The Role of a New Compound Micronutrient Multifunctional Fertilizer against Verticillium dahliae on Cotton
Abstract
:1. Introduction
2. Results
2.1. Inhibitory Effect of CMF on Mycelial Growth of V. dahliae
2.2. Inhibition of CMF on Microsclerotia Germination of V. dahliae
2.3. Influence of CMF on Sporulation of V. dahliae
2.4. Suppression of Cotton Verticillium Wilt in the Greenhouse
2.5. Effect of CMF Treatment on Cotton Seedling Development
2.6. Expression Analysis of Resistance-Related Genes
2.7. Suppression of Cotton Verticillium Wilt in the Field
3. Discussion
4. Materials and Methods
4.1. Cotton Cultivar, Fungal Strain and Culture Conditions
4.2. Preparation of V. dahliae Fermentation Broth
4.3. Assessing the Effect of CMF on the Growth Rate of V. dahliae
4.4. Effect of CMF on the Microsclerotia Germination of V. dahliae
4.5. Assessing the Effect of CMF on the Sporulation of V. dahliae
4.6. Suppressive Effect of CMF on V. dahliae in the Greenhouse
4.7. qPCR Quantification of Fungal Biomass in Plant Tissue
4.8. Expression Analysis of Resistance-Related Genes by qRT-PCR
4.9. Control Efficacy of CMF Against Cotton Verticillium Wilt and Increasing Yield in the Field
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Klosterman, S.J.; Atallah, Z.K.; Vallad, G.E.; Subbarao, K.V. Diversity, pathogenicity, and management of verticillium species. Annu. Rev. Phytopathol. 2009, 47, 39–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.-Y.; Liu, C.; Gui, Y.-J.; Si, K.-W.; Zhang, D.-D.; Wang, J.; Short, D.P.G.; Huang, J.-Q.; Li, N.I.; Yong, L.; et al. Comparative genomics reveals cotton-specific virulence factors in flexible genomic regions in Verticillium dahliae and evidence of hosrizontal gene transfer from Fusarium. New Phytol. 2018, 217, 756–770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Yu, X.; Zhang, C.; Zhang, Q.; Sun, Y.; Zhu, H.; Canming, T. Pectin lyase enhances cotton resistance to Verticillium wilt by inducing cell apoptosis of Verticillium dahliae. J. Hazard. Mater. 2021, 404, 124029. [Google Scholar] [CrossRef] [PubMed]
- Campbell, B.T.; Saha, S.; Du, X.; Jia, Y.; Constable, G.; Dillon, S.; Abdurakhmonov, I.Y.; Abdukarimov, A.; Rizaeva, S.M.; Abdullaev, A.; et al. Status of the global cotton germplasm resources. Crop Sci. 2010, 50, 1161–1179. [Google Scholar] [CrossRef] [Green Version]
- Pegg, G.F.; Brady, B.L. “Control” in Verticillium wilts. In Verticillium Wilts; CABI: New York, NY, USA, 2002; Volume 151, pp. 109–110. [Google Scholar]
- Barbara, D.J. Verticillium Wilts. Physiol. Mol. Plant Pathol. 2003, 62, 51–52. [Google Scholar] [CrossRef]
- Gao, X.; Wheeler, T.; Li, Z.; Kenerley, C.M.; He, P.; Shan, L. Silencing GhNDR1 and GhMKK2 compromises cotton resistance to Verticillium wilt. Plant J. 2011, 66, 293–305. [Google Scholar] [CrossRef] [Green Version]
- Bhat, R.G.; Subbarao, K.V. Host range specificity in verticillium dahliae. Phytopathology 1999, 89, 1218–1225. [Google Scholar] [CrossRef] [Green Version]
- Duniway, J.M. Status of chemical alternatives to methyl bromide for pre-plant fumigation of soil. Phytopathology 2002, 92, 1337–1343. [Google Scholar] [CrossRef] [Green Version]
- Cheng, Q.; Hu, C.; Jia, W.; Cai, M.; Zhao, Y.; Tang, Y.; Yang, D.; Zhou, Y.; Sun, X.; Zhao, X. Selenium reduces the pathogenicity of Sclerotinia sclerotiorum by inhibiting sclerotial formation and germination. Ecotoxicol. Environ. Saf. 2019, 183, 109503. [Google Scholar] [CrossRef]
