Next Article in Journal
Galleria mellonella as a Good Model to Study Acinetobacter baumannii Pathogenesis
Next Article in Special Issue
Epidemiological, Clinical, and Microbiological Characteristics in a Large Series of Patients Affected by Dermacentor-Borne-Necrosis-Erythema-Lymphadenopathy from a Unique Centre from Spain
Previous Article in Journal
Molecular Detection and Characterization of Giardia duodenalis in Farmed Pigs in Three Provinces of Southern China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 10
Issue 11
10.3390/pathogens10111482
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar

by
Christian Keller
1,2,*,
Raphaël Rakotozandrindrainy
3,
Vera von Kalckreuth
4,
Jean Noël Heriniaina
3,
Norbert Georg Schwarz
5,
Gi Deok Pak
4,
Justin Im
4,
Ligia Maria Cruz Espinoza
4,
Ralf Matthias Hagen
6,
Hagen Frickmann
7,8,
Jean Philibert Rakotondrainiarivelo
3,
Tsiry Razafindrabe
3,
Denise Dekker
2,
Jürgen May
2,9,10,
Sven Poppert
2 and
Florian Marks
3,4,11
1
Institute of Virology, Philipps University, 35043 Marburg, Germany
2
Infectious Disease Department and Diagnostic Department, Bernhard Nocht Institute for Tropical Medicine, 20359 Hamburg, Germany
3
Department of Microbiology and Parasitology, University of Antananarivo, Antananarivo BP 566, Madagascar
4
International Vaccine Institute, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Korea
5
Independent Researcher, 67227 Frankenthal, Germany
6
Department of Microbiology and Hospital Hygiene, Bundeswehr Central Hospital Koblenz, 56070 Koblenz, Germany
7
Department of Microbiology and Hospital Hygiene, Bundeswehr Hospital Hamburg, 20359 Hamburg, Germany
8
Institute for Medical Microbiology, Virology and Hygiene, University Medicine Rostock, 18057 Rostock, Germany
9
German Centre for Infection Research (DZIF), Hamburg-Lübeck-Borstel-Riems, 38124 Braunschweig, Germany
10
Department of Tropical Medicine II, University Medical Center Hamburg-Eppendorf (UKE), 20359 Hamburg, Germany
11
Cambridge Institute of Therapeutic Immunology and Infectious Disease, University of Cambridge School of Clinical Medicine, Cambridge Biomedical Campus, Cambridge CB2 0SP, UK
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Author to whom correspondence should be addressed.
Pathogens 2021, 10(11), 1482; https://doi.org/10.3390/pathogens10111482
Submission received: 6 October 2021 / Revised: 2 November 2021 / Accepted: 9 November 2021 / Published: 14 November 2021
(This article belongs to the Special Issue Advances in Spotted Fever)
Browse Figure
Review Reports Versions Notes

Abstract

:
Rickettsiae may cause febrile infections in humans in tropical and subtropical regions. From Madagascar, no molecular data on the role of rickettsioses in febrile patients are available. Blood samples from patients presenting with fever in the area of the capital Antananarivo were screened for the presence of rickettsial DNA. EDTA (ethylenediaminetetraacetic acid) blood from 1020 patients presenting with pyrexia > 38.5 °C was analyzed by gltA-specific qPCR. Positive samples were confirmed by ompB-specific qPCR. From confirmed samples, the gltA amplicons were sequenced and subjected to phylogenetic analysis. From five gltA-reactive samples, two were confirmed by ompB-specific qPCR. The gltA sequence in the sample taken from a 38-year-old female showed 100% homology with R. typhi. The other sample taken from a 1.5-year-old infant was 100% homologous to R. felis. Tick-borne rickettsiae were not identified. The overall rate of febrile patients with molecular evidence for a rickettsial infection from the Madagascan study site was 0.2% (2/1020 patients). Flea-borne rickettsiosis is a rare but neglected cause of infection in Madagascar. Accurate diagnosis may prompt adequate antimicrobial treatment.

