola [25].
WPB also contains a BGC for the siderophore ornibactin, which has been shown to have antibacterial activities against the plant-pathogenic bacteria Erwinia amylovora, Xanthomonas citri pv. malvacearum, and Clavibacter michiganensis subsp. michiganensis [26]. In members of the BCC, ornibactin has been implicated in complications in immunocompromised individuals, particularly those with cystic fibrosis [27]. While the ornibactin cluster in WPB has a 93% genes similarity to the B. cepacia 89 reference cluster (Figure 2), it lacks the orbK gene, which is consistent other members of the B. vietnamiensis species, including the type strain B. vietnamiensis LMG 10929, a plant-associated strain isolated from the rhizosphere of rice [28].
The third BGC identified in WPB, the polyketide cepacin A, a hserlactone with potent activity against both Gram-positive bacteria and the plant pathogen Pythium ultimum, the parasitic oomycete formerly classified as fungi [23]. While the cepacin A BGC in WPB shares only a 62% gene similarity with the B. ambifaria IOP40-10 cepacin A reference cluster in MIBiG (Figure 2), it shares high similarity with other B. vietnamiensis strains, including the type strain LMG 10929 (Appendix A Figure A1). The B. vietnamiensis cepacin A clusters contained two hypothetical proteins of unknown function, as well as several biosynthetic, transport, and regulatory genes not found in the B. ambifaria cluster (data not shown).

2.3.2. In Silico Analysis of Antimicrobial Biosynthetic Gene Clusters in the AFE Strains

The genomes of the AFE strains were mined using antiSMASH to detect BGCs putatively involved in the antifungal activity observed in the plate inhibition assays. AFE strains showing low or no antifungal activity were also included in this analysis since BGC can be silent under the experimental condition used for testing [29]. As expected, the AFE strains with the highest number of BGCs were those belonging to the species Pseudomonas and Bacillus, while Pseudomonas AFE16 and the Enterobacteriaceae AFE strains carried the lowest number of BGCs. All the Pseudomonas strains, except AFE16, carried at least one BGC involved in the synthesis of a secondary metabolite with antimicrobial activity (Table 3). Specifically, Pseudomonas sp. AFE8 carried one BGC sharing 100% similarity score against the viscosin BGC from Pseudomonas fluorescens SBW25, and a BGC showing a 60% similarity with the tolaasin I / tolaasin F from Pseudomonas costantinii DSM 16734 (Figure 3). When compared to the tolaasin reference cluster, the BGC from AFE8 shows only a partial conservation of core and auxiliary biosynthetic genes, suggesting that this cluster could be involved in the synthesis of a tolaasin-like non ribosomal peptide with a different structure and activity from tolaasin (Figure 3). AFE5 carried two BGCs, respectively involved in the synthesis of tolaasin and sessilin, and sharing a score similarity of 80 and 66%. These two clusters were both detected at the edges of contigs. A close inspection indicates that sessilin and tolaasin BGC in AFE5 are part of a single cluster involved in the synthesis of sessilin (Figure 3). Tolaasin, sessilin, and viscosin are well-characterized non-ribosomal peptides with antifungal activity. The tolaasin was first characterized in the fungal pathogen Pseudomonas tolaasii which is the causative agent of the Brown blotch disease, while viscosin and sessilin have been found to be effective against Aspergillus fumigatus, Batrachochytrium dendrobatidis, Rhizoctonia solani, and Pythium myriotylum [30,31].
The Bacillus AFE strains AFE4A and AFE21B carried the highest number of BGCs with antifungal and antimicrobial activity. Both AFE4A and AFE21B shared one copy of the BGCs difficidin, macrolactin H, bacillaene, fengycin, bacilysin, bacillomycin D and surfactin. Among these, macrolactins, bacillomycin and fengycin have been shown to inhibit the growth of several plant pathogens including Fusarium graminearum, Botrytis cinerea, Colletotrichum acutatum, Rhizoctonia solani, Magnaporthe grisea, and Gaeumannomyces graminis var. tritici [32,33,34]. Interestingly, in both AFE4A and AFE21B, the bacillomycin D and fengycin BGCs were located in the same chromosomal region, suggesting that these antifungal agents could act synergistically in the inhibition of the fungal pathogen (Figure 4).

2.3.3. Occidiofungin Mutant of WPB

Gu and colleagues demonstrated through Tn5 mutagenesis of Burkholderia contaminans that an occidiofungin gene cluster was required for antifungal activity against Rhizoctonia solani, Pythium ultimum and others [35]. Since strain WPB contains the same gene cluster, we chose one of the genes, ocfE, as a mutagenesis target to determine if the compound was responsible for the in vitro antimicrobial activities we observed. Extracts from the wild-type and mutant strains were tested by mass spectrometry. Wild-type WPB grown with R. solani AG-8 produced a higher level of occidiofungin than when grown without the fungus, indicating it may be inducible (Figure 5, comparing black and blue chromatograms). Furthermore, the mass spectrometry results confirmed that the ocf mutant did not produce occidiofungin (Figure 5, red chromatogram). The ocf mutant retained minimal ability to inhibit R. solani AG-8 growth (Table 1 and Figure 1), implicating this pathway as a major mechanism this strain uses to directly block pathogenic fungi. This was further supported by the loss of inhibition by the mutant toward the fungi F. culmorum 70110023 or P. ultimum 217. However, the mutant retained inhibitory activity against Ggt ARS-A1, indicating that a different mode of action is utilized (Figure 1).

2.3.4. Confirmation of the Lack of Occidiofungin from AFE Strains by LC-MS-MS

Since occidiofungin was a key antimicrobial compound from strain WPB, the AFE strains were also screened by mass spectrometry to confirm in silico gene analysis indicating a lack of the occidiofungin gene cluster. None of the strains displayed a peak indicative of occidiofungin (data not shown).

2.4. Symbiotic Traits of the AFE Strains

Siderophore production is a common trait of plant-associated microorganisms that is thought to play a biocontrol role by sequestering iron away from pathogens and preventing their growth. The siderophore production assay was used to determine this activity in the endophytes. Seven of the eleven strains exhibited strong to very strong siderophore production (Table 4).
Tests indicative of other symbiotic traits including phytohormone production, nitrogen fixation and phosphate solubilization were performed on the 11 active strains. Strains AFE 3, 9, 14, and 22 were strong producers of auxins (Appendix A Figure A2) so they may enhance root growth. Most of the strains were able to solubilize tricalcium phosphate, especially strains AFE 1, 3, and 14. Though solubilization of other phosphate salts such as iron phosphate and aluminum phosphate should be tested [36], solubility of tricalcium phosphate can be an indicator of the ability to increase the bioavailability of phosphate, an important macronutrient [37]. Strains AFE3 and 9 produced a nitrogenase gene PCR product and were positive in the acetylene reduction assay for nitrogenase activity (Appendix A Figure A3).