- Zhao, Y.-L.; Zhou, T.-T.; Guo, H.-S. Hyphopodium-specific VdNoxB/VdPls1-dependent ROS-Ca2+ signaling is required for plant infection by verticillium dahliae. PLoS Pathog. 2016, 12, e1005793. [Google Scholar] [CrossRef] [Green Version]
- Subbarao, K.V.; Kabir, Z.; Martin, F.N.; Koike, S.T. Management of soilborne diseases in strawberry using vegetable rotations. Plant Dis. 2007, 91, 964–972. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Busby, P.E.; Ridout, M.; Newcombe, G. Fungal endophytes: Modifiers of plant disease. Plant Mol. Biol. 2016, 90, 645–655. [Google Scholar] [CrossRef] [PubMed]
- Komárek, M.; Čadková, E.; Chrastný, V.; Bordas, F.; Bollinger, J.C. Contamination of vineyard soils with fungicides: A review of environmental and toxicological aspects. Environ. Int. 2010, 36, 138–151. [Google Scholar] [CrossRef] [PubMed]
- Elsherbiny, E.A.; Taher, M.A. Silicon induces resistance to postharvest rot of carrot caused by Sclerotinia sclerotiorum and the possible of defense mechanisms. Postharvest Biol. Technol. 2018, 140, 11–17. [Google Scholar] [CrossRef]
- Cabot, C.; Martos, S.; Llugany, M.; Gallego, B.; Tolrà, R.; Poschenrieder, C. A role for Zinc in plant defense against pathogens and herbivores. Front. Plant Sci. 2019, 10, 1171. [Google Scholar] [CrossRef]
- Jung, H.W.; Tschaplinski, T.J.; Wang, L.; Glazebrook, J.; Greenberg, J.T. Priming in systemic plant immunity. Science 2009, 324, 89–91. [Google Scholar] [CrossRef]
- Cai, H.; Tao, N.; Guo, C. Systematic Investigation of the Effects of Macro-elements and Iron on Soybean Plant Response to Fusarium oxysporum Infection. Plant Pathol. J. 2020, 36, 398–405. [Google Scholar]
- Dordas, C. Role of nutrients in controlling plant diseases in sustainable agriculture. A review. Agron. Sustain. Dev. 2008, 28, 33–46. [Google Scholar] [CrossRef] [Green Version]
- Debona, D.; Rodrigues, F.A.; Datnoff, L.E. Silicon’s role in abiotic and biotic plant stresses. Annu. Rev. Phytopathol. 2017, 55, 85–107. [Google Scholar] [CrossRef] [Green Version]
- Fones, H.; Preston, G.M. The impact of transition metals on bacterial plant disease. FEMS Microbiol. Rev. 2013, 37, 495–519. [Google Scholar] [CrossRef] [Green Version]
- Rossbauer, G.; Zwack, F. New ways in the fight against leaf curls of hops. Zinc deficiency: Effect on the growth of hops, reasons and possibilities of control. Hopfen Rundschau 1987, 37, 47–50. (In German) [Google Scholar]
- Bhargava, A.K.; Singh, R.D. Effect of nitrogenous fertilizers and trace elements on the severity of Alternaria blight of bottle gourd. Work. Pap. 1992, 54, 122–123. [Google Scholar]
- Fernando, D.R.; Baker, A.J.M.; Woodrow, I.E. Physiological responses in Macadamia integrifolia on exposure to manganese treatment. Aust. J. Bot. 2009, 57, 406–413. [Google Scholar] [CrossRef]
- Yao, Y.A.; Wang, J.; Ma, X.; Lutts, S.; Sun, C.; Ma, J.; Yang, Y.; Achal, V.; Xu, G. Proteomic analysis of MN-induced resistance to powdery mildew in grapevine. J. Exp. Bot. 2012, 63, 5155–5170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sindha, G.S. Effect of macro and micro nutrients on the development of powdery mildew of pea. Indian J. Mycol. Plant Pathol. 1989, 19, 219–221. [Google Scholar]
- Souza, G.A.; Hart, J.J.; Carvalho, J.G.; Rutzke, M.A.; Albrecht, J.C.; Guilherme, L.R.G.; Kochian, L.V.; Li, L. Genotypic variation of zinc and selenium concentration in grains of Brazilian wheat lines. Plant Sci. 2014, 224, 27–35. [Google Scholar] [CrossRef]
- Shi, Y.Q.; Ma, Y.H.; Liu, A.Z.; Feng, Z.L.; Feng, H.J.; Zhao, L.H.; Wei, F.; Zhu, H.Q. Preliminary report on the control effect of spraying and drip irrigation with Mianweike to verticillium wilt in cotton field of Xinjiang. China Cotton 2020, 47, 19–21. [Google Scholar]
- Rahman, A.; Wallis, C.M.; Uddin, W. Silicon-Induced Systemic Defense Responses in Perennial Ryegrass Against Infection by Magnaporthe oryzae. Phytopathology 2015, 105, 748–757. [Google Scholar] [CrossRef] [Green Version]
- Yaganza, E.S.; Tweddell, R.J.; Arul, J. Postharvest application of organic and inorganic salts to control potato (Solanum tuberosuml.) Storage soft rot: Plant tissue–salt physicochemical interactions. J. Agric. Food Chem. 2014, 62, 9223–9231. [Google Scholar] [CrossRef]
- Dabash, T.S.; El, S.A.I.; Ibrahim, N.A.; Radwan, I.A.; Ali, A.A. Relation between fertilizers and white rot disease of onion with reference to the rhizosphere [Egypt]. Agric. Res. Rev. 1985, 63, 99–110. [Google Scholar]
- Huber, D.M.; Haneklaus, S. Managing nutrition to control plant disease. Landbauforschung Volkenrode 2007, 57, 313. [Google Scholar]
- Fradin, E.F.; Thomma, B.P.H.J. Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol. Plant Pathol. 2006, 7, 71–86. [Google Scholar] [CrossRef] [PubMed]
- Debode, J.; Maeyer, K.D.; Perneel, M.; Pannecoucque, J.; Hfte, M. Biosurfactants are involved in the biological control of verticillium microsclerotia by pseudomonas spp. J. Appl. Microbiol. 2010, 103, 1184–1196. [Google Scholar] [CrossRef] [PubMed]
- Isaac, I.; MacGarvie, Q. Dormancy and germination of resting structures of Verticillium spp. Trans. Br. Mycol. Soc. 1966, 49, 669-IN16. [Google Scholar] [CrossRef]
- Luo, X.; Xie, C.; Dong, J.; Yang, X.; Sui, A. Interactions between Verticillium dahliae and its host: Vegetative growth, pathogenicity, plant immunity. Appl. Microbiol. Biotechnol. 2014, 98, 6921–6932. [Google Scholar] [CrossRef]
- Zhang, Y.-L.; Li, Z.-F.; Feng, Z.-L.; Feng, H.-J.; Shi, Y.-Q.; Zhao, L.-H.; Zhang, X.-L.; Zhu, H.-Q. Functional analysis of the pathogenicity-related gene vdpr1 in the vascular wilt fungus verticillium dahliae. PLoS ONE 2016, 11, e0166000. [Google Scholar] [CrossRef] [Green Version]
- Zhou, T.-T.; Zhao, Y.-L.; Guo, H.-S. Secretory proteins are delivered to the septin-organized penetration interface during root infection by Verticillium dahliae. PLoS Pathog. 2017, 13, e1006275. [Google Scholar] [CrossRef] [Green Version]
- Thao, H.T.B.; Yamakawa, T.; Shibata, K.; Sarr, P.S.; Myint, A.K. Growth response of komatsuna (Brassica rapa var peruvirids) to root and foliar applications of phosphite. Plant Soil. 2008, 308, 1–10. [Google Scholar] [CrossRef]
- Gadjev, I.; Vanderauwera, S.; Gechev, T.S.; Laloi, C.; Minkov, I.N.; Shulaev, V.; Apel, K.; Inzé, D.; Mittler, R.; Van Breusegem, F. Transcriptomic footprints disclose specificity of reactive oxygen species signaling in arabidopsis. Plant Physiol. 2006, 141, 436–445. [Google Scholar] [CrossRef] [Green Version]
- Noman, A.; Ali, Q.; Maqsood, J.; Iqbal, N.; Javed, M.T.; Rasool, N.; Naseem, J. Deciphering physio-biochemical, yield, and nutritional quality attributes of water-stressed radish (Raphanus sativus L.) plants grown from Zn-Lys primed seeds. Chemosphere 2018, 195, 175–189. [Google Scholar] [CrossRef]
- Wei, F.; Zhang, Y.; Shi, Y.; Feng, H.; Zhao, L.; Feng, Z.; Zhu, H. Evaluation of the biocontrol potential of endophytic fungus fusarium solani CEF559 against verticillium dahliae in cotton plant. BioMed Res. Int. 2019, 2019, 3187943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, L.; Zhu, L.; Tu, L.; Liu, L.; Yuan, D.; Jin, L.; Long, L.; Zhang, X. Lignin metabolism has a central role in the resistance of cotton to the wilt fungus Verticillium dahliae as revealed by RNA-Seq-dependent transcriptional analysis and histochemistry. J. Exp. Bot. 2011, 62, 5607–5621. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, J.; Gong, D.; Zhu, S.; Zhang, L.; Zhang, L. Expression of PPO and POD genes and contents of polyphenolic compounds in harvested mango fruits in relation to Benzothiadiazole-induced defense against anthracnose. Sci. Hortic. 2011, 130, 85–89. [Google Scholar] [CrossRef]
- Reuveni, M.; Agapov, V.; Reuveni, R. Controlling powdery mildew caused by Sphaerotheca fuliginea in cucumber by foliar sprays of phosphate and potassium salts. Crop Prot. 1996, 15, 49–53. [Google Scholar] [CrossRef]
- Shaban, M.; Miao, Y.; Ullah, A.; Khan, A.Q.; Menghwar, H.; Khan, A.H.; Ahmed, M.M.; Tabassum, M.A.; Zhu, L. Physiological and molecular mechanism of defense in cotton against Verticillium dahliae. Plant Physiol. Biochem. 2018, 125, 193–204. [Google Scholar] [CrossRef]
- Noman, A.; Liu, Z.; Aqeel, M.; Zainab, M.; Khan, M.I.; Hussain, A.; Ashraf, M.F.; Li, X.; Weng, Y.; He, S. Basic leucine zipper domain transcription factors: The vanguards in plant immunity. Biotechnol. Lett. 2017, 39, 1779–1791. [Google Scholar] [CrossRef]
- Shi, F.M.; Yao, L.L.; Pei, B.L.; Zhou, Q.; Li, X.L.; Li, Y.; Li, Y.Z. Cortical microtubule as a sensor and target of nitric oxide signal during the defence responses to Verticillium dahliae toxins in Arabidopsis. Plant Cell Environ. 2009, 32, 428–438. [Google Scholar] [CrossRef]
- Mwaba, I.; Rey, M.E.C. Nitric oxide associated protein 1 is associated with chloroplast perturbation and disease symptoms in Nicotiana benthamiana infected with South African cassava mosaic virus. Virus Res. 2017, 238, 75–83. [Google Scholar] [CrossRef]
- Wang, J.-Y.; Cai, Y.; Gou, J.-Y.; Mao, Y.-B.; Xu, Y.-H.; Jiang, W.-H.; Chen, X.-Y. VdNEP, an Elicitor from Verticillium dahliae, induces cotton plant wilting. Appl. Environ. Microbiol. 2004, 70, 4989–4995. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.-L.; Ya-Lin, Z.; Feng, Z.-L.; Feng, H.-J.; Zhao, L.-H.; Shi, Y.-Q.; Hu, X.-P.; Zhu, H. Isolation and functional analysis of the pathogenicity-related gene VdPR3 from Verticillium dahliae on cotton. Curr. Genet. 2015, 61, 555–566. [Google Scholar] [CrossRef]
- Hu, X.; Bai, Y.; Chen, T.; Hu, D.; Yang, J.; Chen, W.-H. An optimized method for in vitro production of Verticillium dahliae microsclerotia. Eur. J. Plant Pathol. 2013, 136, 225–229. [Google Scholar] [CrossRef]
- Zhu, H.; Feng, Z.-L.; Li, Z.; Shi, Y.-Q.; Zhao, L.-H.; Yang, J.-R. Characterization of two fungal isolates from cotton and evaluation of their potential for biocontrol of verticillium wilt of cotton. J. Phytopathol. 2013, 161, 70–77. [Google Scholar] [CrossRef]
- Zhang, Y.; Na, Y.; Zhao, L.; Zhu, H.; Canming, T. Transcriptome analysis reveals the defense mechanism of cotton against Verticillium dahliae in the presence of the biocontrol fungus Chaetomium globosum CEF-082. BMC Plant Biol. 2020, 20, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tzima, A.K.; Paplomatas, E.J.; Rauyaree, P.; Ospina-Giraldo, M.D.; Kang, S. VdSNF1, the sucrose nonfermenting protein kinase gene of verticillium dahliae, is required for virulence and expression of genes involved in cell-wall degradation. Mol. Plant Microb. Interact. 2011, 24, 129–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Feng, Z.; Zhao, L.; Liu, S.; Wei, F.; Shi, Y.; Feng, H.; Zhu, H. Succinate dehydrogenase SDH1–1 positively regulates cotton resistance to Verticillium dahliae through a salicylic acid pathway. J. Cotton Res. 2020, 3, 1–12. [Google Scholar] [CrossRef]
CMF Concentration (g/L) | Colony Diameter (mm) | Growth Inhibition Rate (%) |
---|---|---|
0 | 27.20 ± 1.69 a | / |
0.16 | 19.70 ± 1.77 b | 27.57 |
0.31 | 17.00 ± 1.05 c | 37.50 |
0.63 | 13.70 ± 0.67 d | 49.63 |
2.50 | 10.90 ± 0.74 e | 59.93 |
10.00 | 8.70 ± 0.82 f | 68.01 |
Treatment | Root Length (cm) | Plant Height (cm) | Fresh Weight (g) |
---|---|---|---|
Control | 9.43 ± 0.44 a | 11.74 ± 0.61 a | 1.07 ± 0.03 b |
CMF | 9.53 ± 0.11 a | 11.35 ± 1.18 a | 1.23 ± 0.06 a |
Treatment | Seed Cotton (kg/ha) | Lint Cotton (kg/ha) | Lint Percentage (%) | Single Boll Weight (g) |
---|---|---|---|---|
Control | 2588.82 ± 64.61 b | 1043.24 ± 43.92 b | 40.34 ± 2.69 a | 4.79 ± 0.23 a |
CMF | 2770.17 ± 46.69 a | 1128.70 ± 24.82 a | 40.74 ± 0.21 a | 5.13 ± 0.15 a |
Gene Name | Primer Sequence (5′–3′) |
---|---|
qPCR quantification of fungal biomass | |
Vdβt | F: AACAACAGTCCGATGGATAATTC |
R: GTACCGGGCTCGAGATCG | |
actin | F: CCTATGTTGCCCTGGACTATGAGC |
R: GGACAACGGAATCTCTCAGCTCC | |
qRT-PCR detection of genes relative expression | |
POD | F: CCGCATAACCATCACAAG |
R: ACTCTCATCACCTTCAACA | |
PPO | F: ATATCCTTGTTCTGTCTGCTA |
R: CTCCTTCTACCGTCTCTTC | |
PAL | F: TGGTGGCTGAGTTTAGGAAA |
R: TGAGTGAGGCAATGTGTGA | |
PR10 | F: ATGATTGAAGGTCGGCCTTTAGGG |
R: CAGCTGCCACAAACTGGTTCTCAT | |
CHI | F: CTTAGCCCAAACTTCCCA |
R: TACATTGAGTCCACCGAGAC | |
CAD | F: TAACAACAATGATGCCGAGAA |
R: ATGGTCCAAAGATGCTACTGC | |
4CL | F: ATTCAAAAGGGAGATGCC |
R: GAGAAGGGCAAAGCAACA | |
C4H1 | F: CCGAACCCGACACCCATAAGC |
R: GCAGGGATGTCATACCCACCAAG | |
NOA1 | F: GAGGATGCTGAAAGACCTGCTA |
R: TCTCAACTGGCTTGGGTACATG | |
Ubiquitin | F: GAGTCTTCGGACACCATTG |
R: CTTGACCTTCTTCTTCTTGTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Zhao, L.; Feng, Z.; Guo, H.; Feng, H.; Yuan, Y.; Wei, F.; Zhu, H. The Role of a New Compound Micronutrient Multifunctional Fertilizer against Verticillium dahliae on Cotton. Pathogens 2021, 10, 81. https://doi.org/10.3390/pathogens10010081
Zhang Y, Zhao L, Feng Z, Guo H, Feng H, Yuan Y, Wei F, Zhu H. The Role of a New Compound Micronutrient Multifunctional Fertilizer against Verticillium dahliae on Cotton. Pathogens. 2021; 10(1):81. https://doi.org/10.3390/pathogens10010081
Chicago/Turabian StyleZhang, Yalin, Lihong Zhao, Zili Feng, Hongfu Guo, Hongjie Feng, Yuan Yuan, Feng Wei, and Heqin Zhu. 2021. "The Role of a New Compound Micronutrient Multifunctional Fertilizer against Verticillium dahliae on Cotton" Pathogens 10, no. 1: 81. https://doi.org/10.3390/pathogens10010081