1. Introduction

Rickettsiae are arthropod-borne, obligate intracellular Gram-negative bacteria. Phylogenetically, they are divided into four groups: the largely tick-associated spotted fever group that encompasses >25 species (e.g., Rickettsia [R.] rickettsii, R. africae), the lice-/flea-associated typhus group (e.g., R. typhi), the transitional group (e.g., R. felis, which is flea-associated) and the tick-associated ancestral group (e.g., R. bellii) [1,2].
Some, but not all rickettsiae harbored by arthropods are well-known human pathogens, and their pathogenicity differs from species to species. R. rickettsii, the agent of Rocky Mountain spotted fever (RMSF), is endemic in the Americas and is transmitted by ticks of the genera Dermacentor and Rhipicephalus. RMSF is probably the most lethal rickettsiosis, with a case-fatality rate of >35% when treatment with doxycycline is delayed [3]. In Brazil, mortality of RMSF may exceed 50% in some clusters [4]. On the African continent, entomological studies have confirmed the presence of rickettsial DNA in several different tick and flea species [5,6,7]. R. africae, which infests Amblyomma ticks to a percentage of >90%, is the causative agent of African tick-bite fever (ATBF). ATBF is often reported in travelers to Sub-Saharan Africa and usually manifests as a benign disease [8].
Fleas are typical vectors for R. typhi and R. felis. While R. typhi is mainly found in the rat flea Xenopsylla (X.) cheopis, R. felis has been detected in several flea species, including the cat flea Ctenocephalides felis, X. cheopis and the human flea Pulex irritans [6]. Molecular studies from Northern Africa have reported clinical cases of murine typhus [9,10]. Seroepidemiological reports from Sub-Saharan Africa suggest that up to 11% of the population are exposed to R. typhi, e.g., in Mali [11,12]. The mortality of murine typhus is very low (<1%) [13]. R. felis was identified as a potential cause of febrile illness in 1-15% of patients with fever from some African countries, e.g., Ghana and Senegal [14,15]. However, R. felis has also been found in blood samples of non-febrile control subjects, albeit at a significantly lower rate than in febrile patients [16,17]. Consequently, there is some controversy about the pathophysiology of R. felis infections and its role as an obligatory pathogen.
Clinically, spotted fever group rickettsioses often present with fever and an efflorescence called “eschar”, a cutaneous ulcerative lesion at the site of tick bite [18]. Typhus group rickettsioses such as murine typhus (R. typhi) and epidemic typhus (R. prowazekii) are not associated with eschar formation and are thus more difficult to diagnose. Murine typhus presents with a “classical” triad of fever, headache and rash, which is encountered in 33% of patients [19]. R. felis has been associated with similar symptoms as murine typhus [14,20].
Until recently, the importance of rickettsial infections in Madagascar has remained largely unknown. High percentages of Amblyomma variegatum (86.5%) and Amblyomma chabaudii ticks (100%) were found to be infested with Rickettsia (R.) africae [7,21]. Xenopsylla cheopis fleas, collected from small mammals in urban Malagasy areas, tested positive for R. typhi and R. felis, while Pulex irritans fleas from the same area were positive for R. felis [6]. Although it was shown that humans carry antibodies against both typhus group (TG) and spotted fever group (SFG) rickettsiae [6,21], direct molecular evidence for rickettsial infections in humans from Madagascar is so far lacking. A recent pan-Madagascan study that enrolled 682 febrile patients failed to detect rickettsial DNA by applying a novel macroarray system [22]. Here, we present the results of a real-time PCR-based screening for rickettsial DNA in EDTA blood of febrile patients from Madagascar.

2. Results

The patient population, a subset from the Typhoid Fever Surveillance in Africa Program (TSAP) study, was previously characterized in detail by Boone et al. [23]. Briefly, 1020 samples from patients living in a rather rural environment (Imerintsiatosika) or in urban slums (Isotry, central Antananarivo) and presenting with pyrexia ≥38.5 °C were selected for the present study. From 1,020 EDTA samples screened for rickettsial DNA by gltA-specific qPCR, five samples showed amplification in at least one of two replicate runs. Of those, 2/5 samples (#4133, #4196) were confirmed by repeated testing using the same target.
To identify the rickettsial species, gltA amplicons were sequenced applying Sanger sequencing. Excluding primer regions, a sequence of 116 bp was analyzed (for gltA sequences, see Table A1 and Table A2). The two positive samples differed in nine positions. Compared to published sequences in the NCBI database, the gltA amplicon of sample #4133 showed 100% homology to several reference strains of R. typhi, while sample #4196 showed 100% homology to R. felis. The phylogenetic analysis, which included other closely related Rickettsia species, confirmed this identification (Figure 1).
The Ct values of >35 from the two blood samples suggested a low concentration of bacterial target DNA (Table 1). Thus, the molecular typing and confirmation approaches were different in both cases. The amplification of a larger partial ompB sequence (amplicon size: 855-861 bp) [24] was successful only for sample #4133 (in one sequencing direction). Sanger sequencing of the amplicon (GenBank OL310470) showed 100% homology with R. typhi, thereby confirming the gltA sequence result.
A larger ompB amplicon could not be obtained from sample #4196. Instead, we utilized the intergenic spacer-typing approach by Fournier et al. to confirm the gltA sequencing result [25]. The two intergenic spacers dksA-xerC (amplicon size: 164 bp, see Table A2) and rpmE-tRNAfMet (amplicon size: 351 bp, GenBank OL310471) were successfully sequenced from sample #4196. Both showed 100% homology with R. felis. The identification of the rickettsial species in sample #4196 as R. felis was further confirmed by a R. felis-specific ompB qPCR [26] (Table 1).
Both patients with molecular confirmation of Rickettsia spp. in their blood samples were from the urban study site in Antananarivo. The R. typhi patient was a 38-year-old female from the Manarintsoa-Isotry district in central Antananarivo, while the R. felis patient was a 17-month-old infant from Antohomadinika Sud, another central area in Antananarivo. In both individuals, a fever of > 39 °C and a cough were noted, but no rash (Table 1).
These results provide a molecular confirmation of human-pathogenic rickettsiae for the first time in febrile patients from Madagascar. Only the flea-borne species R. typhi and R. felis were found; no tick-borne rickettsiae were identified. Overall, the positive rate for Rickettsia spp. DNA in febrile patients was 0.2% (2/1020 patients) in this study.