2.5. Phylogenomic Analysis of WPB and AFE Strains for Suitability for Use in Agriculture

For the strains to be used directly in agriculture, they must not be phylogenetically affiliated to known human and plant pathogens. Therefore, a phylogenomic analysis was carried out to place WPB and the AFE strain into clusters of phylogenetically related genomes at the species level.
Whole-genome taxonomic classification identified WPB as B. vietnamiensis, matching most closely with the type-strain B. vietnamiensis LMB 10929, and clustering with other members of the BCC. Additionally, WPB was predicted by PathFinder as being a potential human pathogen with high probability (0.843), identifying 246 sequences belonging to a pathogenic protein families and 24 sequences belonging to non-pathogenic protein families.
All Enterobacteriaceae AFE strains were included in already known species clusters (Table A2). The Rahnella strains AFE22 and AFE3 were identified as R. variigena and R. victoriana, respectively, and the reference strains of the species are potential plant pathogens being isolated from various oak species exhibiting symptoms of Acute Oak Decline (AOD) and exhibited a mild hypersensitive response on tobacco plants [38]. On the other hand, the AFE9 strain was identified as Rahnella aceris, which includes only non-pathogenic plant-associated Rahnella isolated from Acer pictum sap [39]. The last Enterobacteriaceae strain, Erwinia AFE1, was identified as Erwinia billingiae. While Erwinia species include several renowned plant and human pathogens, the representative strain of the E. billingiae species cluster lacks several virulence-associated genes found in the plant pathogens E. amylovora, E. pyrifoliae, and E. piriflorinigrans [40,41]. The E. billingiae species clusters include 7 genomes from soil and host-associated (plants and Caenorhabditis elegans) isolates.
The Bacillus strains AFE21B and AFE4A were identified as members of the Bacillus velezensis species (Table A2) which include strains already proposed to EPA and EFSA for use in agriculture as a biopesticide, and as an additive in animal feed [42,43].
Pseudomonas strains AFE8 and AFE5 were affiliated to species-clusters of the P. fluorescens complex which currently includes 48 known Pseudomonas species. Specifically, AFE8 and AFE5 were classified as P. lurida and P. kitaguniensis, respectively (Table A2). The P. lurida species-cluster consists of 25 Pseudomonas strains mostly identified as environmental and host-associated (C. elegans) isolates, while only one strain, i.e., AU10973 (GCA_000801835.1), was isolated from cystic fibrosis (CF) patients [44]. While P. fluorescens strains are not considered an etiologic agent of pulmonary diseases, members of the P. fluorescens species complex are identified at a low frequency in clinical samples from CF patients. It is worth mentioning that given their extreme metabolic versatility, members of the P. fluorescens complex are naturally occurring at low levels in the indigenous microbiota of various body sites, and are also moderately abundant in the respiratory microbiota [45]. Despite this, P. fluorescens is rarely associated with acute infections [46]. Finally, the Pseudomonas strain AFE5 was placed within a species cluster representative of 5 plant-associated Pseudomonas, with the isolate MAFF 212408 being type-strain for the species P. kitaguniensis. The P. kitaguniensis strain MAFF 212408 (GCF_009296165.1) was identified as the causative agent of the ‘bacterial rot disease of Welsh onion’.

3. Discussion

The goal of this study was to isolate endophyte strains that could inhibit key pathogen strains of concern in the Pacific Northwest. To select for such activities, it is necessary to conduct the initial testing in vitro. Once candidate strains are identified, the next phase is to complete genomic sequencing and analysis for genes known to be involved in human pathogenicity since the ultimate goal is to use the inhibitory strains in agriculture. A case in point is that, in a previous study, the endophytes showing the strongest in vitro antifungal activity were of the genus Burkholderia [14]. Burkholderia have been studied for their abilities in plant growth promotion, phytoremediation, endophytic nitrogen fixation, reducing plant abiotic stresses and as biocontrol agents [47,48,49,50,51], while others are known as human pathogens [20]. Since the original Burkholderia genus includes such diverse species, molecular signature and phylogenomic analysis were performed that divided them into Burkholderia and Paraburkholderia genera [52]. A number of root-associated Burkholderia strains also lacked genes associated with human pathogenicity [53]. Subsequently, a new genus, Caballeronia gen. nov.was proposed that contains non-pathogenic and plant-associated members of both Burkholderia and Paraburkholderia [54]. The previously isolated strain of Burkholderia vietnamiensis, WPB, was included in this study of potential mechanisms of antimicrobial activities, although it would not be used in agriculture since this strain falls within the Burkholderia BCC and was determined to harbor genes associated with human pathogenicity. Nonetheless, it served to provide valuable insight into inhibitory mechanisms.
Interestingly, when studying poplar leaves growing along the Snoqualmie River in Washington State, nearly one-fourth of the bacterial microbiome was found to be of the Burkholderia/Paraburkholderia genus (unpublished data). In a recent study, the Burkholderiaceae, along with Pseudomonadaceae and Enterobacteriaceae, was one of the most abundant families detected in the core microbiome of wild poplar inhabiting xeric riparian zones, and riparian zones with mid hot-dry and moist (mesic) climates [55]. Our study further supports the concept that antimicrobial/antifungal producing strains are a core component of the poplar microbiome, and not linked to a specific environment. The high prevalence of Burkholderia points to the importance of this genus in the plant microbiome.
In an effort to isolate a broader biodiversity of endophytes, a different technique was employed in this study. Rather than testing individual isolates for antifungal activity, poplar extracts containing endophytic microorganisms were challenged directly against a fungal pathogen. Microbes were then isolated from zones of inhibition. Though all the strains were originally selected for the ability to inhibit R. solani AG-8, many of them also inhibited other fungal pathogen strains regardless of evolutionary distance. Due to the vast evolutionary distance from the fungi to oomycetes, it was not surprising that few of the strains had activity against P. ultimum. However, this method of challenging extracts rather than single isolates could be applied to any pathogen strains of interest to rapidly select potential biocontrol strains. Though strains AFE 3, 14, and 22 were originally isolated with apparent inhibitory activity against R. solani AG-8, when fully purified, they were no longer active against this pathogen. It is possible that they required a microbial partner or phytochemicals mimicking host-like conditions that were lost during the strain purification phase. For instance, the expression of T6SS, which can be used to deliver antifungal effectors, is silent unless host-like conditions are mimicked [56].
One goal of this study was to isolate strains that each employed different mechanisms of inhibiting plant pathogens. Application of a consortium of strains with complementary antimicrobial activities would be ideal in biocontrol situations, allowing for possible synergies between modes of action and reducing the risk of pathogens developing resistance. In this respect, it has been demonstrated that a combination of three biocontrol species was superior for inhibiting Fusarium [57]. Some of the antimicrobials produced by the Pseudomonas AFE strain have similar modes of action. For instance, the most likely action of the cyclic lipodepsipeptides (CLPs) of the Viscosin-groups involves the direct interaction with the cellular membrane through pore-formation [58]. A similar activity was observed for the lipopeptides of the Tolaasin-group which have the ability to form ion channels into lipid bilayer [59]. Despite this, prior to the development of a microbial consortium with enhanced antifungal potential, the positive interaction between members of the consortium must be assessed. Indeed, Bacillus and Pseudomonas could compete for the same niche, where Bacillus lipopeptides are used to counteract and reduce the toxicity of the lipopeptides synthesized by Pseudomonas [60].
In this study, AFE4A was the best performing strain in terms of breadth and strength of in vitro antifungal activities. AFE4A typically had wide zones of inhibition implying an antifungal mechanism based on the secretion of multiple secondary metabolites with antifungal activity. This is in partial agreement with the antiSMASH analysis which identifies AFE4A, and also AFE21B, as the AFE strains with the greatest antifungal potential. AFE4A and AFE21B were isolated from wild poplars inhabiting two different river systems. Despite this, both strains carried the same BGC’s with antifungal activities and yet had strikingly different inhibition patterns. This would provide an opportunity to study the molecular mechanisms underlying the biosynthesis of the antifungals rather than focusing on comparative genome analysis. The presence of a single lanthipeptide antibiotic gene cluster was found to distinguish AFE4A from AFE21B. Since AFE4A had the most widespread activity against all pathogens tested and the most effective antifungal activity, this defining lanthipeptide (Lantibiotics) gene cluster merits further investigation. However, all the Lantibiotics characterized so far in Bacillus species possess antimicrobial activity, while Pinesin A and B, which are produced by the Gram-negative Chitinophaga pinensis, are the only known Lantibiotics with antifungal activity [61,62]. Therefore, the differences observed between AFE4A and AFE21B could be explained only by different antifungal mechanisms or by differing levels of expression of the BGC’s.
The genome of the yeast strain AFE11, Aureobasidium pullulans, was not sequenced. However, A. pullulans is known to produce a variety of antimicrobial compounds including toxins, volatile compounds, degradative enzymes, and siderophores [42,63]. Described as being a generalist biocontrol strain, it may be the simultaneous production of such a diverse arsenal that leads to its success.
The genome of WPB was found to contain the biosynthetic genes required for the production of occidiofungin, a known antifungal compound. Mutagenesis of the biosynthetic gene ofcE in WPB highlighted the importance of this antimicrobial to the powerful inhibition exhibited by this strain. The results also indicated that other inhibitory activities are at play, although the mechanism still needs to be resolved as no additional BCGs with known antifungal activities were found in WPB. As a genus, Burkholderia possess large, complex, and variable genomes and ongoing efforts to identify novel antimicrobial compounds will continue to benefit from rapidly growing libraries of sequenced genomes, including the sequencing and assembly of the genomes from 450 members of Burkholderiaceae completed by Mullins et al. (2020) [64]. The ofc mutant retained strong inhibition of Ggt ARS-A1 despite the lack of occidiofungin production. Genomic analyses and confirmation through LC-MS has shown that the AFE strains also lack the capability to produce occidiofungin. This implies antifungal mechanisms in all strains tested that are distinct from occidiofungin.
It may be that endophytes are uniquely positioned to evolve antifungal mechanisms that are targeted specifically against pathogens. Populus associates with both ectomycorrhizal and arbuscular mycorrhizal fungi; therefore, forcing co-evolution of the bacterial endophytes with these essential fungal partners. Bacterial endophytes must therefore be capable of co-habitation with these beneficial fungi despite the anti-fungal activities demonstrated here against pathogens. Living with a host plant would apply a heavy evolutionary pressure to develop mechanisms to differentiate between pathogens and beneficial endophytic fungi. The unique niche occupied by endophytes has encouraged the development of several other beneficial traits including nitrogen fixation, phosphate solubilization, and phytohormone production. Though the strains isolated in this study were selected for the ability to inhibit pathogens, several had these beneficial traits as well. Endophytes are a rich resource with great potential to improve the resilience of crops to environmental challenges, both abiotic and biotic.

4. Materials and Methods

4.1. Pathogen Strains

The pathogen strains were sourced and maintained as described [14]. Rhizoctonia solani AG-8 isolate C1 and Fusarium culmorum 70110023 were maintained on potato dextrose agar (PDA). Pythium ultimum 217 was cultured on SY agar. Gaemannomyces graminis var. tritici ARS-A1was maintained on 1/5 X PDA. The pathogen strains used in this study are highly virulent and of concern to Pacific Northwest agriculture.

4.2. Endophyte Extraction from Plant Tissue

Anti-fungal endophyte (AFE) strains were isolated from wild poplar stems collected from the riparian zones of the Snoqualmie, Skykomish, and Yakima Rivers of Washington State, USA. Branches were surface-sterilized with 10% commercial bleach for 10 min and 1% Iodophor for 5 min, followed by three sterile water rinses. Tissue was ground directly into rich media using a mortar and pestle. Extracts were transferred to sterile conical tubes and large particles allowed to settle out before use.

4.3. High-Throughput Antifungal Screen and Inhibition Assays

Endophytes from the poplar extracts were screened for activity before isolation by pipetting diluted plant extract in a circle around the entire perimeter of PDA plates, which had been centrally inoculated with Rhizoctonia solani AG-8. As the pathogen grew, reaching the extract along the border, zones of inhibition were observed. The mixed population bacterial growth central to the inhibition was then streak-purified on MGL agar with incubations at 30 °C. Purified strains were tested for antifungal activity using the dual plate inhibition assay as described [14]. New isolates with antifungal activity were cryogenically stored in glycerol at −80 °C and named with the AFE designation. All subsequent testing of inhibition by the AFE strains as well as WPB and the WPB ocf mutant were done through the dual plate inhibition assay as well. Individual assays were performed in duplicate (two bacterial spots per plate) with three plates per assay. The Petri dishes were 100 × 15 mm.

4.4. Endophyte Identification

Strain WPB was previously isolated from wild poplar [21] and described [22]. New AFE strains were identified through PCR amplification of the 16S rRNA gene of each strain, or 28S rRNA gene of AFE11, using 8F (AGAGTTTGATCCTGGCTCAG′) and 1492R (GGTTACCTTGTTACGACTT-3) primers, or D1/D2 (F63 5′-GCATATCAATAAGCGGAGGAAAAG-3′ and LR3 CGTCCGTGTTTCAAGACGG) for the 28S gene of AFE11. The genetic sequences were then compared to those in the NCBI’s GenBank using the BLASTN webserver.

4.5. Genomic Sequencing and Analysis

The WPB genome had previously been sequenced and assembled at the Department of Energy Joint Genome Institute (JGI) as part of the research topic “Defining the poplar root microbiome”. The assembled genome was submitted to the Rapid Annotation Subsystems Technology (RAST) [65] for annotation and the predicted protein-encoding genes (PEGs) submitted to KEGG KofamKOALA [66] for functional annotation and KEGG Ortholog (KO) assignment. Genome annotation, performed at the JGI, was carried out using the DOE-JGI Microbial Annotation Pipeline (DOE-JGI MAP) [67]. Whole-genome-based taxonomic classification was completed via the Type (Strain) Genome Server (TYGS) [68], and the potential for human pathogenicity predicted using PathogenFinder (v1.1) [69] at the Center for Genomic Epidemiology. The WPB genome is available through the NCBI GenBank database under accession GCA_900102765.1
Of the new AFE isolates, only endophytes showing strong in vitro inhibitory effects against at least one fungal crop pathogen were selected for genomic sequencing, species identification, and in silico analysis of antifungal gene clusters. Strains AFE 1, 3, 4A, 5, 8, 9, 16, 21B and 22 were grown in 10mL MG/L broth, pelleted, and resuspended in Tris buffer (pH 8). Cells were lysed via incubation with 10% SDS (sodium dodecyl sulfate) and 5M sodium chloride at 68C for 30 min. Following RNaseA and Proteinase K treatments, the samples were subjected to phenol-chloroform extractions and ethanol precipitation. The paired-end libraries were constructed from approximately 376 ng of gDNA using the Nextera DNA Flex Library preparation kit, and loaded in one flow cell. Each library was barcode sequenced using a 2 × 250-bp format. The MiSeq run was performed using the MiSeq Reagent Kit v3 (600 cycles) chemistry. The following steps were then performed for assembly: (1) BBMap package was used to remove adapters and keep high-quality reads; (2) filtered reads were assembled using SPAdes (version v3.13.0; ––phred–offset 33 ––cov–cutoff auto –t 16 –m 64 ––careful –k 55,97,127) [70]; (3) contigs were discarded if the length was <1kbp (BBTools reformat.sh: minlength).
Assembly and annotation stats are reported in Appendix A Table A1. Open reading frame (ORF) prediction was performed using RAST [71]. For the taxonomic classification of the AFE strains we used the Genome Taxonomy Database (GTDB-Tk) version 2.1.0 [72].

4.6. In Silico Analysis of Antimicrobial Biosynthetic Gene Clusters in WPB and AFE Strains

The presence of biosynthetic gene clusters (BGCs) encoding for putative non-ribosomal peptidase synthetase (NRPS), polyketide synthases (PKSs), and other enzymes involved in the synthesis of secondary metabolites with predicted antimicrobial activities was performed by using the antiSMASH (v6.1.1) [73]. The analysis included the antiSMASH options for MIBiG comparison, ClusterBlast and KnownClusterBlast similar gene clusters, and the Pfam and TIGRFAM domains.

4.7. Occidiofungin Mutant Construction

A plasmid was first constructed for directed mutagenesis of endophyte strains. To ensure the selectable marker would be functional in the endophyte, the kanamycin resistance gene was cloned from pBHR-GFP into the EcoRI site of pUC18 using pGEM-T-Easy (Promega), and named pMUT0. Using the approach of Zuniga and colleagues [74], the ofcE gene of WPB was targeted. Primers were designed to amplify a 1Kb portion of the ocfE gene from WPB, and BamHI sites were added to the primers to facilitate cloning into the BamHI site of pMUT0. Sequences of the primers were as follows:
Forward primer, TAACGAAAGCTTAAACCGTGTACGACGCCTAT
Reverse primer TAACGAGGATCCCTGCTGAAGTACGCATCCGA
The resulting plasmid was purified and electroporated into electrocompetent WPB cells. Kanamycin resistant colonies were verified by PCR to have a disruption of the ofcE gene.

4.8. Chemical Extraction and Analysis of Secreted Antimicrobials

Rhizoctonia solani (RS) was inhibited by strain WPB and most of the AFE bacterial strains (AFE 1, 3, 4A, 5, 8, 9, 16, 21B, and 22), and was therefore chosen for antifungal chemical discovery. R. solani was grown on PDA (potato dextrose agar). Square plugs (0.8 cm) were then taken from the active margin of R. solani, and transferred to new PDA plates. After 24 h of fungal growth, 4 drops (2.5 microliters per drop) of a 0.2 OD600 culture were added equidistantly to the periphery of the plate. Plates were incubated for another 6 days at 20 °C before the zone of inhibition was cut out for extraction. In order to extract the most compounds, a mixture of acetonitrile, water, and methanol (ACN:H2O:MeOH; 2:1.5:0.5) was used with 0.1% formic acid. Extracts were run on the AB Sciex 5600 QTOF Tandem Quadrupole mass spectrometer in positive mode using reverse phase chromatography at the University of Washington Medicinal Chemistry Mass Spectrometry Center. The occidiofungin peak was determined by the known masses of occidofungin A and B [24].

4.9. Assays for Symbiotic Traits

The production of auxins as well as tricalcium phosphate solubilization were quantified as described [14]. The presence of the nitrogenase subunit nifH gene was determined as described [14]. Nitrogen fixation was assessed using the acetylene reduction assay as follows. Cell suspensions were adjusted to an optical density (OD600) of 0.4 in nitrogen-free medium. One hundred microliters were transferred to 15mL amber vials containing 6ml of NL-CCM agar [75]. Vials were dosed with 0.1ml acetylene gas and incubated for 3 days at 30C. Headspace was analyzed with a gas chromatograph equipped with a flame ionization detector as described [76]. Strain WP5 [21], a diazotrophic endophyte, was included as a positive control. AFE3 and AFE9 were tested in triplicate while the remaining AFE strains that were all negative by PCR for the presence of the nitrogenase gene were tested in singlet and in total served as negative controls.

5. Conclusions

This study expands our understanding of the potential for bacterial endophytes to be used in biocontrol applications. Direct in vitro screening for antimicrobial activity led to the discovery of many endophytes of poplar that had potential for use in biocontrol. While occidiofungin was determined to be the primary mode of action for the Burkholderia strain, the lack of this biosynthetic gene cluster in the new isolates points to different mechanisms at work. Several of the strains harbored genes encoding known antimicrobial compounds, while others had none, indicating novel antifungal pathways yet to be discovered. These varying and perhaps novel mechanisms of antimicrobial activities may be required to reduce the risk of the development of resistance by pathogens. The next phase of this research would be to conduct in vivo tests with pathogen-infected agricultural crops to determine if consortia of strains with these in vitro pathogen inhibition activities will protect the host plants. It will also be necessary to test more strains of each pathogen species to assess the applicability. In addition to their biocontrol potential, some of the endophyte strains could have the ability to be beneficial in other ways such as providing essential nutrients, including nitrogen and phosphorus. With the ability of many endophytes to colonize a broad spectrum of crop species, and to colonize systemically, the endophytes studied here likely have the tools required to chemically defend their host while also strengthening it from within.

6. Patents

The work was not patented but reported in the University of Washington Report of Innovation #48629.

Author Contributions

Conceptualization, P.M.J. and S.L.D.; methodology, P.M.J., S.L.D., A.F., A.W.S. and P.O.; Formal analysis, A.F., P.M.J., R.T., S.S.P., A.W.S. and C.K.; investigation, P.M.J., A.W.S., S.S.P. and C.K.; resources, P.O.; data curation, A.F. and R.T.; writing—original draft preparation, S.L.D. and A.W.S.; writing—review and editing, all authors; visualization, A.W.S., A.F. and R.T.; supervision, S.L.D., P.M.J., A.F. and A.W.S.; project administration, S.L.D.; funding acquisition, S.L.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the University of Washington CoMotion Innovation Fund and the Byron and Alice Lockwood Foundation. The sequencing of strain WPB was conducted by the United States Department of Energy Joint Genome Institute, a DOE Office of Science User Facility supported by the Office of Science of the US DOE under Contract No. DE-AC02-05CH11231.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The WPB genome is available through the NCBI GenBank database under accession GCA_900102765.1. Full antiSMASH results along with AFE strain genomes can be found here: https://doi.org/10.6084/m9.figshare.21164395.v1.

Acknowledgments

We thank Aubrey Stoda and Linnea Stavney for fungal culture maintenance and for assisting with the ocf mutant quantitative assays, and Will Braks for assisting in colonization tests.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Appendix A

Pathogens 12 00013 g0a1 550
Figure A1. The antiSMASH Cluster Blast results of the cepacin A biosynthetic gene clusters in B. vietnamiensis WPB and closely related B. vietnamiensis strains.
Figure A1. The antiSMASH Cluster Blast results of the cepacin A biosynthetic gene clusters in B. vietnamiensis WPB and closely related B. vietnamiensis strains.
Pathogens 12 00013 g0a1
Pathogens 12 00013 g0a2 550
Figure A2. Auxins production by the AFE strains (micrograms per mL).
Figure A2. Auxins production by the AFE strains (micrograms per mL).
Pathogens 12 00013 g0a2
Pathogens 12 00013 g0a3 550
Figure A3. Acetylene reduction as a measure of nitrogenase activity. Strains AFE3 and AFE9 had the nitrogenase gene and their activity was confirmed. The other AFE strains did not have the nitrogenase gene based on PCR with universal nifH primers, and their inactivity was confirmed in this assay. Strain WP5 was included as a positive control.
Figure A3. Acetylene reduction as a measure of nitrogenase activity. Strains AFE3 and AFE9 had the nitrogenase gene and their activity was confirmed. The other AFE strains did not have the nitrogenase gene based on PCR with universal nifH primers, and their inactivity was confirmed in this assay. Strain WP5 was included as a positive control.
Pathogens 12 00013 g0a3
Table
Table A1. Assembly and annotation statistics.
Table A1. Assembly and annotation statistics.
StrainGenusGenome Size (Mbp)ScaffoldsN50GC %ORFCDS
AFE1Erwinia5.3019708,44754.950554982
AFE3Rahnella5.4622420,14653.551775099
AFE4ABacillus3.9625422,22846.441634070
AFE5Pseudomonas5.9168154,07059.555145453
AFE8Pseudomonas6.1430506,26160.557405678
AFE9Rahnella5.7652204,00152.256685589
AFE16Pseudomonas5.9557181,01560.556905627
AFE21BBacillus4.1222585,42946.243514269
AFE22Rhanella5.5247200,56952.153395262
Table
Table A2. Summary of GTDB-tk taxonomic classification of AFE strains.
Table A2. Summary of GTDB-tk taxonomic classification of AFE strains.
AFE Strain IDClassificationClosest GTDB-tk Type-StrainIs Type StrainClosest Type-Strain NCBI AccessionSpecies Cluster Link
AFE1Erwinia billingiaeErwinia billingiae Eb661YESGCF_000196615.1https://gtdb.ecogenomic.org/species?id=Erwinia%20billingiae
AFE16Pseudomonas_E graminis_DPseudomonas graminis WP8NOGCF_004364335.1https://gtdb.ecogenomic.org/species?id=Pseudomonas_E%20graminis_D
AFE21BBacillus velezensisBacillus velezensis NRRL B-41580YESGCF_001461825.1https://gtdb.ecogenomic.org/species?id=Bacillus%20velezensis
AFE22Rahnella variigenaRahnella variigena CIP 105588YESGCF_003610915.1https://gtdb.ecogenomic.org/species?id=Rahnella%20variigena
AFE3Rahnella victorianaRahnella victoriana DSM 27397YESGCF_004330295.1https://gtdb.ecogenomic.org/species?id=Rahnella%20victoriana
AFE4ABacillus velezensisBacillus velezensis NRRL B-41580YESGCF_001461825.1https://gtdb.ecogenomic.org/species?id=Bacillus%20velezensis
AFE5Pseudomonas kitaguniensisPseudomonas kitaguniensis MAFF 212408YESGCF_009296165.1https://gtdb.ecogenomic.org/species?id=Pseudomonas_E%20kitaguniensis
AFE8Pseudomonas luridaPseudomonas lurida LMG 21995YESGCF_002563895.1https://gtdb.ecogenomic.org/species?id=Pseudomonas_E%20lurida
AFE9Rahnella acerisRahnella aceris SAP-19YESGCF_011684115.1https://gtdb.ecogenomic.org/species?id=Rahnella%20aceris

References

  1. Fisher, M.C.; Henk, D.A.; Briggs, C.J.; Brownstein, J.S.; Madoff, L.C.; McCraw, S.L.; Gurr, S.J. Emerging fungal threats to animal, plant and ecosystem health. Nature 2012, 484, 186–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Moore, D.; Robson, G.D.; Trinci, A.P.J. 21st Century Guidebook to Fungi; Cambridge University Press: Cambridge, UK, 2020. [Google Scholar]
  3. Hane, J.K.; Anderson, J.P.; Williams, A.H.; Sperschneider, J.; Singh, K.B. Genome sequencing and comparative genomics of the broad host-range pathogen Rhizoctonia solani AG8. PLoS Genet. 2014, 10, e1004281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Paulitz, T.C. Low input no-till cereal production in the Pacific Northwest of the U.S.: The challenges of root diseases. Eur. J. Plant Pathol. 2006, 115, 271–281. [Google Scholar] [CrossRef]
  5. Syed, A.; Rahman, S.F.; Singh, E.; Pieterse, C.M.J.; Schenk, P.M. Emerging microbial biocontrol strategies for plant pathogens. Plant Sci. 2018, 267, 102–111. [Google Scholar] [CrossRef] [Green Version]
  6. Mavrodi, O.V.; Walter, N.; Elateek, S.; Taylor, C.G.; Okubara, P.A. Suppression of Rhizoctonia and Pythium root rot of wheat by new strains of Pseudomonas. Biol. Control 2012, 62, 93–102. [Google Scholar] [CrossRef]
  7. Palmieri, D.; Ianiri, G.; Del Grosso, C.; Barone, G.; De Curtis, F.; Castoria, R.; Lima, G. Advances and perspectives in the use of biocontrol agents against fungal plant diseases. Horticulturae 2022, 8, 577. [Google Scholar] [CrossRef]
  8. Velivelli, S.L.; De Vos, P.; Kromann, P.; Declerck, S.; Prestwich, B.D. Biological control agents: From field to market, problems and challenges. Trends Biotechnol. 2014, 32, 493–496. [Google Scholar] [CrossRef]
  9. Berg, G. Plant-microbe interactions promoting plant growth and health: Perspectives for controlled use of microorganisms in agriculture. Appl. Microbiol. Biotechnol 2009, 84, 11–18. [Google Scholar] [CrossRef]
  10. Thambugala, K.M.; Daranagama, D.A.; Phillips, A.J.L.; Kannangara, S.D.; Promputtha, I. Fungi vs. Fungi in Biocontrol: An Overview of Fungal Antagonists Applied Against Fungal Plant Pathogens. Front. Cell. Infect. Microbiol. 2020, 10, 604923. [Google Scholar] [CrossRef]
  11. Okubara, P.A.; Kornoely, J.P.; Landa, B.B. Rhizosphere colonization of hexaploid wheat by Pseudomonas fluorescens strains Q8r1-96 and Q2-87 is cultivar-variable and associated with changes in gross root morphology. Biol. Control 2004, 30, 392–403. [Google Scholar] [CrossRef]
  12. Nevada, S.; Lupien, S.; Watson, B.; Okubara, P.A. Growth inhibition of Botrytis cinerea by native vineyard yeasts from Puget Sound, Washington State, USA. J. Biol. Nat. 2021, 13, 42–53. [Google Scholar]
  13. Bonanomi, G.; Lorito, M.; Vinale, F.; Woo, S.L. Organic Amendments, Beneficial Microbes, and Soil Microbiota: Toward a Unified Framework for Disease Suppression. Annu. Rev. Phytopathol. 2018, 56, 1–20. [Google Scholar] [CrossRef] [PubMed]
  14. Kandel, S.L.; Firrincieli, A.; Joubert, P.M.; Okubara, P.A.; Leston, N.D.; McGeorge, K.M.; Mugnozza, G.S.; Harfouche, A.; Kim, S.-H.; Doty, S.L. An in vitro study of bio-control and plant growth promotion potential of Salicaceae endophytes. Front. Microbiol. 2017, 8, 386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Le, C.K.; Gurr, S.J.; Hirsch, P.R.; Mauchline, T.H. Exploitation of endophytes for sustainable agricultural intensification. Mol. Plant Pathol. 2017, 18, 469–473. [Google Scholar]
  16. Doty, S.L. Functional importance of the plant microbiome: Implications for agriculture, forestry and bioenergy. In Functional Importance of the Plant Microbiome: Implications for Agriculture, Forestry and Bioenergy; Springer: Cham, Switzerland, 2017; pp. 1–6. [Google Scholar]
  17. Santoyo, G.; Moreno-Hagelsieb, G.; del Carmen Orozco-Mosqueda, M.; Glick, B.R. Plant growth-promoting bacterial endophytes. Microbiol. Res. 2016, 183, 92–99. [Google Scholar] [CrossRef]
  18. Compant, S.; Clement, C.; Sessitsch, A. Plant growth-promoting bacteria in the rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biol. Biochem. 2010, 42, 669–678. [Google Scholar] [CrossRef] [Green Version]
  19. Kandel, S.L.; Joubert, P.M.; Doty, S.L. Bacterial endophyte colonization and distribution in plants. Microorganisms 2017, 5, 77. [Google Scholar] [CrossRef] [Green Version]
  20. Chiarini, L.; Bevivino, A.; Dalmastri, C.; Tabacchioni, S.; Visca, P. Burkholderia cepacia complex species: Health hazards and biotechnological potential. Trends Microbiol. 2006, 14, 277–286. [Google Scholar] [CrossRef]
  21. Doty, S.L.; Oakley, B.; Xin, G.; Kang, J.W.; Singleton, G.; Khan, Z.; Vajzovic, A.; Staley, J.T. Diazotrophic endophytes of native black cottonwood and willow. Symbiosis 2009, 47, 23–33. [Google Scholar] [CrossRef]
  22. Xin, G.; Zhang, G.; Kang, J.W.; Staley, J.T.; Doty, S.L. A diazotrophic, indole-3-acetic acid-producing endophyte from wild cottonwood. Biol. Fertil. Soils 2009, 45, 669–674. [Google Scholar] [CrossRef]
  23. Mullins, A.J.; Murray, J.A.; Bull, M.J.; Jenner, M.; Jones, C.; Webster, G.; Green, A.; Neill, D.R.; Connor, T.R.; Parkhill, J.; et al. Genome mining identifies cepacin as a plant-protective metabolite of the biopesticidal bacterium Burkholderia ambifaria. Nat. Microbiol. 2019, 4, 996–1005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Lu, S.E.; Novak, J.; Austin, F.W.; Gu, G.; Ellis, D.; Kirk, M.; Wilson-Stanford, S.; Tonelli, M.; Smith, L. Occidiofungin, a unique antifungal glycopeptide produced by a strain of Burkholderia contaminans. Biochemistry 2009, 48, 8312–8321. [Google Scholar] [CrossRef]
  25. Wang, X.; Liu, A.; Guerrero, A.; Liu, J.; Yu, X.; Deng, P.; Ma, L.; Baird, S.; Smith, L.; Li, X.; et al. Occidiofungin is an important component responsible for the antifungal activity of Burkholderia pyrrocinia strain Lyc2. J. Appl. Microbiol. 2016, 120, 607–618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Deng, P.; Foxfire, A.; Xu, J.; Baird, S.M.; Jia, J.; Delgado, K.H.; Shin, R.; Smith, L.; Lu, S.-E. The Siderophore Product Ornibactin Is Required for the Bactericidal Activity of Burkholderia contaminans MS14. Appl. Environ. Microbiol. 2017, 83, e00051-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Thomas, M.S. Iron acquisition mechanisms of the Burkholderia cepacia complex. Biometals 2007, 20, 431–452. [Google Scholar] [CrossRef]
  28. Butt, A.T.; Thomas, M.S. Iron Acquisition Mechanisms and Their Role in the Virulence of Burkholderia Species. Front. Cell. Infect. Microbiol. 2017, 7, 460. [Google Scholar] [CrossRef] [Green Version]
  29. Hoskisson, P.A.; Seipke, R.F. Cryptic or Silent? The Known Unknowns, Unknown Knowns, and Unknown Unknowns of Secondary Metabolism. MBio 2020, 11, e02642-20. [Google Scholar] [CrossRef]
  30. Hermenau, R.; Kugel, S.; Komor, A.J.; Hertweck, C. Helper bacteria halt and disarm mushroom pathogens by linearizing structurally diverse cyclolipopeptides. Proc. Natl. Acad. Sci. USA 2020, 117, 23802–23806. [Google Scholar] [CrossRef]
  31. Ferrarini, E.; De, R.V.; Geudens, N.; Martins, J.C.; Hofte, M. Altering in vivo membrane sterol composition affects the activity of the cyclic lipopeptides tolaasin and sessilin against Pythium. Biochim. Biophys. Acta Biomembr. 2022, 1864, 184008. [Google Scholar] [CrossRef]
  32. Xiao, J.; Guo, X.; Qiao, X.; Zhang, X.; Chen, X.; Zhang, D. Activity of Fengycin and Iturin A Isolated From Bacillus subtilis Z-14 on Gaeumannomyces graminis Var. tritici and Soil Microbial Diversity. Front. Microbiol. 2021, 12, 682437. [Google Scholar]
  33. Karpinski, T.M. Marine Macrolides with Antibacterial and/or Antifungal Activity. Mar. Drugs 2019, 17, 241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Zhang, L.; Sun, C. Fengycins, Cyclic Lipopeptides from Marine Bacillus subtilis Strains, Kill the Plant-Pathogenic Fungus Magnaporthe grisea by Inducing Reactive Oxygen Species Production and Chromatin Condensation. Appl. Environ. Microbiol. 2018, 84, e00445-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Gu, G.; Smith, L.; Wang, N.; Wang, H.; Lu, S.E. Biosynthesis of an antifungal oligopeptide in Burkholderia contaminans strain MS14. Biochem. Biophys. Res. Commun. 2009, 380, 328–332. [Google Scholar] [CrossRef] [PubMed]
  36. Bashan, Y.; Kamnev, A.A.; de-Bashan, L.E. Tricalcium phosphate is inappropriate as a universal selection factor for isolating and testing phosphate-solubilizing bacteria that enhance plant growth: A proposal for an alternative procedure. Biol. Fertil. Soils 2013, 49, 465–479. [Google Scholar] [CrossRef]
  37. Varga, T.; Hixson, K.K.; Ahkami, A.H.; Sher, A.W.; Barnes, M.E.; Chu, R.K.; Battu, A.K.; Nicora, C.D.; Winkler, T.E.; Reno, L.R.; et al. Endophyte-Promoted Phosphorus Solubilization in Populus. Front. Plant Sci. 2020, 11, 567918. [Google Scholar] [CrossRef]
  38. Brady, C.; Hunter, G.; Kirk, S.; Arnold, D.; Denman, S. Rahnella victoriana sp. nov., Rahnella bruchi sp. nov., Rahnella woolbedingensis sp. nov., classification of Rahnella genomospecies 2 and 3 as Rahnella variigena sp. nov. and Rahnella inusitata sp. nov., respectively and emended description of the genus Rahnella. Syst. Appl. Microbiol. 2014, 37, 545–552. [Google Scholar]
  39. Lee, S.D.; Jeon, D.; Kim, I.S.; Choe, H.; Kim, J.S. Rahnella aceris sp. nov., isolated from sap drawn from Acer pictum. Arch. Microbiol. 2020, 202, 2411–2417. [Google Scholar] [CrossRef]
  40. Kube, M.; Migdoll, A.M.; Gehring, I.; Heitmann, K.; Mayer, Y.; Kuhl, H.; Knaust, F.; Geider, K.; Reinhardt, R. Genome comparison of the epiphytic bacteria Erwinia billingiae and E. tasmaniensis with the pear pathogen E. pyrifoliae. BMC Genom. 2010, 11, 393. [Google Scholar] [CrossRef] [Green Version]
  41. Llop, P. Genetic islands in pome fruit pathogenic and non-pathogenic Erwinia species and related plasmids. Front. Microbiol. 2015, 6, 874. [Google Scholar] [CrossRef]
  42. United States Environmental Protection Agency. EPA Proposes Registration of Products Containing Bacillus velezensis Strain RTI301 and Bacillus subtilis Strain RTI477, New Microbial Active Ingredients; 6-25-0021; United States Environmental Protection Agency: Washington, DC, USA, 2021. Available online: https://www.epa.gov/pesticides/epa-proposes-registration-products-containing-bacillus-velezensis-strain-rti301-and (accessed on 20 September 2022).
  43. European Food Safety Authority. Safety and Efficacy of a Feed Additive Consisting of Bacillus velezensis ATCC PTA-6737 (Bacillus velezensis PB6) for Turkeys for Fattening, Turkeys Reared for Breeding, Laying Hens, Minor Poultry Species for Laying, Piglets (Weaned), Weaned Minor Porcine Species and Sows (Kemin Europe, N.V.); 4-13-0022; European Food Safety Authority: Washington, DC, USA, 2021; Available online: https://www.efsa.europa.eu/en/efsajournal/pub/7244 (accessed on 20 September 2022).
  44. Scales, B.S.; Erb-Downward, J.R.; Huffnagle, I.M.; LiPuma, J.J.; Huffnagle, G.B. Comparative genomics of Pseudomonas fluorescens subclade III strains from human lungs. BMC Genom. 2015, 16, 1032. [Google Scholar] [CrossRef] [Green Version]
  45. Scales, B.S.; Dickson, R.P.; LiPuma, J.J.; Huffnagle, G.B. Microbiology, genomics, and clinical significance of the Pseudomonas fluorescens species complex, an unappreciated colonizer of humans. Clin. Microbiol. Rev. 2014, 27, 927–948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Dickson, R.P.; Erb-Downward, R.; Freeman, C.M.; Walker, N.; Scales, B.S.; Beck, J.M.; Martinez, F.J.; Curtis, J.L.; Lama, V.N.; Huffnagle, G.B. Changes in the lung microbiome following lung transplantation include the emergence of two distinct Pseudomonas species with distinct clinical associations. PLoS ONE 2014, 9, e97214. [Google Scholar] [CrossRef] [Green Version]
  47. Sessitsch, A.; Coenye, T.; Sturz, A.V.; Vandamme, P.; Barka, E.A.; Salles, J.F.; Van Elsas, J.D.; Faure, D.; Reiter, B.; Glick, B.R.; et al. Burkholderia phytofirmans sp. nov., a novel plant-associated bacterium with plant-beneficial properties. Int. J. Syst. Evol. Microbiol. 2005, 55, 1187–1192. [Google Scholar] [CrossRef] [PubMed]
  48. Ait, B.E.; Nowak, J.; Clement, C. Enhancement of chilling resistance of inoculated grapevine plantlets with a plant growth-promoting rhizobacterium, Burkholderia phytofirmans strain PsJN. Appl. Environ. Microbiol. 2006, 72, 7246–7252. [Google Scholar]
  49. Andreolli, M.; Lampis, S.; Poli, M.; Gullner, G.; Biro, B.; Vallini, G. Endophytic Burkholderia fungorum DBT1 can improve phytoremediation efficiency of polycyclic aromatic hydrocarbons. Chemosphere 2013, 92, 688–694. [Google Scholar] [CrossRef]
  50. Elliott, G.N.; Chen, W.M.; Chou, J.H.; Wang, H.C.; Sheu, S.Y.; Perin, L.; Reis, V.M.; Moulin, L.; Simon, M.F.; Bontemps, C.; et al. Burkholderia phymatum is a highly effective nitrogen-fixing symbiont of Mimosa spp. and fixes nitrogen ex planta. New Phytol. 2007, 173, 168–180. [Google Scholar] [CrossRef]
  51. Govindarajan, M.; Balandreau, J.; Kwon, S.W.; Weon, H.Y.; Lakshminarasimhan, C. Effects of the inoculation of Burkholderia vietnamensis and related endophytic diazotrophic bacteria on grain yield of rice. Microb. Ecol. 2008, 55, 21–37. [Google Scholar] [CrossRef]
  52. Sawana, A.; Adeolu, M.; Gupta, R.S. Molecular signatures and phylogenomic analysis of the genus Burkholderia: Proposal for division of this genus into the emended genus Burkholderia containing pathogenic organisms and a new genus Paraburkholderia gen. nov. harboring environmental species. Front. Genet. 2014, 5, 429. [Google Scholar] [CrossRef] [Green Version]
  53. Angus, A.A.; Agapakis, C.M.; Fong, S.; Yerrapragada, S.; Santos, P.E.D.L.; Yang, P.; Song, N.; Kano, S.; Caballero-Mellado, J.; De Faria, S.M.; et al. Plant-associated symbiotic Burkholderia species lack hallmark strategies required in mammalian pathogenesis. PLoS ONE 2014, 9, e83779. [Google Scholar] [CrossRef]
  54. Dobritsa, A.P.; Samadpour, M. Transfer of eleven species of the genus Burkholderia to the genus Paraburkholderia and proposal of Caballeronia gen. nov. to accommodate twelve species of the genera Burkholderia and Paraburkholderia. Int. J. Syst. Evol. Microbiol. 2016, 66, 2836–2846. [Google Scholar] [CrossRef]
  55. Firrincieli, A.; Khorasani, M.; Frank, A.C.; Doty, S.L. Influences of climate on phyllosphere endophytic bacterial communities of wild poplar. Frontiers in Plant Science Front. Plant Sci. 2020, 11, 203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Speare, L.; Woo, M.; Bultman, K.M.; Mandel, M.J.; Wollenberg, M.S.; Septer, A.N. Host-Like Conditions Are Required for T6SS-Mediated Competition among Vibrio fischeri Light Organ Symbionts. mSphere 2021, 6, e0128820. [Google Scholar] [CrossRef] [PubMed]
  57. Khan, N.; Maymon, M.; Hirsch, A.M. Combating Fusarium Infection Using Bacillus-Based Antimicrobials. Microorganisms 2017, 5, 75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Geudens, N.; Nasir, M.N.; Crowet, J.-M.; Raaijmakers, J.; Fehér, K.; Coenye, T.; Martins, J.C.; Lins, L.; Sinnaeve, D.; Deleu, M. Membrane Interactions of Natural Cyclic Lipodepsipeptides of the Viscosin Group. Biochim. Biophys. Acta Biomembr. 2017, 1859, 331–339. [Google Scholar] [CrossRef]
  59. Cho, K.H.; Kim, Y.K. Two types of ion channel formation of tolaasin, a Pseudomonas peptide toxin. FEMS Microbiol. Lett. 2003, 221, 221–226. [Google Scholar] [CrossRef]
  60. Andrić, S.; Meyer, T.; Rigolet, A.; Prigent-Combaret, C.; Höfte, M.; Balleux, G.; Steels, S.; Hoff, G.; De Mot, R.; McCann, A.; et al. Lipopeptide Interplay Mediates Molecular Interactions between Soil Bacilli and Pseudomonads. Microbiol. Spectr. 2021, 9, e0203821. [Google Scholar] [CrossRef]
  61. Barbosa, J.; Caetano, T.; Mendo, S. Class I and Class II Lanthipeptides Produced by Bacillus spp. J. Nat. Prod. 2015, 78, 2850–2866. [Google Scholar] [CrossRef]
  62. Mohr, K.I.; Volz, C.; Jansen, R.; Wray, V.; Hoffmann, J.; Bernecker, S.; Wink, J.; Gerth, K.; Stadler, M.; Müller, R. Pinensins: The first antifungal lantibiotics. Angew. Chem. Int. Ed. Engl. 2015, 54, 11254–11258. [Google Scholar] [CrossRef]
  63. Agirman, B.; Erten, H. Biocontrol ability and action mechanisms of Aureobasidium pullulans GE17 and Meyerozyma guilliermondii KL3 against Penicillium digitatum DSM2750 and Penicillium expansum DSM62841 causing postharvest diseases. Yeast 2020, 37, 437–448. [Google Scholar] [CrossRef]
  64. Mullins, A.J.; Jones, C.; Bull, M.J.; Webster, G.; Parkhill, J.; Connor, T.R.; Murray, J.A.; Challis, G.L.; Mahenthiralingam, E. Genomic Assemblies of Members of Burkholderia and Related Genera as a Resource for Natural Product Discovery. Microbiol. Resour. Announc. 2020, 9, e00485-20. [Google Scholar] [CrossRef]
  65. Overbeek, R.; Olson, R.; Pusch, G.D.; Olsen, G.J.; Davis, J.J.; Disz, T.; Edwards, R.A.; Gerdes, S.; Parrello, B.; Shukla, M.; et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 2014, 42, D206–D214. [Google Scholar] [CrossRef] [PubMed]
  66. Aramaki, T.; Blanc-Mathieu, R.; Endo, H.; Ohkubo, K.; Kanehisa, M.; Goto, S.; Ogata, H. KofamKOALA: KEGG Ortholog assignment based on profile HMM and adaptive score threshold. Bioinformatics 2020, 36, 2251–2252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Mavromatis, K.; Ivanova, N.N.; Chen, I.M.; Szeto, E.; Markowitz, V.M.; Kyrpides, N.C. The DOE-JGI Standard Operating Procedure for the Annotations of Microbial Genomes. Stand. Genom. Sci. 2009, 1, 63–67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Meier-Kolthoff, J.P.; Goker, M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019, 10, 2182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  69. Cosentino, S.; Voldby, L.M.; Moller, A.F.; Lund, O. PathogenFinder--distinguishing friend from foe using bacterial whole genome sequence data. PLoS ONE 2013, 8, e77302. [Google Scholar] [CrossRef]
  70. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Green Version]
  71. Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST Server: Rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [Green Version]
  72. Parks, D.H.; Chuvochina, M.; Rinke, C.; Mussig, A.J.; Chaumeil, P.A.; Hugenholtz, P. GTDB: An ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy. Nucleic Acids Res. 2022, 50, D785–D794. [Google Scholar] [CrossRef]
  73. Blin, K.; Shaw, S.; Kloosterman, A.M.; Charlop-Powers, Z.; van Wezel, G.P.; Medema, M.H.; Weber, T. antiSMASH 6.0: Improving cluster detection and comparison capabilities. Nucleic Acids Res. 2021, 49, W29–W35. [Google Scholar] [CrossRef]
  74. Zúñiga, A.; Poupin, M.J.; Donoso, R.; Ledger, T.; Guiliani, N.; Gutiérrez, R.A.; González, B. Quorum sensing and indole-3-acetic acid degradation play a role in colonization and plant growth promotion of Arabidopsis thaliana by Burkholderia phytofirmans PsJN. Mol. Plant Microbe Interact. 2013, 26, 546–553. [Google Scholar] [CrossRef] [Green Version]
  75. Rennie, R.J. A single medium for the isolation of acetylene-reducing (dinitrogen-fixing) bacteria from soils. Can. J. Microbiol. 1981, 27, 8–14. [Google Scholar] [CrossRef] [PubMed]
  76. Doty, S.L.; Sher, A.W.; Fleck, N.D.; Khorasani, M.; Bumgarner, R.E.; Khan, Z.; Ko, A.W.K.; Kim, S.-H.; DeLuca, T.H. Variable nitrogen fixation in wild Populus. PLoS ONE 2016, 11, e0155979. [Google Scholar] [CrossRef] [PubMed]
Pathogens 12 00013 g001 550
Figure 1. Example in vitro antifungal activities. Wild-type (WT) Burkholderia vietnamiensis strain WPB and the ocf mutant against Rhizoctonia solani AG-8 and Gaemannomyces graminis var. tritici ARS-A1.
Figure 1. Example in vitro antifungal activities. Wild-type (WT) Burkholderia vietnamiensis strain WPB and the ocf mutant against Rhizoctonia solani AG-8 and Gaemannomyces graminis var. tritici ARS-A1.
Pathogens 12 00013 g001
Pathogens 12 00013 g002 550
Figure 2. Organization of the biosynthetic gene clusters identified in Burkholderia vietnamiensis WPB. Orthologous genes shared between the BGCs in WPB and reference strain are shown with the same color for (A) occidiofungin (A,B) ornibactin, and (C) cepacin A. The genes not shared between WPB and the reference strain are in white.
Figure 2. Organization of the biosynthetic gene clusters identified in Burkholderia vietnamiensis WPB. Orthologous genes shared between the BGCs in WPB and reference strain are shown with the same color for (A) occidiofungin (A,B) ornibactin, and (C) cepacin A. The genes not shared between WPB and the reference strain are in white.
Pathogens 12 00013 g002
Pathogens 12 00013 g003 550
Figure 3. Organization of the biosynthetic gene clusters identified in the Pseudomonas strains AFE8 (A) and AFE5 (B). Orthologous genes shared between the BGCs in the AFE and reference strain are shown with the same color, while the genes not shared are in white.
Figure 3. Organization of the biosynthetic gene clusters identified in the Pseudomonas strains AFE8 (A) and AFE5 (B). Orthologous genes shared between the BGCs in the AFE and reference strain are shown with the same color, while the genes not shared are in white.
Pathogens 12 00013 g003
Pathogens 12 00013 g004 550
Figure 4. Topology of the fengycin and bacillomycin D gene clusters in the Bacillus AFE strains 4A and 21B. The blue and dark-pink lines indicate the fengycin and bacillomycin D gene clusters, respectively. Orthologous genes shared between the BGCs in the AFE and reference strain are shown with the same color, while the genes not shared are in white.
Figure 4. Topology of the fengycin and bacillomycin D gene clusters in the Bacillus AFE strains 4A and 21B. The blue and dark-pink lines indicate the fengycin and bacillomycin D gene clusters, respectively. Orthologous genes shared between the BGCs in the AFE and reference strain are shown with the same color, while the genes not shared are in white.
Pathogens 12 00013 g004
Pathogens 12 00013 g005 550
Figure 5. Confirmation of occidiofungin production in strain WPB by mass spectrometry. Top panel: Black line indicates wild-type WPB grown with Rhizoctonia solani AG-8; red line indicates the ocf mutant; blue line indicates wild-type WPB grown in the absence of fungus. Vertical line indicates the occidiofungin peak. Lower panel: M+H molecules present in the occidiofungin peak.
Figure 5. Confirmation of occidiofungin production in strain WPB by mass spectrometry. Top panel: Black line indicates wild-type WPB grown with Rhizoctonia solani AG-8; red line indicates the ocf mutant; blue line indicates wild-type WPB grown in the absence of fungus. Vertical line indicates the occidiofungin peak. Lower panel: M+H molecules present in the occidiofungin peak.
Pathogens 12 00013 g005
Table
Table 1. Zones of inhibition from wild-type Burkholderia vietnamiensis strain WPB and the occidiofungin ocf mutant. The distances from the bacterial colony and the pathogen strains were quantified. Units are in millimeters. Standard deviation is indicated by ±.
Table 1. Zones of inhibition from wild-type Burkholderia vietnamiensis strain WPB and the occidiofungin ocf mutant. The distances from the bacterial colony and the pathogen strains were quantified. Units are in millimeters. Standard deviation is indicated by ±.
StrainR. solaniGgtF. culmorumP. ultimum
WPB5.03 ± 0.6411.40 ± 1.254.44 ± 0.872.17 ± 0.98
WPB ocf0.00 ± 0.005.46 ± 0.610.00 ± 0.000.00 ± 0.00
Table
Table 2. Antifungal Endophytes. Species identification, sources and in vitro antifungal activity of the eleven chosen Anti-Fungal Endophyte (AFE) strains as determined by the dual plate assay [-, no activity; + very weak inhibition; ++ weak; +++ strong; ++++ very strong]. The pathogen strains were R. solani AG-8, Ggt ARS-A1, F. culmorum 70110023, and P. ultimum 217.
Table 2. Antifungal Endophytes. Species identification, sources and in vitro antifungal activity of the eleven chosen Anti-Fungal Endophyte (AFE) strains as determined by the dual plate assay [-, no activity; + very weak inhibition; ++ weak; +++ strong; ++++ very strong]. The pathogen strains were R. solani AG-8, Ggt ARS-A1, F. culmorum 70110023, and P. ultimum 217.
StrainSpeciesSourceR. solaniGgtF. culmorumP. ultimum
AFE 1Rahnella sp.Snoqualmie River wild poplar 4++++++++−
AFE 3Rahnella sp.Snoqualmie River wild poplar 4−++++−+
AFE 4ABacillus velezensisSnoqualmie River wild poplar 4++++++++++++
AFE 5Pseudomonas sp.Snoqualmie River wild poplar 4+++++++
AFE 8Pseudomonas sp.Yakima River wild poplar 12+++++++−
AFE 9Rahnella aquatilisYakima River wild poplar 12+++++−++
AFE 11Aureobasidium pullulansSkykomish River wild poplar+++−−
AFE 14Pantoea agglomeransSkykomish River wild poplar−++−−
AFE 16Pseudomonas graminisSkykomish River wild poplar++++−−
AFE 21BBacillus velezensisSkykomish River wild poplar++++++++−
AFE 22Rahnella sp.Skykomish River wild poplar−+++−+
Table
Table 3. Known antimicrobial biosynthetic gene clusters. WPB and the AFE strains carry a variety of biosynthetic gene clusters with known antifungal and antibacterial activity.
Table 3. Known antimicrobial biosynthetic gene clusters. WPB and the AFE strains carry a variety of biosynthetic gene clusters with known antifungal and antibacterial activity.
StrainTotal # of BGCBGC’s with Known Antimicrobial Activity 1Activity
WPB12cepacin A (62%)antibiotic/antioomycetes
ornibactin (93%)antibiotic
occidiofungin (94%)antifungal
AFE 17-
AFE 36-
AFE 4A21difficidin 2 (100%)antibacterial
macrolactin (100%)antibacterial/antifungal
bacillaene (100%)antibacterial
fengycin (86%)antibacterial
bacilysin (100%)antibacterial/antifungal
bacillibactin (100%)antibacterial
lanthipeptide class IIantibacterial
AFE 518sessilin 2 (100%)antifungal
AFE 814viscosine (100%)antifungal
tolaasin (60%)antibacterial/antifungal
AFE 95-
AFE 165-
AFE 21B21difficidin (100%)antibacterial
macrolactin (100%)antibacterial/antifungal
bacillaene (100%)antibacterial
fengycin (80%)antibacterial
bacilysin (100%)antibacterial/antifungal
bacillibactin (100%)antibacterial
surfactin (52%)antibacterial
AFE 227
1 Only clusters with a similarity > 50% are reported. In parentheses are similarity scores with the reference cluster. 2 The BGC for difficidin (AFE4A: NODE 3, NODE 2, and NODE 14) and sessilin (AFE 5: NODE 40 and NODE 26) were fragmented over different contigs and completeness was assessed after manual curation of the antiSMASH analysis.
Table
Table 4. Siderophore production in the AFE strains. Data converted to qualitative scale [−, no yellow halo; +, weak; ++ strong; +++ very strong].
Table 4. Siderophore production in the AFE strains. Data converted to qualitative scale [−, no yellow halo; +, weak; ++ strong; +++ very strong].
StrainLevel of Siderophore Production
AFE 1++
AFE 3++
AFE 4A−
AFE 5+++
AFE 8+++
AFE 9++
AFE 11−
AFE 14++
AFE 16+
AFE 21B−
AFE 22+++
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Doty, S.L.; Joubert, P.M.; Firrincieli, A.; Sher, A.W.; Tournay, R.; Kill, C.; Parikh, S.S.; Okubara, P. Potential Biocontrol Activities of Populus Endophytes against Several Plant Pathogens Using Different Inhibitory Mechanisms. Pathogens 2023, 12, 13. https://doi.org/10.3390/pathogens12010013

AMA Style

Doty SL, Joubert PM, Firrincieli A, Sher AW, Tournay R, Kill C, Parikh SS, Okubara P. Potential Biocontrol Activities of Populus Endophytes against Several Plant Pathogens Using Different Inhibitory Mechanisms. Pathogens. 2023; 12(1):13. https://doi.org/10.3390/pathogens12010013

Chicago/Turabian Style

Doty, Sharon L., Pierre M. Joubert, Andrea Firrincieli, Andrew W. Sher, Robert Tournay, Carina Kill, Shruti S. Parikh, and Patricia Okubara. 2023. "Potential Biocontrol Activities of Populus Endophytes against Several Plant Pathogens Using Different Inhibitory Mechanisms" Pathogens 12, no. 1: 13. https://doi.org/10.3390/pathogens12010013

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop