Antibiotic Resistance and Virulence Profiles of Escherichia coli Strains Isolated from Wild Birds in Poland
by
, , , and
Anna Nowaczek
1, 
Marta Dec
1,*,
Dagmara Stępień-Pyśniak
1,
Renata Urban-Chmiel
1,
Agnieszka Marek
1 and
Paweł Różański
2 1
Department of Veterinary Prevention and Avian Diseases, Faculty of Veterinary Medicine, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin, Poland
2
Department of Animal Hygiene and Environmental Hazards, Faculty of Animal Sciences and Bioeconomy, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin, Poland
*
Author to whom correspondence should be addressed.
Pathogens 2021, 10(8), 1059; https://doi.org/10.3390/pathogens10081059
Submission received: 28 June 2021
/
Revised: 9 August 2021
/
Accepted: 17 August 2021
/
Published: 20 August 2021
(This article belongs to the Special Issue Detection and Characterization of Drug-Resistant Organisms)
Abstract
:Wild animals are increasingly reported as carriers of antibiotic-resistant and pathogenic bacteria including Enterobacteriaceae. However, the role of free-living birds as reservoirs for potentially dangerous microbes is not yet thoroughly understood. In our work, we examined Escherichia coli strains from wild birds in Poland in relation to their antimicrobial agents susceptibility, virulence and phylogenetic affiliation. Identification of E. coli was performed using MALDI-TOF mass spectrometry. The antibiotic susceptibility of the isolates was determined by the broth microdilution method, and resistance and virulence genes were detected by PCR. E. coli bacteria were isolated from 32 of 34 samples. The strains were most often classified into phylogenetic groups B1 (50%) and A (25%). Resistance to tetracycline (50%), ciprofloxacin (46.8%), gentamicin (34.3%) and ampicillin (28.1%) was most frequently reported, and as many as 31.2% of E. coli isolates exhibited a multidrug resistance phenotype. Among resistance genes, sul2 (31.2% of isolates) and blaTEM (28.1%) were identified most frequently, while irp-2 (31.2%) and ompT (28.1%) were the most common virulence-associated genes. Five strains were included in the APEC group. The study indicates that wild birds can be carriers of potentially dangerous E. coli strains and vectors for the spread of resistant bacteria and resistance determinants in the environment.
Keywords:
Escherichia coli; APEC; wild birds; virulence genes; resistance genes; antibiotic resistance; MIC1. Introduction
Escherichia coli (E. coli) is a common member of the natural intestinal microflora of humans and animals, including birds. However, in addition to non-pathogenic commensal strains, there are also pathogenic E. coli strains involved in many types of infections. Intestinal pathogenic E. coli (IPEC) bacteria are associated with infections of the gastrointestinal tract, while extraintestinal pathogenic E. coli (ExPEC) strains cause infections in extraintestinal anatomic sites. Several pathotypes can be distinguished among IPEC strains: enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enterohaemorrhagic E. coli (EHEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), adherent invasive E. coli (AIEC), and diffusely adherent E. coli (DAEC) [1]. ExPEC strains include avian pathogenic E. coli (APEC), uropathogenic E. coli (UPEC), neonatal meningitis E. coli (NMEC), and sepsis-associated E. coli (SEPEC) [1,2]. Characteristic virulence factors, which play a decisive role in pathogenesis, have been defined for each of these pathotypes [3].
APEC strains are responsible for different extraintestinal diseases in birds, known as avian colibacillosis. In poultry, these infections can be local or systemic, and include acute coli-septicemia, fibrinopurulent polyserositis, aero-sacculitis, pericarditis, salpingitis, synovitis, omphalitis, yolk sac infection, swollen head syndrome, coli-granuloma, and cellulitis [4]. Due to their high incidence and mortality, these diseases cause huge economic losses in the poultry sector around the world.
APEC strains produce a variety of virulence factors facilitating host tissue colonization, including adhesins (encoded by papC and tsh), iron uptake systems (iutA, irp2, sit and iroN), serum resistance (iss, ompT and kpsII), toxins (vat), and others (cvi/cva and etsB) [5]. Many genes coding for these virulence factors are often clustered together on chromosomes and plasmids and can be transmitted by horizontal gene transfer [6]. Moreover, APEC and other ExPEC strains that cause infections in humans, are quite closely phylogenetically related and share some of the same virulence genes. Therefore, APEC strains may hypothetically have zoonotic potential and pose a health risk to humans [7].
In recent years, a significant increase in antibiotic resistance has been noted not only among pathogenic strains, but also among commensal E. coli. Antibiotic-resistant E. coli strains are currently found in a variety of environments, and their spread is promoted by the extreme genomic plasticity of these bacteria [8]. A report from the European Antimicrobial Resistance Surveillance Network (EARS-Net) from 2020 shows that more than half (57.1%) of the E. coli strains from humans reported in 2019 showed resistance to at least one of the groups of antibiotics under surveillance. Resistance to penicillin was most commonly reported (57.1%), followed by fluoroquinolones (23.8%), third-generation cephalosporins (15.1%), and aminoglycosides (10.8%) [9]. A high percentage of antibiotic-resistant E. coli isolates is also noted in farm animals, especially poultry. In Poland, E. coli strains from broiler chickens are most commonly found to be resistant to penicillin, fluor-quinolones and tetracyclines, and antibiotic resistance applies both to isolates from non-clinical birds and to cases of colibacillosis [10].
The occurrence of resistant E. coli bacteria in wild birds, including multidrug resistant strains, has been demonstrated by several authors conducting research in various countries around the world, including Poland [11,12,13,14,15]. They can also be a reservoir of APEC, as well as E. coli strains pathogenic to humans, including E. coli serotype H7:O157 [16,17]. Due to their migratory lifestyle, free-living birds can be contributing vectors for the spread of potentially dangerous E. coli strains between ecosystems.
Information on the characteristics of E. coli strains in free-living birds in Poland is limited. Therefore, we have conducted a study aimed at assessing the occurrence of antibiotic-resistant and virulent E. coli from wild birds inhabiting suburban areas of south-eastern Poland. Referring to this fact, the intention of the study was to determine, whether wild birds are carriers and transmitters of dangerous Enterobacteriaceae strains that, when spreading in the environment, may pose a threat to poultry farms.
2. Results
2.1. Identification of E. coli
E. coli bacteria were isolated from 32 of 34 samples taken from wild birds. Log(score) values obtained in MALDI-TOF mass spectrometry were higher than 2300 for all these isolates, which indicates a high probability of correct identification to the species level (Table 1). The largest number of E. coli isolates (n = 13) was obtained from mallards (Anas platyrhynchos), and the rest from white-tailed eagle (Haliaeetus albicilla) (n = 2), common buzzard (Buteo buteo) (n = 2), Eurasian sparrow hawk (Accipiter nisus) (n = 2), Eurasian tawny owl (Stix aluco) (n = 2), mute swan (Cygnus olor) (n = 1), little bittern (Ixobrychus minutus) (n = 1), little owl (Athene noctua) (n = 1), short-eared owl (Asio flammeus) (n = 1), great spotted woodpecker (Dendrocopos major) (n = 1), lesser spotted woodpecker (Dendrocopos minor) (n = 1), European green woodpecker (Picus viridis) (n = 1), bohemian waxwing (Bombycilla garrulus) (n = 1), western capercaillie (Tetrao urogallus) (n = 1), grey heron (Ardea cinerea) (n = 1), and Eurasian golden oriole (Oriolus oriolus) (n = 1) (Table 1). Two birds from which we did not isolate E. coli belonged to the species peregrine falcon (Falco peregrinus). From cloacal swabs from these birds, bacterial growth on MacConkey agar was obtained; however, these strains were identified by MALDI-TOF MS as Escherichia albertii (data not shown).
2.2. Antibiotic Resistance of E. coli
Multidrug-resistant (MDR) bacteria show non-susceptibility to at least one agent in three or more antimicrobial categories [18]. Analysis of resistance to antimicrobial agents based on MICs showed that 31.2% (n = 10) of the E. coli strains were resistant to three or more groups of antibiotic and 28.1% (n = 9) were resistant to two groups of antibiotic (Table 1). Only one E. coli isolate (e48) was found to be susceptible to all antimicrobials tested. As many as, 50% of isolates (n = 16) were resistant to tetracycline and 10 strains showed intermediate susceptibility to this antibiotic. Resistance to ciprofloxacin was demonstrated in 46.8% (n = 15) of isolates. Among aminoglycosides, 34.3% (n = 11) of isolates were resistant to gentamicin, and 40.6% (n = 13) showed intermediate susceptibility to this antimicrobial agent, while 18.7% (n = 6) of E. coli strains showed resistance to kanamycin. Lower incidence of resistance was found for trimethoprim/sulfamethoxazole (34.3%, n = 11) and ampicillin (28.1%, n = 9). Resistance to chloramphenicol was noted sporadically, with only two (6.25%) resistant isolates and one with intermediate susceptibility (3.1%) (Table 2). MDR E. coli isolates came from mallard (Anas platyrhynchos) (n = 6), Eurasian golden oriole (Oriolus oriolus) (n = 1), Eurasian sparrow hawk (Accipiter nisus) (n = 1), common buzzard (Buteo buteo) (n = 1) and little bittern (Ixobrychus minutus) (n = 1). Among the MDR E. coli strains, the most common resistance profile was tetracycline–trimethoprim/sulfamethoxazole–ampicillin (Table 1).
2.3. Detection of Resistance and Virulence Genes
All isolates showing resistance to ampicillin (n = 9) contained the blaTEM gene (encoding β-lactamase TEM capable of inactivating penicillin, including ampicillin), and the aphA1 gene (coding for aminoglycoside 3′-phosphotransferase) was found in all kanamycin-resistant E. coli strains (n = 6). The sul2 gene (encoding the mutant dihydropteroate synthase enzyme that does not bind sulfonamides) was detected in 10 of 11 E. coli phenotypically resistant to trimethoprim/sulfamethoxazole, the sul3 gene was detected in three strains, and one strain resistant to these two antibiotics additionally had the dhfrI gene (mediating trimethoprim resistance). The tetA gene was found in four of 16 isolates showing resistance to tetracycline. Regarding streptomycin resistance genes, which belong to aminoglycoside group, aadA was found in two of all examination strains and gene strA/strB was also found in two strains. None of the E. coli isolates contained the tetB, aac(3)-IV, aac(3)-II, aphA2, qnr, catI or sul1 gene (Table 1).
Nine of the 24 virulence genes were detected in the E. coli isolates. The most commonly detected were irp-2 (found in 31.2% of isolates, n = 10,) ompT (28.1%, n = 9), iutA and iss (21.8%, n = 7 each). Other virulence genes typical of APEC strains, i.e., cva/cvi, iucD, pap-C and tsh, were detected less frequently. Furthermore, the astA gene characteristic of enteroaggregative E. coli strains (EAEC) was recorded in four isolates. Nine (28.1%) E. coli strains contained multiple virulence genes (at least three), but none of the virulence genes were detected in 37.5% (n = 12) strains (Table 1).
Five strains that contained at least five virulence genes were classified as APEC. Three strains (from mallard) showed coexistence with five APEC-specific virulence genes (ompT + iutA + iucD + iss + cva/cvi), one isolate (from Eurasian sparrow hawk) contained six virulence genes (ompT + iutA + iucD + irp-2 + iss + cva/cvi), and one strain (from little bittern) had six genes (ompT + iutA + iucD + irp-2 + iss + cva/cvi + astA) characteristic of APEC as well as astA.
2.4. Determination of E. coli Phylogenetic Groups
Phylogenetic groups of E. coli were determined based on the electrophoretic profiles of multiplex PCR amplicons (yja, TspE4.C2, chuA, svg and uidA). Half (50%) of the isolates (n = 16) belonged to group B1, 25% of isolates (n = 8) were assigned to group A, 12.5% (n = 4) to B2 and 12.5% (n = 4) to group D. None of the isolates belonged to group B21 (all isolates were svg-negative) (Figure 1).
Most of the MDR strains belonged to the type A phylogenetic group (seven of 10 MDR strains), two to group B1 and one to group D. Strains containing virulence factors (n = 21.7%) were assigned to various phylogenetic groups, including group A (n = 7), B1 (n = 5), B2 (n = 4) and D (n = 4). As many as 10 of 12 isolates in which no virulence gene was detected represented phylogenetic group B1. In addition, seven isolates in group B1 were negative for both virulence and resistance genes.
The incidence of virulence genes ompT, iutA, and iucD in the phylogenetic group B1 is significantly lower than in A, B2 and D. The observed relationship is at an average level as indicated by the analysis of the contingency coefficient (0.52, 0.47, 0.48, respectively). For these three genes, a significant correlation was also observed in the decrease in virulence with the increase in the number of observations in the B1 = phylogenetic group, which confirms the strength of the relationship observed. Taking into account all the virulence genes tested, the B1 phylogenetic group was significantly less virulent (p = 0.009) than the others (contingency coefficient 0.55).
3. Discussion
So far, only a few studies have been carried out on antibiotic resistance and the presence of virulence genes in E. coli bacteria from free-living birds in Poland. Antibiotic-resistant E. coli strains, including MDR, are widely isolated from humans [19], farm animals [20,21] and increasingly from wildlife [22]. Our study has shown that resistant E. coli strains, including MDR, are spread among wild birds. The frequency of resistance is much higher than that observed for E. coli originating in water birds from the Baltic Sea coast in Poland [14] and in birds living in other parts of Europe [11,12,23].
The high frequency of tetracycline resistance (50%) in the strains tested in our study is consistent with the results of Pinto et al. [13] and Radhauani et al. [12], who found that over 70% of E. coli from Portuguese wild birds showed a tetracycline-resistant phenotype. It should be emphasized, however, that several other authors noted less than 22% tetracycline-resistant E. coli from free-living birds [11,23,24,25,26]. In E. coli isolates from poultry, the frequency of resistance to tetracycline is over 70% [27,28,29]. The tet(A) gene found in several phenotypically resistant strains is often detected in Enterobacteriaceae from poultry [30] and was recorded in E. coli isolates from wild birds of the Azores Archipelago [31].
In the case of ampicillin, the resistance rate in E. coli strains was 28.1%, and the results were similar to those reported by other authors [11,24,26], who identified 18.1–19.5% of isolates as ampicillin-resistant. In poultry, significantly higher resistance to ampicillin (≥63%) is generally found [27,28]. Phenotypic resistance correlated with the presence of the blaTEM gene, that was also previously found in ampicillin-resistant E. coli from buzzards (Buteo buteo) in Portugal and wild birds in Poland [12,14].
The percentage of ciprofloxacin-resistant isolates reported in our study (nearly 50%) is consistent with the results of Radhauani et al. [12], who found a resistance rate of 50% in E. coli isolates from buzzards. Other authors, however, note a much lower frequency of fluoroquinolone resistance in E. coli from wild birds, ranging from 3% to 22% [24,25], and some do not report resistance to this group of antimicrobial agents at all [15,23]. In E. coli from broiler chickens, the percentage of isolates resistant to ciprofloxacin is usually high, above 50% [27,28].
An interesting finding was the high percentage of gentamicin-resistant strains confirmed in our study (75%), which significantly differs from the results of other research projects. Several authors [15,24,26] observed fewer than 1% gentamicin-resistant strains among E. coli isolates from wild birds. To rule out any error in determining the gentamicin MIC value, we additionally used the disc diffusion method (data not shown). Despite the high percentage of gentamicin-resistant strains, the resistance genes that usually determine resistance to gentamicin in Enterobacteriaceae, i.e., aac(3)-II and aac(3)-IV (coding for aminoglycoside acetyltransferase), were not detected. It is therefore possible that resistance to gentamicin in the strains is the result of the production of other aminoglycoside-modifying genes (e.g., ant-2) or other resistance mechanisms [32].
The percentage of trimethoprim/sulfamethoxazole-resistant isolates recorded in our study (over 35%) is similar to the results of Radhouani et al. [12], who classified 22% of E. coli isolates from common buzzards in Portugal as phenotypically resistant. A much lower frequency of trimethoprim/sulfamethoxazole-resistant E. coli strains, of less than 5%, was observed in isolates from European starlings (Sturnus vulgaris) [15]. In line with other studies, we also note the common presence of the sul2 gene in trimethoprim/sulfamethoxazole-resistant E. coli isolates [15].
A high percentage of antibiotic-resistant strains found in wild birds in this study may be the result of acquisition of resistant strains from human sources, farms, or contaminated river water [33]. Wastewater and outflows from fields fertilized with manure make their way into rivers, and fecal bacteria may thus be transported over long distances.
Virulence genes characteristic of APEC, as well as the astA gene, were detected in most of the E. coli isolates. The most frequently identified gene was irp-2, which encodes iron-repressible high-molecular weight protein 2 (IRP-2), involved in iron acquisition. Some authors show a high prevalence of this gene among EAEC strains, although the role of IRP-2 in EAEC pathogenesis in unclear [34]. The irp-2 gene recorded in this study, as well as other genes suggested as predictors of the virulence of APEC strains, i.e., ompT, iutA, iss, pap-C, cva/cvi and tsh, are commonly found in pathogenic E. coli strains from poultry [35], but have also been reported in E. coli from wild birds [36]. Kuczkowski et al. [36] demonstrated the frequent occurrence of the irp-2 and astA genes (in 11.6% of isolates), while the iss, iucD, tsh, pap-C and vat genes were rarely found in E. coli isolates from wild water birds in Poland and the Netherlands. Borges et al. [16] showed that 30.6% of E. coli isolates taken from wild birds in Brazil were positive for at least one virulence gene, the most prevalent being iss, followed by sitA, traT, ompT, fyuA and irp2. Other virulence-associated genes, including iutA, iucC, iucD, tsh and cvaC, were detected sporadically. The astA gene found in several isolates is responsible for the production of heat-stable enterotoxin 1 (EAST1) characteristic of diarrheagenic EAEC strains [37]. The presence of the astA gene has also been confirmed in ExPEC strains derived from both humans (UPEC) and poultry (APEC) [36,38]. However, ExPEC isolates may also contain an astA pseudogene that has not been reported in diarrheagenic E. coli strains [38].
The dominance of E. coli group B1 isolates in this study is consistent with the results of other authors analyzing E. coli from wild birds [36,39]. Commensal E. coli with no pathogenic features which inhabit the gastrointestinal tract most often represent group A or B1, while ExPEC strains (including APEC) are usually assigned to phylogenetic groups B2 and D [2]. The E. coli strains used in these studies were not tested for pathogenicity, but we have noted a significantly lower incidence of virulence genes in isolates of the phylogenetic group B1. Four out of five strains qualified as APEC represented phylogenetic group A, and one strain represented group B1.
4. Materials and Methods
4.1. Isolation of Escherichia coli Strains
The material for the study was fresh feces from 34 wild birds of different species in mainly habiting suburban areas of south-eastern Poland. One sample per bird was collected within 1–2 h after the birds had been transported to the Wild Bird Rehabilitation Centre at the Department and Clinic of Animal Surgery, Faculty of Veterinary Medicine, University of Life Sciences in Lublin. The material was collected between May and October 2017. Samples were recovered from 17 wild bird species: mallard (Anas platyrhynchos, n = 13), white-tailed eagle (Haliaeetus albicilla, n = 2), common buzzard (Buteo buteo, n = 2), Eurasian sparrow hawk (Accipiter nisus, n = 2), peregrine falcon (Falco peregrines, n = 2), Eurasian tawny owl (Stix aluco, n = 2), mute swan (Cygnus olor, n = 1), little bittern (Ixobrychus minutes, n = 1), little owl (Athene noctua, n = 1), short-eared owl (Asio flammeus, n = 1), great spotted woodpecker (Dendrocopos major, n = 1), lesser spotted woodpecker (Dendrocopos minor, n = 1), European green woodpecker (Picus viridis, n = 1), bohemian waxwing (Bombycilla garrulous, n = 1), western capercaillie (Tetrao urogallus, n = 1), grey heron (Ardea cinerea, n = 1) and Eurasian golden oriole (Oriolus oriolus, n = 1). Feces was suspended in buffered peptone water (Oxoid Ltd., Basingstoke, UK) and subsequently, a loopful from each suspension was inoculated directly onto MacConkey agar (Oxoid Ltd., Basingstoke, UK) plates and incubated at 37 °C for 24 h under aerobic conditions. Single pink colonies were harvested, cultured on BHI (Brain Heart Infusion) broth (Oxoid Ltd., Basingstoke, UK) and pure cultures supplemented with 20% glycerol were stored at −80 °C for further analysis.
4.2. Identification of E. coli
The species of the isolates were confirmed by MALDI-TOF mass spectrometry (UltrafleXtreme MALDI-TOF, Bruker Daltonics, Hamburg, Germany) using a standard ethanol/formic acid extraction sample preparation procedure [40]. The mass spectra obtained from each isolate were processed with the MALDI Biotyper 3.0 software package (Bruker Daltonics, Hamburg, Germany), and the results were shown as the top 10 identification matches along with confidence scores ranging from 0.000 to 3.000, according to the manufacturer’s criteria (www.bruker.com; accessed on: 19 September 2021).
4.3. Antibiotic Susceptibility Testing
Antibiotic profiles of E. coli strains were based on determination of the minimum inhibitory concentration (MIC) of the antibiotic defined by serial microdilution in Mueller-Hinton broth (Oxoid Ltd., Basingstoke, UK) on a 96-well flat-bottomed microplate (Medlab, Raszyn, Poland), according to standards developed by the Clinical and Laboratory Standards Institute [41].
The antimicrobials tested were ciprofloxacin (0.125–128 μg/mL), ampicillin (0.25–256 μg/mL), gentamicin (0.125–256 μg/mL), tetracycline (0.5–256 μg/mL), chloramphenicol (0.5–256 μg/mL), kanamycin (0.25–256 μg/mL), and trimethoprim/sulfamethoxazole (0.25–64 μg/mL and 4.75–1216 μg/mL, respectively, mixed at a 1:19 ratio). All dry powder antibiotics were purchased from Roth, Zielona Góra, Poland), except trimethoprim and sulfamethoxazole, which were obtained from Merck KGaA (Darmstadt, Germany), and ciprofloxacin, obtained from Honeywell-Fluka (Bucharest, Romania).
The E. coli colonies grown on Columbia agar with 5% defibrinated horse blood were suspended in 0.85% NaCl solution to obtain a density corresponding to 0.5 on the McFarland scale. Microdilution plates were inoculated with 50 µL of a 1:100-diluted (in Mueller-Hinton broth) inoculum and 50 µL of the appropriate antibiotic concentration (stock solutions were previously dissolved in Mueller-Hinton broth). Plates were incubated at 37 °C for 24 h under aerobic conditions [42]. An Escherichia coli ATCC 25922 reference strain was used as quality control. MIC breakpoint was defined as the lowest concentration of the substance at which no growth of the bacterial strains could be seen. Isolates were classified as susceptible, intermediate and resistant according to the threshold breakpoint proposed by the Clinical and Laboratory Standards Institute [41].
4.4. Detection of Resistance Genes
Genomic DNA from E. coli isolates was isolated using a Gene MATRIX Bacterial & Yeast Genomic DNA Purification Kit (Eurx, Gdańsk, Poland) following the manufacturer’s instructions. The presence of genes conferring resistance to tetracyclines—tet(A) and tet(B); aminoglycosides—aphA1, aphA2, aac(3)-II and aac(3)-IV; sulfonamides—sul1, sul2 and sul3; β-lactams—blaTEM; fluoroquinolones—qnr; trimethoprim—dhfrI; and chloramphenicol—catI and cm1A—were determined by PCR using the primers presented in Table A1. The reaction mixture used in the PCR assay contained 2.5 μL of 10× concentrated reaction buffer containing 25 mM MgCl2, 1 μL 25mM dNTPs mix, 1U AllegroTaq polymerase (Novazym, Poznań, Poland), 1 μL of each of the primers (10 μM) and 1 μL of the tested E. coli DNA in a total volume of 25 μL for each sample. Amplification reactions were performed in a thermocycler (Eppendorf Mastercycler Gradient, Westbury, NY, USA) using the following program: initial denaturation—1 cycle at 94 °C for 5 min, 30 cycles of 40 s at 94 °C, 40 s at 50–66 °C (according to the annealing temperature for the individual primers; Table A1), and 75 s at 72 °C, followed by 8 min of final extension at 72 °C. The PCR products in a volume of 8 μL were separated by electrophoresis (100 V) on a 1.5% agarose gel in 1 × TBE (Tris-borate-EDTA) buffer and visualized by SimplySafe staining (Eurx, Poland). A 100–1000 bp molecular standard (Blirt, Gdańsk, Poland) was used to determine the size of the amplification products, using Quantity One software (BioRad, Hercules, CA, USA).
4.5. Detection of Virulence Genes
Uni-plex or multiplex PCR, using gene-specific primers (Table A2 and Table A3), was used to detect the presence of 24 genes associated with virulence in E. coli strains. Three E. coli strains containing virulence genes were used as positive controls (stx1- and stx2-; eaeA- and hlyA-; astA-, escV- and eaeA-positive strains). Based on criteria described by De Carli et al. [43], isolates containing at least five virulence genes were considered APEC strains and isolates containing fewer than five virulence genes were considered avian non-pathogenic Escherichia coli (non-APEC) strains.
4.6. Determination of E. coli Phylogenetic Groups
To determine the phylogenetic groups of the E. coli isolates, five sets of primers for the genes yja, TspE4.C2, chuA, svg and uidA were used in a multiplex PCR, as previously described [44]. PCR products were separated by electrophoresis in 3% (w/v) high resolution agarose (Blirt, Gdańsk, Poland). The phylogenetic groups were determined based on the PCR gel pattern.
4.7. Statistical Analysis
In order to identify associations between phylogenetic groups of isolates and the presence of virulence-associated genes, the Chi-square independence test with Yates correction was used. The level of significance was set as p < 0.05. The statistical analysis was performed with the use of Statistica 13 data analysis software system, TIBCO Software Inc. 2017 (Palo Alto, CA, USA).
5. Conclusions
To sum up, the results of the study indicate that free-living birds can be a reservoir of E. coli strains containing both resistance and virulence genes, and due to their migratory life cycle they can contribute to the spread of resistant microbes between ecosystems. Given the large number of birds migrating in Europe each year, their contribution to the spread of drug-resistant and avian pathogenic strains of E. coli appears to be significant.
Monitoring the presence of antibiotic-resistant and pathogenic microorganisms in wild animals in various geographical areas makes it possible to assess the impact of the spread of resistance genes on humans and animals and enables the implementation of possible measures to control antibiotic resistance.
Further research is needed to clarify the high percentage of gentamicin-resistant E. coli strains not previously found in birds, and the mechanisms of resistance to this antibiotic.
Author Contributions
Conceptualization, A.N. and D.S.-P.; methodology, A.N. and M.D.; software, A.N. and M.D.; validation, A.N., M.D. and D.S.-P.; formal analysis, A.N. and M.D.; investigation, A.N. and M.D.; resources, P.R. and A.M.; data curation, A.N. and M.D.; writing—original draft preparation, A.N.; writing—review and editing, M.D.; visualization, M.D.; supervision, R.U.-C. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All data generated or analysed during this study are included in this published article and its appendix information files.
Acknowledgments
The authors would like to thank Professor Stanisław Winiarczyk and Doctor Dorota Pietras-Ożga from the Department of Epizootiology and the Clinic of Infectious Diseases, University of Life Sciences in Lublin, for sharing mass spectrometer and technical assistance during identification of E. coli by MALDI-TOF mass spectrometry. We also would like to thank Professor Jacek Osek from the National Veterinary Research Institute in Puławy and Doctor Barbara Turchi from the University of Pisa, for positive E. coli strain used in detection of virulence genes.
Conflicts of Interest
The authors declare no conflict of interest.
Appendix A
Table A1: Primer sequences for resistance genes and PCR conditions, Table A2: PCR primers used for detection of virulence genes, Table A3: PCR schemes used to detect virulence genes in E. coli.
Table A1.
Primer sequences for resistance genes and PCR conditions.
| Target Gene | Sequence (5′ → 3′) | Annealing Temperature (°C) | Size of Amplification Product (bp) | Reference |
|---|---|---|---|---|
| aphA1 | F: ATG GGC TCG CGA TAA TGT C R: CTC ACC GAG GCA GTT CCA T | 50 | 600 | [45] |
| aphA2 | F: GAA CAA GAT GGA TTG CAC GC R: GCT CTT CAG CAA TAT CAC GG | 50 | 680 | [45] |
| sul1 | F: TTC GGC ATT CTG AAT CTC AC R: ATG ATC TAA CCC TCG GTC TC | 50 | 822 | [45] |
| sul2 | F: CGG CAT CGT CAA CAT AAC C R: GTG TGC GGA TGA AGT CAG | 50 | 722 | [45] |
| sul3 | F: CAA CGG AAG TGG GCG TTG TGG A R: GCT GCA CCA ATT CGC TGA ACG | 66 | 244 | [46] |
| blaTEM | F: GAG TAT TCA ACA TTT TCG T R: ACC AAT GCT TAA TCA GTG A | 50 | 857 | [45] |
| tet(A) | F: GTG AAA CCC AAC ATA CCC C R: GAA GGC AAG CAG GAT GTA G | 50 | 887 | [45] |
| tet(B) | F: CCT TAT CAT GCC AGT CTT GC R: ACT GCC GTT TTT TCG CC | 50 | 773 | [45] |
| dhfrI | F: AAG AAT GGA GTT ATC GGG ATT G R: GGG TAA AAA CTG GCC TAA AAT TG | 50 | 391 | [45] |
| qnr | F: GGG TAT GGA TAT TAT TGA TAA AG R: CTA ATC CGG CAG CAC TAT TTA | 50 | 670 | [47] |
| aac(3)-IV | F: CTT CAG GAT GGC AAG TTG GT R: TCA TCT CGT TCT CCG CTC AT | 55 | 286 | [47] |
| cmlA | F: CCG CCA CGG TGT TGT TGT TAT C R: CAC CTT GCC TGC CCA TCA TTA G | 55 | 698 | [47] |
| catI | F: AGT TGC TCA ATG TAC CTA TAA CC R: TTG TAA TTC ATT AAG CAT TCT GCC | 55 | 547 | [47] |
| aac(3)-II | F: ATA TCG CGA TGC ATA CGC GG R: GAC GGC CTC TAA CCG GAA GG | 56 | 877 | [48] |
| aadA | F: GTG GAT GGC GGC CTG AAG CC R: AAT GCC CAG TCG GCA GCG | 62 | 525 | [46] |
| strA/strB | F: ATG GTG GAC CCT AAA ACT CT R: CGT CTA GGA TCG AGA CAA AG | 62 | 893 | [46] |
Table A2.
PCR primers used for detection of virulence genes.
| Pathovar | Target Gene | Sequence (5′ → 3′) of Primers | Size of Amplification Product (bp) | Reference |
|---|---|---|---|---|
| EHEC, EPEC | escV | F: ATT CTG GCT CTC TTC TTC TTT ATG GCT G R: CGT CCC CTT TTA CAA ACT TCA TCG C | 544 | [49] |
| ent | F: TGG GCT AAA AGA AGA CAC ACT G R: CAA GCA TCC TGA TTA TCT CAC C | 629 | [49] | |
| eaeA | F: GAC CCG GCA CAA GCA TAA GC R: CCA CCT GCA GCA ACA AGA GG | 384 | [50] | |
| Typical EPEC | bfpB | F: GAC ACC TCA TTG CTG AAG TCG R: CCA GAA CAC CTC CGT TAT GC | 910 | [49] |
| EHEC | stx1 | F: ATA AAT CGC CAT TCG TTG ACT AC R: AGA ACG CCC ACT GAG ATC ATC | 180 | [50] |
| stx2 | F: GGC ACT GTC TGA AAC TGC TCC R: TCG CCA GTT ATC TGA CAT TCT G | 255 | [50] | |
| hlyA | F: GCA TCA TCA AGC GTA CGT TCC R: AAT GAG CCA AGC TGG TTA AGC T | 534 | [50] | |
| saa | F: CGT GAT GAA CAG GCT ATT GC R: ATG GAC ATG CCT GTG GCA AC | 119 | [50] | |
| EIEC | ipaH | F: GAA AAC CCT CCT GGT CCA TCA GG R: GCC GGT CAG CCA CCC TCT GAG AGT AC | 437 | [49] |
| invE | F: CGA TAG ATG GCG AGA AAT TAT ATC CCG R: CGA TCA AGA ATC CCT AAC AGA AGA ATC AC | 766 | [49] | |
| EAEC | astA | F: TGC CAT CAA CAC AGT ATA TCC G R: ACG GCT TTG TAG TCC TTC CAT | 102 | [49] |
| aggR | F: ACG CAG AGT TGC CTG ATA AAG R: AAT ACA GAA TCG TCA GCA TCA GC | 400 | [49] | |
| pic | F: AGC CGT TTC CGC AGA AGC C R: AAA TGT CAG TGA ACC GAC GAT TGG | 1,111 | [49] | |
| ETEC | elt | F: GAA CAG GAG GTT TCT GCG TTA GGT G R: CTT TCA ATG GCT TTT TTT TGG GAG TC | 655 | [49] |
| estIa | F: CCT CTT TTA GYC AGA CAR CTG AAT CAS TTG R: CAG GCA GGA TTA CAA CAA AGT TCA CAG | 157 | [49] | |
| estIb | F: TGTCTTTTTCACCTTTCGCTC R: CGGTACAAGCAGGATTACAACAC | 171 | [49] | |
| APEC | ompT | F: TCA TCC CGG AAG CCT CCC TCA CTA CTA T R: TAG CGT TTG CTG CAC TGG CTT CTG ATA C | 496 | [51] |
| iutA | F: GGC TGG ACA TCA TGG GAA CTG G R: CGT CGG GAA CGG GTA GAA TCG | 302 | [51] | |
| irp-2 | F: AAG GAT TCG CTG TTA CCG GAC R: AAC TCC TGA TAC AGG TGG C | 413 | [52] | |
| iss | F: ATC ACA TAG GAT TCT GCC G R: CAG CGG AGT ATA GAT GCC A | 306 | [52] | |
| pap-C | F: TGA TAT CAC GCA GTC AGT AGC R: CCG GCC ATA TTC ACA TAA | 501 | [52] | |
| tsh | F: ACT ATT CTC TGC AGG AAG TC R: CTT CCG ATG TTC TGA ACG T | 824 | [52] | |
| cva/cvi | F: TGG TAG AAT GTG CCA GAG CAA G R: GAG CTG TTT GTA GCG AAG CC | 1181 | [52] | |
| iucD | F: ACA AAA AGT TCT ATC GCT TCC R: CCT GAT CCA GAT GAT GCT C | 714 | [52] |
Table A3.
PCR schemes used to detect virulence genes in E. coli.
| PCR Type | Detected Genes | Annealing Temperature (°C) | Reference |
|---|---|---|---|
| Multiplex I | stx1, stx2, hylA, eaeA, saa | 65 (10 cycles) then 62 (20 cycles) | [50] |
| Multiplex II | ecsV, ent, bfpB, invE, astA, aggR, pic, ipaH, elt, estIa, estIb | 62 | [49] |
| Multiplex III | ompT, iutA | 63 | [51] |
| Multiplex IV | tsh, pap-C, iss, irp-2 | 57 | [52] |
| Uniplex I | cva/cvi | 58 | [52] |
| Uniplex II | iucD | 55 | [52] |
References
- Kotłowski, R.; Grecka, K.; Kot, B.; Szweda, P. New Approaches for Escherichia coli Genotyping. Pathogens 2020, 9, 73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sarowska, J.; Futoma-Koloch, B.; Jama-Kmiecik, A.; Frej-Madrzak, M.; Ksiazczyk, M.; Bugla-Ploskonska, G.; Choroszy-Krol, I. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources: Recent reports. Gut Pathog. 2019, 11, 10. [Google Scholar] [CrossRef] [Green Version]
- Köhler, C.D.; Dobrindt, U. What defines extraintestinal pathogenic Escherichia coli? Int. J. Med. Microbiol. 2011, 301, 642–647. [Google Scholar] [CrossRef] [PubMed]
- Giovanardi, D.; Campagnari, E.; Ruffoni, L.S.; Pesente, P.; Ortali, G.; Furlattini, V. Avian pathogenic Escherichia coli transmission from broiler breeders to their progeny in an integrated poultry production chain. Avian Pathol. 2005, 34, 313–318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kathayat, D.; Lokesh, D.; Ranjit, S.; Rajashekara, G. Avian Pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies. Pathogens 2021, 10, 467. [Google Scholar] [CrossRef] [PubMed]
- Varga, C.; Brash, M.L.; Slavic, D.; Boerlin, P.; Susta, L. Evaluating Virulence-Associated Genes and Antimicrobial Resistance of Avian Pathogenic Escherichia coli Isolates from Broiler and Broiler Breeder Chickens in Ontario, Canada. Avian Dis. 2018, 62, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Cunha, M.P.; de Oliveira, M.G.; de Oliveira, M.C.; da Silva, K.C.; Gomes, C.R.; Moreno, A.M.; Knöbl, T. Virulence profiles, phylogenetic background, and antibiotic resistance of Escherichia coli isolated from turkeys with airsacculitis. Sci. World J. 2014, 2014, 289024. [Google Scholar] [CrossRef] [Green Version]
- Baldy-Chudzik, K.; Bok, E.; Mazurek, J. Well-known and new variants of pathogenic Escherichia coli as a consequence of the plastic genome. Postepy Hig. Med. Dosw. 2015, 69, 345–361. [Google Scholar] [CrossRef]
- ECDC. Antimicrobial Resistance in the EU/EEA (EARS-Net)-Annual Epidemiological Report 2019. In Proceedings of the European Centre for Disease Prevention and Control, Stockholm, Sweden, 2020; Available online: https://www.ecdc.europa.eu/sites/default/files/documents/surveillance-antimicrobial-resistance-Europe-2019.pdf (accessed on 19 September 2020).
- Roth, N.; Käsbohrer, A.; Mayrhofer, S.; Zitz, U.; Hofacre, C.; Domig, K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: A global overview. Poult. Sci. 2019, 98, 1791–1804. [Google Scholar] [CrossRef]
- Stedt, J.; Bonnedahl, J.; Hernandez, J.; McMahon, B.J.; Hasan, B.; Olsen, B.; Drobni, M.; Waldenström, J. Antibiotic resistance patterns in Escherichia coli from gulls in nine European countries. Infect. Ecol. Epidemiol. 2014, 4. [Google Scholar] [CrossRef] [Green Version]
- Radhouani, H.; Poeta, P.; Gonçalves, A.; Pacheco, R.; Sargo, R.; Igrejas, G. Wild birds as biological indicators of environmental pollution: Antimicrobial resistance patterns of Escherichia coli and enterococci isolated from common buzzards (Buteo buteo). J. Med. Microbiol. 2012, 61, 837–843. [Google Scholar] [CrossRef]
- Pinto, A.; Simões, R.; Oliveira, M.; Vaz-Pires, P.; Brandão, R.; da Costa, P.M. Multidrug resistance in wild bird populations: Importance of the food chain. J. Zoo Wildl. Med. 2015, 46, 723–731. [Google Scholar] [CrossRef]
- Literak, I.; Dolejska, M.; Janoszowska, D.; Hrusakova, J.; Meissner, W.; Rzyska, H.; Bzoma, S.; Cizek, A. Antibiotic-resistant Escherichia coli bacteria, including strains with genes encoding the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic Sea Coast of Poland. Appl. Environ. Microbiol. 2010, 76, 8126–8134. [Google Scholar] [CrossRef] [Green Version]
- Gaukler, S.M.; Linz, G.M.; Sherwood, J.S.; Dyer, N.W.; Bleier, W.J.; Wannemuehler, Y.M.; Nolan, L.K.; Logue, C.M. Escherichia coli, Salmonella, and Mycobacterium avium subsp. paratuberculosis in wild European starlings at a Kansas cattle feedlot. Avian Dis. 2009, 53, 544–551. [Google Scholar] [CrossRef]
- Borges, C.A.; Beraldo, L.G.; Maluta, R.P.; Cardozo, M.V.; Barboza, K.B.; Guastalli, E.A.; Kariyawasam, S.; DebRoy, C.; Ávila, F.A. Multidrug-resistant pathogenic Escherichia coli isolated from wild birds in a veterinary hospital. Avian Pathol. 2017, 46, 76–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wallace, J.S.; Cheasty, T.; Jones, K. Isolation of vero cytotoxin-producing Escherichia coli O157 from wild birds. J. Appl. Microbiol. 1997, 82, 399–404. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dehbanipour, R.; Rastaghi, S.; Sedighi, M.; Maleki, N.; Faghri, J. High prevalence of multidrug-resistance uropathogenic Escherichia coli strains, Isfahan. Iran Nat. Sci. Biol. Med. 2016, 7, 22–26. [Google Scholar]
- Srinivasan, V.; Gillespie, B.E.; Lewis, M.J.; Nguyen, L.T.; Headrick, S.I.; Schukken, Y.H.; Oliver, S.P. Phenotypic and genotypic antimicrobial resistance patterns of Escherichia coli isolated from dairy cows with mastitis. Vet. Microbiol. 2007, 124, 319–328. [Google Scholar] [CrossRef]
- Yang, H.; Chen, S.; White, D.G.; Zhao, S.; McDermott, P.; Walker, R.; Meng, J. Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. J. Clin. Microbiol. 2004, 42, 3483–3489. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turchi, B.; Dec, M.; Bertelloni, F.; Winiarczyk, S.; Gnat, S.; Bresciani, F.; Viviani, F.; Cerri, D.; Fratini, F. Antibiotic Susceptibility and Virulence Factors in Escherichia coli from Sympatric Wildlife of the Apuan Alps Regional Park (Tuscany, Italy). Microb. Drug Resist. 2019, 25, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Carroll, D.; Wang, J.; Fanning, S.; McMahon, B.J. Antimicrobial resistance in wildlife: Implications for public health. Zoonoses Public Health. 2015, 62, 534–542. [Google Scholar] [CrossRef] [Green Version]
- Dolejska, M.; Bierosova, B.; Kohoutova, L.; Literak, I.; Cizek, A. Antibiotic-resistant Salmonella and Escherichia coli isolates with integrons and extended-spectrum beta-lactamases in surface water and sympatric black-headed gulls. J. Appl. Microbiol. 2009, 106, 1941–1950. [Google Scholar] [CrossRef]
- Kmet, V.; Drugdova, Z.; Kmetova, M.; Stanko, M. Virulence and antibiotic resistance of Escherichia coli isolated from rooks. Ann. Agric. Environ. Med. 2013, 20, 273–275. [Google Scholar]
- Sacristán, C.; Esperón, F.; Herrera-León, S.; Iglesias, I.; Neves, E.; Nogal, V.; Muñoz, M.J.; de la Torre, A. Virulence genes, antibiotic resistance and integrons in Escherichia coli strains isolated from synanthropic birds from Spain. Avian Pathol. 2014, 43, 172–175. [Google Scholar] [CrossRef]
- Mendonça, N.; Figueiredo, R.; Mendes, C.; Card, R.M.; Anjum, M.F.; da Silva, G.J. Microarray evaluation of antimicrobial resistance and virulence of Escherichia coli isolates from Portuguese poultry. Antibiotics 2016, 5, 4. [Google Scholar] [CrossRef] [Green Version]
- Yassin, A.K.; Gong, J.; Kelly, P.; Lu, G.; Guardabassi, L.; Wei, L.; Han, X.; Qiu, H.; Price, S.; Cheng, D. Antimicrobial resistance in clinical Escherichia coli isolates from poultry and livestock, China. PLoS ONE 2017, 12, e0185326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miles, T.D.; McLaughlin, W.; Brown, P.D. Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Vet. Res. 2006, 2, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vuthy, Y.; SunLay, K.; Seiha, H.; Kerleguer, A.; Aidara-Kane, A. Antibiotic susceptibility and molecular characterization of resistance genes among Escherichia coli and among Salmonella subsp. in chicken food chains. Asian Pac. J. Trop Biomed. 2017, 7, 670–674. [Google Scholar] [CrossRef]
- Santos, T.; Silva, N.; Igrejas, G.; Rodrigues, P.; Micael, J.; Rodrigues, T.; Resendes, R.; Gonçalves, A.; Marinho, C.; Gonçalves, D.; et al. Dissemination of antibiotic resistant Enterococcus spp. and Escherichia coli from wild birds of Azores Archipelago. Anaerobe 2013, 24, 25–31. [Google Scholar] [CrossRef] [PubMed]
- Jakobsen, L.; Sandvang, D.; Jensen, V.F.; Seyfarth, A.M.; Frimodt-Møller, N.; Hammerum, A.M. Gentamicin susceptibility in Escherichia coli related to the genetic background: Problems with breakpoints. Clin. Microbiol. Infect. 2007, 13, 830–832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dolejska, M.; Cizek, A.; Literak, I. High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from Black-headed Gulls in the Czech Republic. J. Appl. Microbiol. 2007, 103, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Uber, A.P.; Trabulsi, L.R.; Irino, K.; Beutin, L.; Ghilardi, A.C.; Gomes, T.A.; Liberatore, A.M.; de Castro, A.F.; Elias, W.P. Enteroaggregative Escherichia coli from humans and animals differ in major phenotypical traits and virulence genes. FEMS Microbiol. Lett. 2006, 256, 251–257. [Google Scholar] [CrossRef] [Green Version]
- Subedi, M.; Bhattarai, R.K.; Devkota, B.; Phuyal, S.; Luitel, H. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet. Res. 2018, 14, 166. [Google Scholar] [CrossRef]
- Kuczkowski, M.; Krawiec, M.; Voslamber, B.; Książczyk, M.; Płoskońska-Bugla, G.; Wieliczko, A. Virulence genes and the antimicrobial susceptibility of Escherichia coli, isolated from wild waterbirds, in the Netherlands and Poland. Vector-Borne Zoonotic Dis. 2016, 16, 528–536. [Google Scholar] [CrossRef]
- Osek, J. Identification of the astA gene in enterotoxigenic Escherichia coli strains responsible for diarrhea in pigs. Bull Vet. Inst. Pulawy. 2003, 47, 9–15. [Google Scholar]
- Maluta, R.P.; Leite, J.L.; Rojas, T.; Scaletsky, I.; Guastalli, E.; Ramos, M.C.; da Silveira, W.D. Variants of astA gene among extra-intestinal Escherichia coli of human and avian origin. FEMS Microbiol. Lett. 2017, 364. [Google Scholar] [CrossRef] [Green Version]
- Staji, H.; Shahaboddin, E.; Kafshdouzan, K. Correlation of Escherichia coli strains isolated from wild bird feces and human urinary tract infections from phylogenetic point of view. J. Clin. Microbiol. Infect. 2017, 4, 12653. [Google Scholar] [CrossRef]
- Dudzic, A.; Urban-Chmiel, R.; Stępień-Pyśniak, D.; Dec, M.; Puchalski, A.; Wernicki, A. Isolation, identification and antibiotic resistance of Campylobacter strains isolated from domestic and free-living pigeons. Br. Poult. Sci. 2016, 57, 172–178. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, 9th ed.; CLSI standard M07-A9; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- De Carli, S.; Ikuta, N.; Lehmann, F.K.; da Silveira, V.P.; de Melo Predebon, G.; Fonseca, A.S.; Lunge, V.R. Virulence gene content in Escherichia coli isolates from poultry flocks with clinical signs of colibacillosis in Brazil. Poult. Sci. 2015, 94, 2635–2640. [Google Scholar] [CrossRef]
- Feng, Y.; Mannion, A.; Madden, C.M.; Swennes, A.G.; Townes, C.; Byrd, C.; Marini, R.P.; Fox, J.G. Cytotoxic Escherichia coli strains encoding colibactin and cytotoxic necrotizing factor (CNF) colonize laboratory macaques. Gut Pathog. 2017, 9, 71. [Google Scholar] [CrossRef] [PubMed]
- Maynard, C.; Fairbrother, J.M.; Bekal, S.; Sanschagrin, F.; Levesque, R.C.; Brousseau, R.; Masson, L.; Larivière, S.; Harel, J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar] [CrossRef] [Green Version]
- Kozak, G.K.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Momtaz, H.; Safarpoor Dehkordi, F.; Taktaz, T.; Rezvani, A.; Yarali, S. Shiga toxin-producing Escherichia coli isolated from bovine mastitic milk: Serogroups, virulence factors, and antibiotic resistance properties. Sci. World J. 2012, 2012, 618709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, X.; Xu, B.; Yang, Y.; Liu, D.; Yang, M.; Wang, J.; Shen, H.; Zhou, X.; Ma, X. A high throughput multiplex PCR assay for simultaneous detection of seven aminoglycoside-resistance genes in Enterobacteriaceae. BMC Microbiol. 2013, 13, 58. [Google Scholar] [CrossRef] [Green Version]
- Antikainen, J.; Tarkka, E.; Haukka, K.; Siitonen, A.; Vaara, M.; Kirveskari, J. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples. Eur. J. Clin. Microbiol. Infect. Dis. 2009, 28, 899–908. [Google Scholar] [CrossRef]
- Paton, A.W.; Paton, J.C. Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxA, and saa. J. Clin. Microbiol. 2002, 40, 271–274. [Google Scholar] [CrossRef] [Green Version]
- Van der Westhuizen, W.A.; Bragg, R.R. Multiplex polymerase chain reaction for screening avian pathogenic Escherichia coli for virulence genes. Avian Pathol. 2012, 41, 33–40. [Google Scholar] [CrossRef] [Green Version]
- Ewers, C.; Janssen, T.; Kiessling, S.; Philipp, H.C.; Wieler, L.H. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction. Avian Dis. 2005, 49, 269–273. [Google Scholar] [CrossRef]
Figure 1.
Multiplex PCR patterns for E. coli phylogenetic groups.
Table 1.
Antibiotic resistance phenotypes, resistance genes, virulence genes and phylogenetic groups of all E. coli isolates.
Table 1.
Antibiotic resistance phenotypes, resistance genes, virulence genes and phylogenetic groups of all E. coli isolates.
| Isolate | Species | MALDI-TOF MS Biotyper Log (Score) | Phylogenetic Group | Antibiotic Phenotype Pattern (Including Resistant and Intermediate Strains) a | Resistance Genes | Virulence Genes |
|---|---|---|---|---|---|---|
| e2 | White-tailed eagle (Haliaeetus albicilla) | E. coli 2.348 | D | T-CN-K | aphA1 | astA |
| e3 | White-tailed eagle (Haliaeetus albicilla) | E. coli 2.305 | B1 | CN-CIP | - | - |
| e5 | Mute swan (Cygnus olor) | E. coli 2.470 | B2 | T | - | ompT |
| e13 | Eurasian golden oriole (Oriolus oriolus) | E. coli 2.442 | A | T-TR/S-AMP b | tet(A), sul2, blaTEM, strA/strB | astA |
| e14 | Eurasian sparrow hawk (Accipiter nisus) | E. coli 2.395 | A | T-TR/S-AMP b | sul2, blaTEM, strA/strB | ompT, iutA, iucD, irp-2, iss, cva/cvi |
| e17 | Mallard (Anas platyrhynchos) | E. coli 2.316 | B1 | CN-CIP | - | - |
| e18 | Mallard (Anas platyrhynchos) | E. coli 2.328 | A | T-TR/S-AMP-C b | tet(A), sul3, dhfrI, blaTEM, aadA | ompT |
| e20 | Mallard (Anas platyrhynchos) | E. coli 2.316 | A | CN-CIP-TR/S-AMP b | sul2, blaTEM | ompT, iutA, iucD, iss, cva/cvi |
| e25 | Mallard (Anas platyrhynchos) | E. coli 2.378 | A | T-CN-CIP-TR/S-AMP b | tet(A), sul2, blaTEM | ompT, iutA, iucD, iss, cva/cvi |
| e26 | Mallard (Anas platyrhynchos) | E. coli 2.403 | A | CIP-TR/S-AMP b | sul2, blaTEM | ompT, iutA, iucD, iss, cva/cvi |
| e32 | Eurasian tawny owl (Stix aluco) | E. coli 2.334 | B1 | T-CN | - | - |
| e33 | Mallard (Anas platyrhynchos) | E. coli 2.603 | B1 | T-CN-K | aphA1 | - |
| e34 | Mallard (Anas platyrhynchos) | E. coli 2.344 | B1 | T-CN-K | aphA1 | - |
| e35 | Little bittern (Ixobrychus minutus) | E. coli 2.406 | B1 | T-CN-CIP-TR/S-AMP-K-C b | tet(A), sul2, sul3, blaTEM, aphA1 aadA | astA, ompT, iutA, iucD, irp-2, iss, cva/cvi |
| e36 | Eurasian sparrow hawk (Accipiter nisus) | E. coli 2.370 | B1 | T-CN-CIP | - | - |
| e37 | Mallard (Anas platyrhynchos) | E. coli 2.456 | D | T-CN | - | iss |
| e38 | Mallard (Anas platyrhynchos) | E. coli 2.304 | A | T-CN | - | astA, ompT, tsh |
| e39 | Mallard (Anas platyrhynchos) | E. coli 2.412 | A | T-CN-TR/S b | sul2 | - |
| e42 | Common buzzard (Buteo buteo) | E. coli 2.310 | B1 | T-CN-CIP-TR/S-K-C b | sul2, aphA1 | - |
| e42a | Common buzzard (Buteo buteo) | E. coli 2.345 | B1 | T-CN-K | aphA1, sul3 | - |
| e43 | Little owl (Athene noctua) | E. coli 2.402 | D | CN-TR/S-AMP | sul2, blaTEM | iutA, pap-C, irp-2 |
| e47 | Mallard (Anas platyrhynchos) | E. coli 2. 376 | D | T-CN-CIP-TR/S-AMP b | sul2, blaTEM | iutA, pap-C, irp-2 |
| e48 | Mallard (Anas platyrhynchos) | E. coli 2.502 | B1 | - | - | - |
| e50 | Mallard (Anas platyrhynchos) | E. coli 2.315 | B1 | T-CN-CIP | - | - |
| e53 | Lesser spotted woodpecker (Dendrocopos minor) | E. coli 2.506 | B2 | T-CN | - | irp-2 |
| e54 | European green woodpecker (Picus viridis) | E. coli 2.317 | B2 | T-CN | - | irp-2 |
| e55 | Bohemian waxwing (Bombycilla garrulus) | E. coli 2.404 | B2 | T | - | irp-2 |
| e56 | Eurasian tawny owl (Stix aluco) | E. coli 2.348 | B1 | T-CN-CIP | - | irp-2 |
| e57 | Short-eared owl (Asio flammeus) | E. coli 2.372 | B1 | T-CN-CIP | - | - |
| e58 | Great spotted woodpecker (Dendrocopos major) | E. coli 2.512 | B1 | T-CN-CIP | - | irp-2 |
| e63 | Western capercaillie (Tetrao urogallus) | E. coli 2.309 | B1 | T-CN-CIP | - | irp-2 |
| e64 | Grey heron (Ardea cinerea) | E. coli 2.324 | B1 | T-CIP | - | ompT, iss, cva/cvi |
Legend: a bold and underlined symbols indicate resistance, non-bold, non-underlined symbols indicate intermediate susceptibility; T—tetracycline, C—gentamicin, K—kanamycin, CIP—ciprofloxacin, AMP—ampicillin, C—chloramphenicol, TR/S—trimethoprim/sulfamethoxazole, b MDR strain.
Table 2.
Distribution of minimal inhibitory concentrations (MICs) of antibiotics among Escherichia coli isolates.
Table 2.
Distribution of minimal inhibitory concentrations (MICs) of antibiotics among Escherichia coli isolates.
| Antibiotic | Number of Isolates with MIC (µg/mL) of | Number of Resistant Isolates n/(%) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ≤0.125 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | 128 | ≥256 | ||
| TE | 1 | 1 | 4 | 10 | 13 | 2 | 1 | 16/(50%) | |||||
| CN | 1 | 2 | 1 | 1 | 3 | 13 | 9 | 2 | 11 (34.3%) | ||||
| CIP | 9 | 6 | 2 | 3 | 7 | 4 | 1 | 15/(46.8%) | |||||
| AMP | 4 | 10 | 6 | 3 | 9 | 9/(28.1%) | |||||||
| K | 2 | 2 | 3 | 19 | 6 | 6/(18.7%) | |||||||
| C | 8 | 18 | 2 | 1 | 1 | 1 | 1 | 2/(6.2%) | |||||
| Number of Isolates with MIC (µg/mL) of | |||||||||||||
| ≤0.25/4.75 | 0.5/9.5 | 1/19 | 2/38 | 4/76 | 8/152 | 16/304 | 32/608 | ≥64/1216 | |||||
| TR/S | 7 | 4 | 10 | 9 | 1 | 1 | 11/(34.3%) | ||||||
Legend: dark grey: values for resistant strains; light gray: values for strains with intermediate susceptibility.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Nowaczek, A.; Dec, M.; Stępień-Pyśniak, D.; Urban-Chmiel, R.; Marek, A.; Różański, P. Antibiotic Resistance and Virulence Profiles of Escherichia coli Strains Isolated from Wild Birds in Poland. Pathogens 2021, 10, 1059. https://doi.org/10.3390/pathogens10081059
AMA Style
Nowaczek A, Dec M, Stępień-Pyśniak D, Urban-Chmiel R, Marek A, Różański P. Antibiotic Resistance and Virulence Profiles of Escherichia coli Strains Isolated from Wild Birds in Poland. Pathogens. 2021; 10(8):1059. https://doi.org/10.3390/pathogens10081059
Chicago/Turabian StyleNowaczek, Anna, Marta Dec, Dagmara Stępień-Pyśniak, Renata Urban-Chmiel, Agnieszka Marek, and Paweł Różański. 2021. "Antibiotic Resistance and Virulence Profiles of Escherichia coli Strains Isolated from Wild Birds in Poland" Pathogens 10, no. 8: 1059. https://doi.org/10.3390/pathogens10081059
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