3. Discussion

The high endemicity of plague in Madagascar indicates that the Malagasy population is exceptionally exposed to flea-borne infections [27,28]. However, little is known about the regional epidemiology of flea-borne rickettsioses. Apart from a single case of an R. typhi infection in a French traveler returning from Madagascar [29], there has only been indirect serological evidence that humans may become infected [6]. Molecular data from fleas that showed infection with rickettsiae suggested that there might be a risk of transmission to humans [6]. The present study shows for the first time, based on a real-time PCR screening for rickettsial DNA in febrile patients, that human-pathogenic, flea-borne rickettsiae are transmitted to humans in Madagascar.
Overall, the detection rate of rickettsial DNA in whole blood samples was low in this study (2/1020 patients). While we cannot exclude that storage and transport conditions may have affected the stability of target DNA in our study, previous investigations showed that Rickettsia-specific PCRs from blood samples may yield false-negative results in serologically confirmed cases [30,31]. A systematic review reported a blood DNA median sensitivity of 18% (6–27%) for pan-Rickettsia PCRs (SFG: 42% [6–69%]; TG: 3% [1–18%]) [32]. Thus, we may have missed some rickettsial infections by our approach. Importantly, the high Ct values identified here should not be interpreted as a sign of low clinical relevance, since they reflect the transient nature of these pathogens in circulating blood [33]. In sum, it is likely that the actual number of rickettsial infections among febrile patients may be several-fold higher than that detected by PCR.
With 1/1020 samples (0.1%) testing positive for R. felis, the detection rate in the urban setting of the Malagasy capital is lower than previously reported from continental African countries, where frequencies from 1.5% PCR-positive samples in Ghana to 15% in rural Senegal have been found [14,15]. As in our 1-year- and 5-month-old patients, R. felis is thought to be a common cause of febrile disease in children [14]. It can be detected significantly more often in febrile compared to afebrile patients, but its identification in afebrile pediatric control groups [16,34] has questioned its role as an obligatory pathogen. Another conundrum is the significance of Plasmodium falciparum/R. felis co-infections in regions with high malaria endemicity [14,15]. Notably, in our Malagasy study population, malaria was found only in a very low percentage of febrile patients (0–2%) [35].
R. typhi causes murine typhus, an infection with low mortality, and is transmitted worldwide, mainly in suburban areas [36]. Epidemiological studies indicate its transmission to humans in African countries [11,12,37], and direct molecular evidence from fever studies has primarily been provided from the northern African countries Algeria and Tunisia [38].
Infections with R. typhi and R. felis are associated with similar clinical presentations. Distinguishing them is possible by molecular diagnostics [26,39], but difficult by serology. In both infections, typical symptoms include fever and cough, as in our patients, and the absence of rashes often complicates the clinical diagnosis [14,36].
The present study found no evidence for spotted fever group rickettsiae in febrile patients. While according to seroprevalence studies, transmission of SFG rickettsiosis occurs in Madagascar [21], these infections are likely to only rarely present as bloodstream infections and may therefore be difficult to diagnose by applying molecular diagnostic approaches with EDTA blood samples.
While it was not determined in the present study whether fleas from the specific patients’ areas of residence carry R. felis or R. typhi, a similar study was performed in urban areas of the Tsiroanomandidy district, about 200 km west of Antananarivo. Here, 26/117 (24%) Xenopsylla cheopis fleas collected from small mammals tested positive for R. typhi, and 2/117 (2%) were positive for R. felis. In 8/26 (31%) Pulex irritans fleas, R. felis was detected. No co-infections with both species in the same flea were reported. It is highly likely that rodents in Antananarivo carry fleas with a similarly high proportion of Rickettsia infection, thus posing a risk for transmission of R. felis and R. typhi to humans.
In future research, a prospective study design may be appropriate when investigating rickettsial infections in Madagascar. A comprehensive approach that takes into account clinical clues for rickettsial infections (e.g., eschars or rashes), serological assays (e.g., IgM/IgG against several rickettsial antigens) and immediate sample processing for PCR (e.g., from buffy coat) may provide a more complete picture of spotted and typhus fever rickettsioses.

4. Materials and Methods

4.1. Human Blood Sample Collection

EDTA blood samples were collected within the framework of the Typhoid Fever Surveillance in Africa Program (TSAP) [40]. A detailed description of how samples were collected is provided elsewhere [23]. In brief, 4500 EDTA blood specimens were collected from febrile patients in Madagascar between 2011 and 2013 continuously throughout the year. Of those, a total of 1,020 samples from individuals presenting with a body temperature ≥38.5°C were screened for the presence of rickettsial DNA. Samples were previously tested for the presence of Burkholderia pseudomallei, Coxiella burnetii, Brucella spp., Leptospira spp. and Borrelia spp. DNA, with a detection rate of 1.5% for Brucella spp. and otherwise negative results [23,41].

4.2. DNA Extraction and Real-Time PCR

Total DNA was extracted from 1 ml of human EDTA blood samples using the Flexigene DNA Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol. Rickettsial DNA was screened for by gltA-specific real-time PCR, using a modification of a previously published protocol based on the primers RKND03_F (5′-GTGAATGAAAGATTACACTATTTAT-3′) and RKND03_R (5′-GTATCTTAGCAATCATTCTAATAGC-3′), which yields an amplicon of 166 bp (base pairs) [42,43]. In a total of 10 µL, reactions contained 1x reaction buffer (Invitrogen, Darmstadt, Germany), 2.5 mM magnesium chloride, 0.2 mM deoxynucleotides (ABI), 5 nM bovine serum albumin, 0.5 µM of each oligonucleotide (Tibmolbiol, Berlin, Germany), SYBR Green, 0.25 U PlatinumTaq DNA polymerase and 2 µL of sample. Reactions were run in duplicate on a LightCycler 480 II instrument (Roche, Mannheim, Germany). The following cycling conditions were used: activation 95 °C, 15 min; 45 cycles: denaturation 94 °C, 15 s; annealing 60 °C, 30 s; elongation 72 °C, 30 s.
When a typical amplification curve was found, the result was confirmed in two independent, ompB-specific real-time PCRs for R. typhi and R. felis that allow detection of each species by a molecular beacon [26]. Samples showing amplification in both gltA and ompB assays were interpreted as positive for Rickettsia spp.

4.3. Conventional PCR, Sequencing and Phylogenetic Analysis

For further typing, the intergenic spacer dksA-xerC was amplified using the primers dksA-xerC_F (5′-TCCCATAGGTAATTTAGGTGTTTC-3′) and dksA-xerC_R (5′-TACTACCGCATATCCAATTAAAAA-3′ [25]). The spacer rpmE-tRNAfMet was amplified using the primers rpmE-tRNArMet_F (5′-TTCCGGAAATGTAGTAAATCAATC-3′) and tRNArMet_F (5′-TCAGGTTATGAGCCTGACGA-3′ [25]). For sequencing a part of the ompB gene, the primers 120-M59 (5′-CCGCAGGGTTGGTAACTGC-3′) and 120-807 (5′-CCTTTTAGATTACCGCCTAA-3′ [24]) were used.
All conventional PCR reactions were run on a GeneAmp PCR System 2700 thermocycler (ABI) in a total volume of 50 µL, in the presence of 1x reaction buffer (Invitrogen, Darmstadt, Germany), 1.5 mM magnesium chloride, 0.2 mM deoxynucleotides (ABI), 0.2 µM of each oligonucleotide (Tibmolbiol, Berlin, Germany), 2 U PlatinumTaq DNA polymerase and 2 µL of sample. Upon denaturation at 95 °C for 3 min, 40 PCR cycles of 30 s at 95 °C, 30 s at 54 °C (spacers) or 58 °C (ompB) and 1 min at 72 °C were run, followed by a 5 min extension at 72 °C.
The gltA, ompB, dksA-xerC and rpmE-tRNAfMet amplicons were visualized by agarose gel electrophoresis and subjected to bidirectional conventional Sanger sequencing (Seqlab, Göttingen, Germany). Sequences <200 bp are provided in Appendix A (Table A1 and Table A2); sequences > 200 bp were deposited in the NCBI GenBank under the accession numbers OL310470 (ompB) and OL310471 (rpmE-tRNAfMet).
Upon Clustal W multiple alignment (BioEdit Sequence Alignment Editor, version 7.0.5.3), gltA sequences were analyzed phylogenetically using the MEGA7 software (Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets; Kumar, Stecher, and Tamura 2015).

5. Conclusions

Taken together, the present study provides direct molecular evidence for both R. typhi and R. felis in blood samples of febrile patients from Madagascar. We suggest that flea-borne rickettsial infections are a relevant differential diagnosis of fevers of unknown etiology in a small number of patients and should be considered when deciding on empirical antimicrobial therapy by healthcare professionals in Madagascar.

Author Contributions

Conceptualization, C.K., S.P., H.F., J.M. and F.M.; methodology, C.K.; resources, V.v.K., J.N.H., N.G.S., G.D.P., J.I., L.M.C.E., R.M.H., J.P.R., T.R. and J.M.; writing—original draft preparation, C.K.; writing—review and editing, H.F. and S.P.; visualization, C.K; project administration, R.R., J.M., D.D. and F.M.; funding acquisition, F.M. All authors have read and agreed to the published version of the manuscript.

Funding

The TSAP project was based on research funded by the Bill & Melinda Gates Foundation (OPPGH5231) [40]. In addition, this research received no external funding.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki. The study protocol was approved by the Malagasy Ethical Committee (no. 088 MSANP/CE from 2014/09/25, amendment to approval 045/MSANP/CE from 2011/09/11) and the IVI Institutional Review Board (no. IVI IRB #2011-001).

Informed Consent Statement

Written, informed consent was obtained from all patients involved in the study.

Data Availability Statement

All relevant data are provided in the manuscript. The ompB sequence have been deposited at NCBI GenBank under accession number OL310470, the rpmE-tRNAfMet sequence is available under accession number OL310471.

Acknowledgments

We would like to thank Claudia Sander-Jülch, Tasja Lempertz and Shoaib Azizi for excellent technical assistance.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Appendix A. Sequences Obtained in the Study

Table
Table A1. Supplementary sequence information, sample #4133.
Table A1. Supplementary sequence information, sample #4133.
#4133, gltA (116 bp)
TTCAAACCTTTTGTAGTTCTTCTCATCCTATGGCTATTATGCTTGCAGCTGTTGGTTCTCTTTCAGCATTTTATCCTGATTTATTGAATTTTAATGAAACAGACTATGAACTTACC
#4133, ompB (759 bp): GenBank accession number OL310470
Table
Table A2. Supplementary sequence information, sample #4196.
Table A2. Supplementary sequence information, sample #4196.
#4196, gltA (116 bp)
TTCAAACATTTTGTAGCTCTTCTCATCCTATGGCTATTATGCTTGCGGCCGTTGGTTCTCTTTCGGCATTTTATCCTGATTTACTGAATTTTAAAGAAGCAGACTACGAACTTACC
#4196, dksA-xerC (117 bp)
TAGCATATTAATATCTCAATATTAGCTTTAGTATATTATGTTTATAAGGTTTTTAAAATAAAATAATATATAACTTAAAACTAACGCAAGAAGATTATGAATATTAATATATTTTAT
#4196, rpmE-tRNAfMet (319 bp): GenBank Accession number OL310471

References

  1. Thu, M.J.; Qiu, Y.; Matsuno, K.; Kajihara, M.; Mori-Kajihara, A.; Omori, R.; Monma, N.; Chiba, K.; Seto, J.; Gokuden, M.; et al. Diversity of spotted fever group rickettsiae and their association with host ticks in Japan. Sci. Rep. 2019, 9, 1500. [Google Scholar] [CrossRef] [Green Version]
  2. Gillespie, J.J.; Williams, K.; Shukla, M.; Snyder, E.E.; Nordberg, E.K.; Ceraul, S.M.; Dharmanolía, C.; Rainey, D.; Soneja, J.; Shallom, J.M.; et al. Rickettsia phylogenomics: Unwinding the intricacies of obligate intracellular life. PLoS ONE 2008, 3, e2018. [Google Scholar] [CrossRef] [Green Version]
  3. Jay, R.; Armstrong, P. Clinical characteristics of Rocky Mountain spotted fever in the United States: A literature review. J. Vector Borne Dis. 2020, 57, 114–120. [Google Scholar] [CrossRef] [PubMed]
  4. Nogueira Angerami, R.; Nunes, E.M.; Mendes Nascimento, E.M.; Ribas Freitas, A.; Kemp, B.; Feltrin, A.F.C.; Pacola, M.R.; Perecin, G.E.C.; Sinkoc, V.; Ribeiro Resende, M.; et al. Clusters of Brazilian spotted fever in São Paulo State, southeastern Brazil. A review of official reports and the scientific literature. Clin. Microbiol. Infect. 2009, 15, 202–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Vanegas, A.; Keller, C.; Krüger, A.; Manchang, T.K.; Hagen, R.M.; Frickmann, H.; Veit, A.; Achukwi, M.D.; Krücken, J.; Poppert, S. Molecular detection of spotted fever group rickettsiae in ticks from Cameroon. Ticks Tick. Borne. Dis. 2018, 9, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
  6. Rakotonanahary, R.J.L.; Harrison, A.; Maina, A.N.; Jiang, J.; Richards, A.L.; Rajerison, M.; Telfer, S. Molecular and serological evidence of flea-associated typhus group and spotted fever group rickettsial infections in Madagascar. Parasit. Vectors 2017, 10, 125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Ehlers, J.; Ganzhorn, J.U.; Silaghi, C.; Krüger, A.; Pothmann, D.; Yedidya Ratovonamana, R.; Veit, A.; Keller, C.; Poppert, S. Tick (Amblyomma chabaudi) infestation of endemic tortoises in southwest Madagascar and investigation of tick-borne pathogens. Ticks Tick. Borne. Dis. 2016, 7, 378–383. [Google Scholar] [CrossRef]
  8. Roch, N.; Epaulard, O.; Pelloux, I.; Pavese, P.; Brion, J.-P.; Raoult, D.; Maurin, M. African tick bite fever in elderly patients: 8 cases in French tourists returning from South Africa. Clin. Infect. Dis. 2008, 47, e28–e35. [Google Scholar] [CrossRef] [Green Version]
  9. Znazen, A.; Rolain, J.M.; Hammami, N.; Hammami, A.; Ben Jemaa, M.; Raoult, D. Rickettsia felis infection, Tunisia. Emerg. Infect. Dis. 2006, 12, 138–140. [Google Scholar] [CrossRef]
  10. Khrouf, F.; Sellami, H.; Elleuch, E.; Hattab, Z.; Ammari, L.; Khalfaoui, M.; Souissi, J.; Harrabi, H.; M’ghirbi, Y.; Tiouiri, H.; et al. Molecular diagnosis of Rickettsia infection in patients from Tunisia. Ticks Tick. Borne. Dis. 2016, 7, 653–656. [Google Scholar] [CrossRef] [PubMed]
  11. Dupont, H.T.; Brouqui, P.; Faugere, B.; Raoult, D. Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin. Infect. Dis. 1995, 21, 1126–1133. [Google Scholar] [CrossRef] [PubMed]
  12. Niang, M.; Parola, P.; Tissot-Dupont, H.; Baidi, L.; Brouqui, P.; Raoult, D. Prevalence of antibodies to Rickettsia conorii, Rickettsia africae, Rickettsia typhi and Coxiella burnetii in Mauritania. Eur. J. Epidemiol. 1998, 14, 817–818. [Google Scholar] [CrossRef]
  13. Doppler, J.F.; Newton, P.N. A systematic review of the untreated mortality of murine typhus. PLoS Negl. Trop. Dis. 2020, 14, e0008641. [Google Scholar] [CrossRef]
  14. Sothmann, P.; Keller, C.; Krumkamp, R.; Kreuels, B.; Aldrich, C.; Sarpong, N.; Steierberg, S.; Winter, D.; Boahen, K.G.; Owusu-Dabo, E.; et al. Rickettsia felis Infection in Febrile Children, Ghana. Am. J. Trop. Med. Hyg. 2017, 96, 16–0754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Mediannikov, O.; Socolovschi, C.; Edouard, S.; Fenollar, F.; Mouffok, N.; Bassene, H.; Diatta, G.; Tall, A.; Niangaly, H.; Doumbo, O.; et al. Common epidemiology of Rickettsia felis infection and malaria, Africa. Emerg. Infect. Dis. 2013, 19, 1775–1783. [Google Scholar] [CrossRef]
  16. Mourembou, G.; Lekana-Douki, J.B.; Mediannikov, O.; Nzondo, S.M.; Kouna, L.C.; Essone, J.C.B.B.; Fenollar, F.; Raoult, D. Possible role of Rickettsia felis in acute febrile illness among children in Gabon. Emerg. Infect. Dis. 2015, 21, 1808–1815. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Maina, A.N.; Knobel, D.L.; Jiang, J.; Halliday, J.; Feikin, D.R.; Cleaveland, S.; Ng’ang’a, Z.; Junghae, M.; Breiman, R.F.; Richards, A.L.; et al. Rickettsia felis infection in febrile patients, western Kenya, 2007–2010. Emerg. Infect. Dis. 2012, 18, 328–331. [Google Scholar] [CrossRef]
  18. Cherry, C.C.; Denison, A.M.; Kato, C.Y.; Thornton, K.; Paddock, C.D. Diagnosis of spotted fever group rickettsioses in U.S. travelers returning from Africa, 2007–2016. Am. J. Trop. Med. Hyg. 2018, 99, 136–142. [Google Scholar] [CrossRef] [Green Version]
  19. Tsioutis, C.; Zafeiri, M.; Avramopoulos, A.; Prousali, E.; Miligkos, M.; Karageorgos, S.A. Clinical and laboratory characteristics, epidemiology, and outcomes of murine typhus: A systematic review. Acta Trop. 2017, 166, 16–24. [Google Scholar] [CrossRef]
  20. Parola, P. Rickettsia felis: From a rare disease in the USA to a common cause of fever in sub-Saharan Africa. Clin. Microbiol. Infect. 2011, 17, 996–1000. [Google Scholar] [CrossRef] [Green Version]
  21. Keller, C.; Krüger, A.; Schwarz, N.G.; Rakotozandrindrainy, R.; Rakotondrainiarivelo, J.P.; Razafindrabe, T.; Derschum, H.; Silaghi, C.; Pothmann, D.; Veit, A.; et al. High detection rate of Rickettsia africae in Amblyomma variegatum but low prevalence of anti-rickettsial antibodies in healthy pregnant women in Madagascar. Ticks Tick. Borne. Dis. 2016, 7, 60–65. [Google Scholar] [CrossRef]
  22. Guillebaud, J.; Bernardson, B.; Randriambolamanantsoa, T.H.; Randrianasolo, L.; Randriamampionona, J.L.; Marino, C.A.; Rasolofo, V.; Randrianarivelojosia, M.; Vigan-Womas, I.; Stivaktas, V.; et al. Study on causes of fever in primary healthcare center uncovers pathogens of public health concern in Madagascar. PLoS Negl. Trop. Dis. 2018, 12, e0006642. [Google Scholar] [CrossRef] [PubMed]
  23. Boone, I.; Henning, K.; Hilbert, A.; Neubauer, H.; von Kalckreuth, V.; Dekker, D.M.; Schwarz, N.G.; Pak, G.D.; Krüger, A.; Hagen, R.M.; et al. Are brucellosis, Q fever and melioidosis potential causes of febrile illness in Madagascar? Acta Trop. 2017, 172, 255–262. [Google Scholar] [CrossRef] [PubMed]
  24. Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmp (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [Green Version]
  25. Fournier, P.; Zhu, Y.; Ogata, H.; Raoult, D. Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii Strains. J. Clin. Microbiol. 2004, 42, 5757–5766. [Google Scholar] [CrossRef] [Green Version]
  26. Henry, K.M.; Jiang, J.; Rozmajzl, P.J.; Azad, A.F.; Macaluso, K.R.; Richards, A.L. Development of quantitative real-time PCR assays to detect Rickettsia typhi and Rickettsia felis, the causative agents of murine typhus and flea-borne spotted fever. Mol. Cell. Probes 2007, 21, 17–23. [Google Scholar] [CrossRef]
  27. Andrianaivoarimanana, V.; Kreppel, K.; Elissa, N.; Duplantier, J.M.; Carniel, E.; Rajerison, M.; Jambou, R. Understanding the persistence of Plague Foci in Madagascar. PLoS Negl. Trop. Dis. 2013, 7, 1853–1857. [Google Scholar] [CrossRef] [Green Version]
  28. Goodman, S.M.; Andriniaina, H.R.R.; Soarimalala, V.; Beaucournu, J.C. The fleas of endemic and introduced small mammals in central highland forests of Madagascar: Faunistics, species diversity, and absence of host specificity. J. Med. Entomol. 2015, 52, 1135–1143. [Google Scholar] [CrossRef]
  29. Walter, G.; Botelho-Nevers, E.; Socolovschi, C.; Raoult, D.; Parola, P. Murine typhus in returned travelers: A report of thirty-two cases. Am. J. Trop. Med. Hyg. 2012, 86, 1049–1053. [Google Scholar] [CrossRef] [Green Version]
  30. Znazen, A.; Sellami, H.; Elleuch, E.; Hattab, Z.; Ben Sassi, L.; Khrouf, F.; Dammak, H.; Letaief, A.; Ben Jemaa, M.; Hammami, A. Comparison of two quantitative real time PCR assays for Rickettsia detection in patients from Tunisia. PLoS Negl. Trop. Dis. 2015, 9, e0003487. [Google Scholar] [CrossRef] [Green Version]
  31. Rauch, J.; Eisermann, P.; Noack, B.; Mehlhoop, U.; Muntau, B.; Schäfer, J.; Tappe, D. Typhus group Rickettsiosis, Germany, 2010–2017—Volume 24, Number 7–July 2018—Emerging Infectious Diseases journal—CDC. Emerg. Infect. Dis. 2018, 24, 1213–1220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Paris, D.H.; Dumler, J.S. State of the art of diagnosis of rickettsial diseases: The use of blood specimens for diagnosis of scrub typhus, spotted fever group rickettsiosis, and murine typhus. Curr. Opin. Infect. Dis. 2016, 29, 433. [Google Scholar] [CrossRef] [Green Version]
  33. Robinson, M.T.; Satjanadumrong, J.; Hughes, T.; Stenos, J.; Blacksell, S.D. Diagnosis of spotted fever group Rickettsia infections: The Asian perspective. Epidemiol. Infect. 2019, 147, e286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Mourembou, G.; Fenollar, F.; Socolovschi, C.; Lemamy, G.J.; Nzoughe, H.; Kouna, L.C.; Toure-Ndouo, F.; Million, M.; Mbiguino, A.N.; Lekana-Douki, J.B.; et al. Molecular detection of fastidious and common Bacteria as well as plasmodium spp. in Febrile and Afebrile children in Franceville, Gabon. Am. J. Trop. Med. Hyg. 2015, 92, 926–932. [Google Scholar] [CrossRef] [Green Version]
  35. Park, S.E.; Pak, G.D.; Aaby, P.; Adu-Sarkodie, Y.; Ali, M.; Aseffa, A.; Biggs, H.M.; Bjerregaard-Andersen, M.; Breiman, R.F.; Crump, J.A.; et al. The relationship between invasive nontyphoidal salmonella disease, other bacterial bloodstream infections, and Malaria in sub-Saharan Africa. Clin. Infect. Dis. 2016, 62, s23–s31. [Google Scholar] [CrossRef] [Green Version]
  36. Civen, R.; Ngo, V. Murine Typhus: An unrecognized suburban Vectorborne disease. Clin. Infect. Dis. 2008, 46, 913–918. [Google Scholar] [CrossRef] [Green Version]
  37. Okabayashi, T.; Hasebe, F.; Samui, K.L.; Mweene, A.S.; Pandey, S.G.; Yanase, T.; Muramatsu, Y.; Ueno, H.; Morita, C. Short report: Prevalence of antibodies against spotted fever, murine typhus, and Q fever rickettsiae in humans living in Zambia. Am. J. Trop. Med. Hyg. 1999, 61, 70–72. [Google Scholar] [CrossRef] [PubMed]
  38. Angelakis, E.; Botelho, E.; Socolovschi, C.; Sobas, C.R.; Piketty, C.; Parola, P.; Raoult, D. Murine typhus as a cause of fever in travelers from tunisia and Mediterranean areas. J. Travel Med. 2010, 17, 310–315. [Google Scholar] [CrossRef]
  39. Azad, A.F.; Radulovic, S.; Higgins, J.A.; Noden, B.H.; Troyer, J.M. Flea-borne Rickettsioses: Ecologic Considerations. Emerg. Infect. Dis. 1997, 3, 319–327. [Google Scholar] [CrossRef] [Green Version]
  40. Von Kalckreuth, V.; Konings, F.; Aaby, P.; Adu-Sarkodie, Y.; Ali, M.; Aseffa, A.; Baker, S.; Breiman, R.F.; Bjerregaard-Andersen, M.; Clemens, J.D.; et al. The typhoid fever surveillance in Africa program (TSAP): Clinical, diagnostic, and epidemiological methodologies. Clin. Infect. Dis. 2016, 62, s9–s16. [Google Scholar] [CrossRef] [Green Version]
  41. Hagen, R.M.; Frickmann, H.; Ehlers, J.; Krüger, A.; Margos, G.; Hizo-Teufel, C.; Fingerle, V.; Rakotozandrindrainy, R.; von Kalckreuth, V.; Im, J.; et al. Presence of Borrelia spp. DNA in ticks, but absence of Borrelia spp. and of Leptospira spp. DNA in blood of fever patients in Madagascar. Acta Trop. 2018, 177, 127–134. [Google Scholar] [CrossRef]
  42. Mediannikov, O.; Diatta, G.; Fenollar, F.; Sokhna, C.; Trape, J.F.; Raoult, D. Tick-borne rickettsioses, neglected emerging diseases in rural Senegal. PLoS Negl. Trop. Dis. 2010, 4, e821. [Google Scholar] [CrossRef] [Green Version]
  43. Mediannikov, O.; Fenollar, F. Looking in ticks for human bacterial pathogens. Microb. Pathog. 2014, 77, 142–148. [Google Scholar] [CrossRef]
Pathogens 10 01482 g001 550
Figure 1. An amplicon of 116 bp from the rickettsial citrate synthase gene (gltA) was aligned with gltA sequences from rickettsial reference strains retrieved from the NCBI database, using Clustal W (BioEdit 7.0.5.3). A phylogenetic analysis was performed in MEGA7 using the maximum likelihood method (Tamura-Nei model). The percentage of trees in which the associated taxa clustered together is shown next to the branches.
Figure 1. An amplicon of 116 bp from the rickettsial citrate synthase gene (gltA) was aligned with gltA sequences from rickettsial reference strains retrieved from the NCBI database, using Clustal W (BioEdit 7.0.5.3). A phylogenetic analysis was performed in MEGA7 using the maximum likelihood method (Tamura-Nei model). The percentage of trees in which the associated taxa clustered together is shown next to the branches.
Pathogens 10 01482 g001
Table
Table 1. Detection of Rickettsia DNA: sample and patient characteristics.
Table 1. Detection of Rickettsia DNA: sample and patient characteristics.
IDAgeSexResidenceBody Temp.RashCoughgltA
Ct		gltA
Seq.		R. felis ompB
Ct		Rick.
ompB
seq.
413338 y.fManarintsoa Isotry
(Antananarivo)		40.0-+37.3R. typhi (100%)neg.R. typhi (100%)
41961 y.
5 m		mAntohomadinika Sud (Antananarivo)39.4-+35.2R. felis (100%)39.2NP 1
1 NP = not possible. Ct = cycle threshold, y = year, m = month, ID = identification number, temp. = temperature, R. = Rickettsia, Rick. = Rickettsia spp.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Keller, C.; Rakotozandrindrainy, R.; von Kalckreuth, V.; Heriniaina, J.N.; Schwarz, N.G.; Pak, G.D.; Im, J.; Espinoza, L.M.C.; Hagen, R.M.; Frickmann, H.; et al. Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar. Pathogens 2021, 10, 1482. https://doi.org/10.3390/pathogens10111482

AMA Style

Keller C, Rakotozandrindrainy R, von Kalckreuth V, Heriniaina JN, Schwarz NG, Pak GD, Im J, Espinoza LMC, Hagen RM, Frickmann H, et al. Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar. Pathogens. 2021; 10(11):1482. https://doi.org/10.3390/pathogens10111482

Chicago/Turabian Style

Keller, Christian, Raphaël Rakotozandrindrainy, Vera von Kalckreuth, Jean Noël Heriniaina, Norbert Georg Schwarz, Gi Deok Pak, Justin Im, Ligia Maria Cruz Espinoza, Ralf Matthias Hagen, Hagen Frickmann, and et al. 2021. "Molecular Evidence for Flea-Borne Rickettsiosis in Febrile Patients from Madagascar" Pathogens 10, no. 11: 1482. https://doi.org/10.3390/pathogens10111482

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop