Next Article in Journal
The Evolution of Glycoside Hydrolase Family 1 in Insects Related to Their Adaptation to Plant Utilization
Previous Article in Journal
In Silico Characterization and Gene Expression Analysis of Toll Signaling Pathway-Related Genes in Diaphorina citri
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 13
Issue 9
10.3390/insects13090784
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae)

by
Delong Kong
1,2,3,
Daxia Shi
1,2,3,
Changlu Wang
4,
Ruyue Zhai
1,2,3,
Lingling Lyu
5,
Yurong He
1,2,3,* and
Desen Wang
1,2,3,*
1
Department of Entomology, South China Agricultural University, Guangzhou 510642, China
2
Key Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, Guangzhou 510642, China
3
Engineering Research Center of Biological Control, Ministry of Education, Guangzhou 510642, China
4
Department of Entomology, Rutgers University, New Brunswick, NJ 08901, USA
5
Ningbo Dayang Technology Co., Ltd., Ningbo 315000, China
*
Authors to whom correspondence should be addressed.
Insects 2022, 13(9), 784; https://doi.org/10.3390/insects13090784
Submission received: 19 July 2022 / Revised: 23 August 2022 / Accepted: 26 August 2022 / Published: 30 August 2022
(This article belongs to the Section Insect Molecular Biology and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Reference genes are the basis for exploring the function of target genes in insects. Recently, we identified a large number of chemoreceptor genes by transcriptome sequencing in different tissues of Cimex hemipterus (F.) (Hemiptera: Cimicidae). Additionally, we plan to study the expression patterns of these genes and clarify their functions. However, there is no report on the screening and application of the reference genes in C. hemipterus. In the present study, the expression-level stability of 10 candidate reference genes in C. hemipterus under various experimental conditions was evaluated through qRT-PCR combined with RefFinder (which integrates four computational programs: geNorm, NormFinder, BestKeeper, and ∆Ct). Results show that the optimal combination of reference genes for each experimental condition was as follows: RPL8 and EF1α for the developmental stage, RPL8 and RPS16 for adult sex, RPL8 and RPL11 for adult tissue, RPL8 and β-tubulin for gas stimulation, and RPL8 and NADH for temperature. The results will lay a foundation for the follow-up study on the expression and function of the target genes of tropical bed bugs.

Abstract

The tropical bed bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae) is an important public-health pest that feeds on the blood of humans and some other animals. To explore the function of the target genes of C. hemipterus, it is essential to select suitable reference genes for the accurate quantification of gene expression. Here, we selected 10 frequently used reference genes in insects and evaluated their stability in C. hemipterus under various biotic (developmental stage, sex, and tissue) and abiotic (gas stimulation and temperature) conditions through RefFinder (which integrates four computational programs: geNorm, NormFinder, BestKeeper, and ∆Ct). Results indicate that the optimal combination of reference genes for each experimental condition was as follows: RPL8 and EF1α for the developmental stage (eggs, early instar nymphs, late instar nymphs, and adults), RPL8 and RPS16 for adult sex, RPL8 and RPL11 for adult tissue (head, thorax, abdomen, and legs), RPL8 and β-tubulin for gas stimulation (air and carbon dioxide), and RPL8 and NADH for temperature (0, 5, 17, 30, and 37 °C). Finally, the expression pattern of the HSP70 and GR21 genes were analyzed, and the results highlight the importance of appropriate reference-gene selection. Our results provide a comprehensive list of optimal reference genes from C. hemipterus for the first time, which will contribute to accurately analyzing the expression of target genes.

1. Introduction

Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) testing has been widely used in the detection and quantitative analysis of mRNA transcription levels, owing to its advantages of high accuracy, high specificity, high sensitivity, easy performance, and rapidity [1,2]. Nevertheless, the precision of qRT-PCR analysis is often influenced by many biological and technical factors, for example, RNA integrity, quality, and reverse transcription efficiency, as well as PCR efficiency [2,3]. To avoid errors caused by the above variables and obtain accurate and reliable results, reference genes are often applied to normalize the expression of target genes [4].
Generally speaking, the suitable reference gene should not be controlled or affected by the experimental procedure [5]. However, many studies indicated that any reference gene is also not guaranteed to be stably expressed under all experimental conditions [6,7,8,9,10,11,12,13]. Therefore, it is necessary to select suitable reference genes under specific conditions for certain insect species rather than using common reference genes [14].
Bed bugs, Cimex hemipterus (F.) and Cimex lectularius L. (Hemiptera: Cimicidae), are cryptic and nocturnal obligate blood-sucking insects that feed on the blood of humans and some other warm-blooded animals [15,16]. In China, both C. hemipterus and C. lectularius are distributed, among which southern provinces such as Guangdong, Guangxi, Fujian, and Hainan are dominated by C. hemipterus, while other provinces are dominated by C. lectularius [17,18,19,20]. Since 2007, the number of reports of bed bug infestations has increased dramatically in China [21,22,23].
Similar to other blood-sucking insects [24,25,26], bed bugs can accurately locate their hosts and successfully feed on blood by sensing host-derived signaling substances such as CO2, host odor, and heat [27,28,29]. At present, the intrinsic mechanism of mosquito perception of host-derived signaling substances has been extensively studied, and numerous odorant receptors (ORs), gustatory receptors (GRs), and ionotropic receptors (IRs) involved in chemosensory signal transduction have been identified [24,25,30,31,32]. For bed bugs, there are relatively few studies on the chemosensory mechanisms of C. lectularius, and these mainly focus on the olfactory sensing mechanisms of aggregated pheromones and host odors, as well as repellent substances [29]; however, studies on the chemosensory mechanism of C. hemipterus have not been reported yet. Exploring the internal mechanism of bed bugs’ perceptions of host-derived signal substances and identifying the relevant chemoreceptor genes will help enrich our comprehensive understanding of the bugs’ host-search behavior and provide an important theoretical basis for the timely monitoring of bed bugs. On the other hand, it will lay the foundation for seeking new bed bug control strategies, which is of great practical significance for the realization of safe and efficient bed bug control.
Recently, we identified a large number of chemoreceptor genes by transcriptome sequencing in different tissues of C. hemipterus. Additionally, we plan to study the expression patterns of these genes (for example, in different tissues and in different developmental stages of bugs) and clarify their functions. However, there is no report on the screening and application of the reference genes in C. hemipterus. Although reference genes have been reported in C. lectularius [33,34], which belongs to the same genus as C. hemipterus, it is unknown whether these reference genes are equally suitable for C. hemipterus. Thus, the objective of the present study was to screen the stably expressed reference genes of C. hemipterus under five experimental conditions (developmental stage, sex, tissue, gas (air and carbon dioxide) stimulation, and temperature) for qRT-PCR normalization. Our results will provide the basic information for subsequent target-gene-expression analysis and functional studies in C. hemipterus and then lay the foundation for a better understanding of this pest and the formulation of rational control methods.

2. Materials and Methods

2.1. Insects

The Cimex hemipterus used in this study were collected from Guangzhou City, Guangdong Province, China in 2018 [19]. They were maintained in artificial climate chambers (26 ± 1 °C, 40 ± 10% relative humidity (RH) with a photoperiod of 12:12 (L:D) h) according to the methods of Zhang et al. (2021) [35].

2.2. Experimental Condition and Sample Collection

A total of five experimental conditions (developmental stage, sex, tissue, gas stimulation, and temperature) were set up to assess the stability of the 10 candidate reference genes in C. hemipterus. For each replication, the developmental-stage sample includes 50 eggs, 20 1st–2nd instar nymphs, 8 4th–5th instar nymphs, and 5 male adults; the sex sample contains 5 male adults and 5 female adults; the body tissue sample includes the head (containing antennae and mouthparts), thorax, abdomen, and legs, which were dissected from 50 male adults; the gas stimulation sample contains 5 CO2-treated (the concentration of CO2 was 1.6%) male adults and 5 air-treated male adults—all the male adults were stimulated by CO2 or air for 3 h with a flow rate of 500 mL/min, respectively; the temperature treatment sample contains male adults that were exposed to 0, 5, 17, 30, and 37 °C for 2 h, with 4 individuals per temperature treatment. Each experimental condition was replicated three times. The collected samples were immediately frozen with liquid nitrogen and temporarily stored under the condition of −80 °C until RNA extraction.

2.3. RNA Extraction and cDNA Synthesis

TRIzol reagent (Takara Biomedical Technology (Beijing) Co., Ltd., Beijing, China) was used for extracting total RNA from each sample following the manufacturer’s manual. The concentration and purity of RNAs were determined by a NanoDrop One Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The OD260/280 value of the total RNA was between 1.9 and 2.1, which was considered to meet the quality requirements for subsequent experiments. Then, the integrity of RNAs was examined by 0.8% agarose gel electrophoresis. First-strand cDNAs were synthesized by reverse transcribing 1 µg of total RNA with the PrimeScript RT Kit (Takara Biomedical Technology (Beijing) Co., Ltd., Beijing, China).

2.4. Reference Gene Selection, Primer Design, and qRT-PCR

Ten candidate reference genes were selected based on our recently sequenced transcriptomes for C. hemipterus (Kong et al., unpublished data). The 10 reference genes were Ribosomal protein L8 (RPL8), Ribosomal protein L11 (RPL11), Ribosomal protein L13 (RPL13), Ribosomal protein S16 (RPS16), α-tubulin (α-tubulin), β-tubulin (β-tubulin), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), Elongation factor 1 α (EF1α), NADH dehydrogenase (ubiquinone) flavoprotein 1 (NADH), and Actin (Actin). Primer pairs for amplification were designed strictly according to the principles of qRT-PCR primer design using the software Primer Premier 5.0. The primer sequence, length, and amplification efficiency (E) of the 10 reference genes are listed in Table 1.
The 20 µL reaction system included 10 µL 2 × SYBR Green Premix (TIANGEN, China), 0.6 µL of 10 µM primers, 6.8 µL ddH2O, and 2 µL diluted cDNA. Reactions were conducted using a CFX-96 real-time PCR system (Bio-Rad, Hercules, CA, USA). The amplification program was as follows: 95 °C for 10 min, 40 cycles of 95 °C for 10 s, and 60 °C for 32 s. The presence of a single peak in the melting curve analysis was selected to confirm the gene-specific amplification, as well as to get rid of the non-specific amplification and the primer–dimer generation.
The amplification efficiency and correlation coefficient of each candidate reference gene were measured by applying the slope of the standard curve generated by the serial five-fold diluted cDNA template [1]. The amplification efficiency (E) of each primer pair was calculated according to the equation [5]:
E = (10[−1/slope] − 1) × 100

2.5. Determination of Reference Gene Expression Stability

The expression stability of the 10 candidate reference genes was assessed using RefFinder (https://www.heartcure.com.au/reffinder/, accessed on 10 July 2022), which integrates four major computational programs, i.e., geNorm [36], NormFinder [7], BestKeeper [4], and the ∆Ct method [37]. The suitable number of reference genes for normalizing target gene expression was determined by computing the pairwise variation (V) using geNorm [36]. If the V-value (Vn/Vn+1) is lower than 0.15, it indicates using n genes is enough for target gene expression normalization.

2.6. Validation of the Candidate Reference Genes

To further verify the accuracy of our experimental results, the expression profiles of the heat shock protein (HSP70) gene and gustatory receptor 21 (GR21) gene in C. hemipterus were normalized by the top two most stable (RPL8 and RPL11) and least stable (RPL13 and RPS16) candidates in the head (including antennae and mouthparts), thorax, abdomen, and legs. The forward primer of HSP70 was 5′-GAACGGGAACCAAGGAGGC-3′, and the reverse primer of HSP70 was 5′-TCGACGGCGAATCTCAGCA-3′. The forward primer of GR21 was 5′-CGGGCATGGTGTTTATCAAG-3′, and the reverse primer of GR21 was 5′-CTCCCAGTGTAACTCGAGGG-3′. The relative expression levels of HSP70 and GR21 in different tissues (considered as different treatments) were computed using the 2−∆∆Ct method [38]. Each treatment was replicated 3–5 times.
One-way analysis of variance (ANOVA) was used to analyze the expression differences between HSP70 and GR21 in different tissues, and Tukey’s honest significant difference (HSD) test was selected for separating the means. Statistical analysis was conducted using SPSS version 22.0 [39].

3. Results

3.1. Primer Specificity and Efficiency

Melting curves of all primer pairs were a single peak, and no nonspecific amplification products were observed, indicating that the primers were highly specific. The amplification efficiency (E) of the primers for the 10 reference genes ranged from 87.11% for NADH to 111.07% for RPL8, and the correlation coefficients varied from 0.9806 to 0.9990 (Table 1).

3.2. Ct Values of Candidate Reference Genes

The cycle threshold (Ct) values of the 10 reference genes under five experimental conditions were used for evaluating their expression levels. As shown in Figure 1 and Table 2, the Ct values ranged from 14.92 to 32.34, and the most values were distributed between 18 and 27. Actin was the most abundant transcript (the mean Ct value was 16.46 ± 0.40), and NADH was the least abundant candidate reference gene (the mean Ct value was 24.61 ± 0.56) (Table 2).

3.3. Stability of the 10 Reference Genes under Different Experimental Conditions

For the developmental stage, there was a significant difference between the two most stable reference genes recommended by the four algorithms (Table 3). In the geNorm analysis, RPL8 and RPL11 had the best stability. In the NormFinder analysis, EF1α and NADH were the two most stable genes. The BestKeeper analysis showed that NADH and β-tubulin were the top two ranked genes. Additionally, in the ∆Ct analysis, RPL8 and EF1α were identified as the two most stable genes. Based on the RefFinder analysis results, RPL8 was the most stable reference gene in the developmental stage condition, followed by EF1α, NADH, RPL11, GAPDH, RPS16, β-tubulin, RPL13, α-tubulin, and Actin (Figure 2). The pairwise variation value of V2/3 calculated by geNorm was below the threshold value of 0.15 (Figure 3). Thus, in different developmental stages, RPL8 and EF1α were the suitable combination of reference genes.
For bed bug sex, the two most stable genes from the four computational programs differ significantly. For example, RPS16 and EF1α were determined to be the top two most stably expressed referenced genes by geNorm, RPL8 and RPL13 for NormFinder, RPS16 and RPL11 for BestKeeper, and RPL8 and RPL11 for ΔCt (Table 3). Based on the integrated analysis results of RefFinder, the most stable reference gene in different sex conditions was RPL8, followed by RPS16, RPL11, EF1α, GAPDH, RPL13, α-tubulin, Actin, β-tubulin, and NADH (Figure 2). The results of the geNorm analysis indicate that the pairwise variation value of V2/3 was less than the threshold value of 0.15 (Figure 3). Therefore, the combination of RPL8 and RPS16 was recommended for normalizing the qRT-PCR data in the different sexes of adult samples by geNorm.
For bed bug tissue, geNorm and NormFinder had the same top two genes in stability ranking: RPL8 and RPL11 (Table 3). However, the top two in BestKeeper were RPL8 and α-tubulin, and the top two in ΔCt were EF1α and RPL8 (Table 3). The RefFinder analysis showed that RPL8 was the most stable reference gene under this experimental condition, followed by RPL11, EF1α, α-tubulin, GAPDH, Actin, β-tubulin, NADH, RPL13, and RPS16 (Figure 2). The pairwise variation value of V2/3 was less than the cut-off value of 0.15 according to the geNorm analysis. (Figure 3). Therefore, RPL8 and RPL11 were recognized as suitable reference genes for normalizing qRT-PCR data in the different tissue samples.
For gas stimulation, NormFinder and ΔCt had the same top two gene stability rankings: RPL8 and β-tubulin (Table 3). However, based on geNorm, Actin and β-tubulin were the top two most stable genes. EF1α and GAPDH were determined to be the top two most stably expressed genes by BestKeeper (Table 3). Based on the analysis results of RefFinder, the most stable gene under the treatment of gas stimulation was RPL8, followed by β-tubulin, Actin, RPL11, EF1α, α-tubulin, GAPDH, NADH, RPL13, and RPS16 (Figure 2). The geNorm analysis results indicated that the pair-wise value of V2/3 was lower than 0.15 (Figure 3), suggesting that the combination of RPL8 and β-tubulin was sufficient for reliable normalization in different gas stimulation samples.
For temperature treatment, the top two most stable genes from the four computational programs differed from each other. They were RPL8 and RPL13 by geNorm, RPL8, and β-tubulin by NormFinder, NADH and Actin by BestKeeper, and RPL8 and NADH by ΔCt (Table 3). Based on the RefFinder analysis, the most stable reference gene under the conditions of different temperatures was RPL8, followed by NADH, β-tubulin, RPL13, EF1α, GAPDH, RPL11, Actin, α-tubulin, and RPS16 (Figure 2). The pairwise variation value of V2/3 calculated by the geNorm analysis program was less than 0.15 (Figure 3), indicating that the combination of RPL8 and NADH was adequate for optimal normalization in different temperature treatment samples.

3.4. Validation of Candidate Reference Genes in Different Tissues

The expression trend of HSP70 in different tissues was similar in the two combinations, with higher expression in the thorax and abdomen, and lower expression in the head and legs. When the two most stable reference genes (RPL8 and RPL11) were selected as reference genes, the relative expression levels of HSP70 in the legs were significantly higher than in the head (F3,16 = 17.1, p < 0.0001; Figure 4). However, when the two least stable reference genes (RPL13 and RPS16) were selected, no significant difference was observed in the relative expression of HSP70 between the head and legs (F3,16 = 9.1, p = 0.001; Figure 4). For another gene, the relative expression trend of GR21 in different tissues was inconsistent in the two reference-gene combinations (RPL8 and RPL11, RPL13 and RPS16). The relative expression of GR21 in the head was the highest, and the relative expression in the four tissues was significantly different, when normalized by RPL8 and RPL11 (F3,8 = 439.9, p < 0.0001; Figure 5). While, when normalized by RPL13 and RPS16, the tissue with the highest relative expression of GR21 was the thorax. However, there was no significant difference in the relative expression among the head, thorax, and legs; in addition, no significant difference was observed among the head, abdomen, and legs (Figure 5). Therefore, these results further indicate that the expression levels of the target genes will be different when normalized by different reference-gene combinations.

4. Discussion

In the present study, the expression-level stability of 10 candidate reference genes in C. hemipterus under various experimental conditions was evaluated through qRT-PCR. According to the final evaluation results of RefFinder, it was found that the stable expressed reference genes recommended for different developmental stages, different tissues of the adult males, different sexes, different temperature treatments, and bed bugs stimulated by different gases varied. Among them, RPL8 had the least variable expression levels under the five experimental conditions, which was consistent with the report of Zhu et al. [34]. In the research of Zhu et al. [34], the stability of four reference genes (RPL11, RPL8, RPS16, and HSP70) under the conditions of different populations, different developmental stages, different tissues, and dsRNA injected in C. lectularius was compared; that study also identified RPL8 as an optimal reference gene. We infer that this consistency may be related to the close genetic relationship between C. hemipterus and C. lectularius. Another report about the selection of reference genes in C. lectularius showed that RPL18 was defined as the best reference gene for various tissues and developmental stages of pesticide-exposed and susceptible strains, and their candidate reference genes include Actin, β-tubulin, EF1α, GAPDH, syntaxin (SYN), RPL18, and ubiquitin-C (UBC) [33]. However, our study did not include RPL18 as a candidate reference gene. Whether there was a difference in the stability of RPL8 and RPL18 in C. hemipterus requires further study.
Actin and GAPDH, the most widely used internal reference genes in animals, insects, and plants, did not show good expression stability in C. hemipterus (Figure 2, Table 3). This significant variance in the expression stability has been reported in many previous studies [6,8,9,33,40,41]. EF1α [33,42] and NADH [43] also have been widely used as reference genes in different species and experimental conditions. In our experiments, EF1α was one of the top two most stable genes in the developmental-stage sample set, but it did not perform well among the other four factors. Similarly, NADH was one of the top two most stable genes in different temperature treatment samples; however, its stabilization was greatly reduced under the conditions of different developmental stages and sexes. These results further demonstrate that no single reference gene is suitable for all species and different treatment conditions.
The ribosomal protein (RP) is involved in translation and protein synthesis and is one of the most highly conserved proteins in all biological cells. The RP coding gene was considered to be one stable expressed reference gene and had been widely used in insect molecular research to regulate the level of gene expression over the past 10 years [44,45,46,47,48]. These genes include RPL8 under the conditions of different populations, different developmental stages, different tissues, dsRNA injected in C. lectularius [34], different geographic populations, across developmental stages, different wing dimorphisms, different temperature treatments, and different antibiotic treatments of Metopolophium dirhodum (Walker) (Hemiptera: Aphididae) [43]; RPL13 in the different tissues of Rhopalosiphum padi L. (Hemiptera: Aphididae) [49]; and RPL11 in the conditions of different developmental stages and temperatures in Aphis craccivora Koch (Hemiptera: Aphidiae) [50]. In this study, the RPL8 gene exhibited the most stable expression level in C. hemipterus under the five experimental conditions, RPL11 was recommended as one of the top two most stable expressed genes in different adult tissues, and RPS16 was also recommended for different sexes. Our results further expand the application scope of the RP coding gene as an internal reference gene in hemiptera insects.
It has been widely accepted that introducing two or more reference genes to normalize target-gene expression levels can reduce various errors and ensure the accuracy of results in experiments [51,52]. However, using a poor stable reference gene may yield the incorrect expression pattern of the target gene and lead to erroneous interpretations [50]. In the present experiment, the expression level of GR21 was inconsistent among different tissues when normalized to the top two most stable (RPL8 and RPL11) and least stable (RPL13 and RPS16) reference genes. Therefore, it is pivotal to choose and confirm the best stable reference genes for certain insect species under specific conditions.
Over the past 20–30 yr period, there was a significant upward trend of bed bug infestations worldwide. The effective control of C. hemipterus has become a common issue in many infested countries or regions, such as China [19,20,53], southeast Asia [54,55], and South Africa [56]. Our results can provide the essential information for target-gene expression analysis and functional studies of this pest in order to lay a foundation for further exploration of new C. hemipterus control methods/strategies. However, this study only screened the reference genes of C. hemipterus under three biotic (developmental stage, tissue, and sex) and two abiotic (gas stimulation and temperature) conditions. Whether the results are also suitable for other experimental conditions (such as RNAi, insecticide treatment, etc.) in C. hemipterus or other species needs to be further verified.

5. Conclusions

In this study, we selected 10 frequently used reference genes in insects and evaluated their stability in C. hemipterus under various biotic (developmental stage, sex, and tissue) and abiotic (gas stimulation and temperature) conditions using RefFinder. The results show that the most suitable candidate combinations of reference genes were as follows: RPL8 and EF1α for the developmental stage (eggs, early instar nymphs, late instar nymphs, and adults), RPL8 and RPS16 for adult sex, RPL8 and RPL11 for adult tissue (head, thorax, abdomen, and legs), RPL8 and β-tubulin for gas stimulation (air and carbon dioxide), and RPL8 and NADH for temperature treatment. These findings will provide the basic information for subsequent target-gene-expression analysis and functional studies in C. hemipterus.

Author Contributions

Conceptualization, D.W. and D.K.; Methodology, D.W. and D.K.; Software, D.W. and D.K.; Formal analysis, D.W., D.K. and L.L.; Resources, D.S. and R.Z.; Validation, D.S., R.Z. and L.L.; Investigation, D.S., R.Z., L.L. and Y.H.; Data curation, D.K. and D.W.; Writing—original draft preparation, D.K. and D.W.; Writing—review and editing, D.W., D.K., C.W. and Y.H.; Project administration, D.W. and C.W.; Funding acquisition, D.W. and C.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Characteristic Innovation Project of Colleges and Universities of the Guangdong Provincial Department of Education (2020KTSCX017), the Ningbo Key Research and Development Plan and “Jie Bang Gua Shuai” Program (2022Z124), and the Jiangxi Province 2018 ‘Double Thousands Talents’ Plan (jxsq2018102116).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We thank Min Fan, Qiling Liang, and Shujie Mo from the South China Agricultural University for help in rearing bed bugs and preparing experimental materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
  2. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
  3. Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative real-time RT-PCR—A perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed]
  4. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
  5. Radonić, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.; Nitsche, A. Guideline to reference gene selection for quantitative real-time PCR. Biochem. Bioph. Res. Commun. 2004, 313, 856–862. [Google Scholar] [CrossRef]
  6. Lee, P.D.; Sladek, R.; Greenwood, C.M.T.; Hudson, T.J. Control genes and variability: Absence of ubiquitous reference transcripts in diverse mammalian expression studies. Genome Res. 2002, 12, 292–297. [Google Scholar] [CrossRef]
  7. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
  8. Bémeur, C.; Ste-Marie, L.; Desjardins, P.; Hazell, A.S.; Vachon, L.; Butterworth, R.; Montgomery, J. Decreased β-actin mRNA expression in hyperglycemic focal cerebral ischemia in the rat. Neurosci. Lett. 2004, 357, 211–214. [Google Scholar] [CrossRef]
  9. Pan, H.; Yang, X.; Bidne, K.; Hellmich, R.L.; Siegfried, B.D.; Zhou, X. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator. PLoS ONE 2015, 10, e0129482. [Google Scholar] [CrossRef]
  10. Yang, C.; Preisser, E.L.; Zhang, H.; Liu, Y.; Dai, L.; Pan, H.; Zhou, X. Selection of reference genes for RT-qPCR analysis in Coccinella septempunctata to assess un-intended effects of RNAi transgenic plants. Front. Plant Sci. 2016, 7, 1672. [Google Scholar]
  11. Yang, X.; Pan, H.; Yuan, L.; Zhou, X. Reference gene selection for RT-qPCR analysis in Harmonia axyridis, a global invasive lady beetle. Sci. Rep. 2018, 8, 2689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Liang, C.; Han, S.; Han, H.; Zhao, F.; He, Y. Selection of reference genes for Harmonia axyridis (Coleoptera: Coccinellidae) feeding on different diets. J. Asia-Pac. Entomol. 2019, 22, 1115–1122. [Google Scholar] [CrossRef]
  13. Guo, C.F.; Pan, H.P.; Zhang, L.H.; Ou, D.; Lu, Z.T.; Khan, M.M.; Qiu, B.L. Comprehensive assessment of candidate reference genes for gene expression studies using RT-qPCR in Tamarixia radiata, a predominant parasitoid of Diaphorina citri. Genes 2020, 11, 1178. [Google Scholar] [CrossRef]
  14. Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.A.W.; Zumla, A. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef]
  15. Goddard, J.; deShazo, R. Bed bugs (Cimex lectularius) and clinical consequences of their bites. JAMA 2009, 301, 1358–1366. [Google Scholar] [CrossRef] [PubMed]
  16. Bernardeschi, C.; Cleach, L.L.; Delaunay, P.; Chosidow, O. Bed bug infestation. BMJ 2013, 346, f138. [Google Scholar] [CrossRef]
  17. Teng, K.F.; Feng, L.C. The geographical distribution of the two species of bedbugs, Cimex lectularius L. and C. hemiptera F., in China. Acta Entomol. Sin. 1953, 2, 253–264. [Google Scholar]
  18. Zhao, Y.; Feng, X.; Li, M.; Qiu, X. The double-mutation (M918I + L1014F) kdr allele is fixed in Cimex hemipterus populations in Guangxi, China. Bull. Entomol. Res. 2020, 110, 506–511. [Google Scholar] [CrossRef]
  19. Zhang, J.; Xia, Y.; Wang, C.; Han, D.; Ren, D.; Zheng, J.; Xu, X.; He, Y.; Wang, D. Morphological and molecular identification of tropical bed bugs from two cities of the Pearl River Delta in China. J. Med. Entomol. 2021, 58, 471–474. [Google Scholar] [CrossRef]
  20. Kong, D.; Han, D.; Zhai, R.; Wang, C.; Zhang, J.; Xia, Y.; Nian, X.; Liu, C.; He, Y.; Wang, D. A case study on tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae) infestation and management in dormitories. J. Econ. Entomol. 2022. [Google Scholar] [CrossRef]
  21. Wang, L.; Xu, Y.; Zeng, L. Resurgence of bed bugs (Hemiptera: Cimicidae) in mainland China. Fla. Entomol. 2013, 96, 131–136. [Google Scholar] [CrossRef]
  22. Wang, L.; Cai, X.; Xu, Y. Status of urban bed bug infestations in southern China: An analysis of pest control service records in Shenzhen in 2012 and Dongguan in 2013. J. Med. Entomol. 2015, 52, 76–80. [Google Scholar] [CrossRef] [PubMed]
  23. Ren, D.S.; Wu, H.X.; Xiu, P.C.; Song, X.P.; Yue, Y.J.; Lu, L.; Liu, Q.Y. National surveillance report on bed bugs in China, 2019. Chin. J. Vector Biol. Control 2020, 31, 423–425. [Google Scholar]
  24. McMeniman, C.J.; Corfas, R.A.; Matthews, B.J.; Ritchie, S.A.; Vosshall, L.B. Multimodal integration of carbon dioxide and other sensory cues drives mosquito attraction to humans. Cell 2014, 156, 1060–1071. [Google Scholar] [CrossRef]
  25. Raji, J.I.; Melo, N.; Castillo, J.S.; Gonzalez, S.; Saldana, V.; Stensmyr, M.C.; DeGennaro, M. Aedes aegypti mosquitoes detect acidic volatiles found in human odor using the IR8a pathway. Curr. Biol. 2019, 29, 1253–1262. [Google Scholar] [CrossRef]
  26. Greppi, C.; Laursen, W.J.; Budelli, G.; Chang, E.C.; Daniels, A.M.; van Giesen, L.; Smidler, A.L.; Catteruccia, F.; Garrity, P.A. Mosquito heat-seeking is driven by an ancestral cooling receptor. Science 2020, 367, 681–684. [Google Scholar] [CrossRef]
  27. Reinhardt, K.; Siva-Jothy, M.T. Biology of the bed bugs (Cimicidae). Annu. Rev. Entomol. 2007, 52, 351–374. [Google Scholar] [CrossRef]
  28. Doggett, S.L.; Miller, D.M.; Lee, C.Y. Advances in the Biology and Management of Modern Bed Bugs; Wiley-Blackwell: Chichester, West Sussex, UK, 2018. [Google Scholar]
  29. Liu, F.; Chen, Z.; Ye, Z.; Liu, N. The olfactory chemosensation of hematophagous Hemipteran insects. Front. Physiol. 2021, 12, 703768. [Google Scholar] [CrossRef]
  30. Kwon, H.W.; Lu, T.; Rützler, M.; Zwiebel, L.J. Olfactory responses in a gustatory organ of the malaria vector mosquito Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2006, 103, 13526–13531. [Google Scholar] [CrossRef]
  31. Lu, T.; Qiu, Y.T.; Wang, G.; Kwon, J.Y.; Rutzler, M.; Kwon, H.W.; Pitts, R.J.; van Loon, J.J.A.; Takken, W.; Carlson, J.R.; et al. Odor coding in the maxillary palp of the malaria vector mosquito Anopheles gambiae. Curr. Biol. 2007, 17, 1533–1544. [Google Scholar] [CrossRef]
  32. Tauxe, G.M.; MacWilliam, D.; Boyle, S.M.; Guda, T.; Ray, A. Targeting a dual detector of skin and CO2 to modify mosquito host seeking. Cell 2013, 155, 1365–1379. [Google Scholar] [CrossRef] [PubMed]
  33. Mamidala, P.; Rajarapu, S.P.; Jones, S.C.; Mittapalli, O. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius. J. Med. Entomol. 2011, 48, 947–951. [Google Scholar] [CrossRef] [PubMed]
  34. Zhu, F.; Sams, S.; Moural, T.; Haynes, K.F.; Potter, M.F.; Palli, S.R. RNA interference of NADPH-cytochrome P450 reductase results in reduced insecticide resistance in the bed bug, Cimex lectularius. PLoS ONE 2012, 7, e31037. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Zhang, J.; Liang, Q.; Xia, Y.; Kong, D.; Wang, C.; Mo, S.; He, Y.; Wang, D. Behavioral response of the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae) to carbon dioxide. J. Econ. Entomol. 2021, 114, 2198–2203. [Google Scholar] [CrossRef]
  36. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 14389. [Google Scholar] [CrossRef] [PubMed]
  37. Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
  38. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  39. IBM Corporation. IBM SPSS Statistics Base 22.0; IBM Corporation: Armonk, NY, USA, 2013. [Google Scholar]
  40. Liang, W.; Zou, X.; Carballar-Lejarazú, R.; Wu, L.; Sun, W.; Yuan, X.; Wu, S.; Li, P.; Ding, H.; Ni, L.; et al. Selection and evaluation of reference genes for qRT-PCR analysis in Euscaphis konishii Hayata based on transcriptome data. Plant Methods 2018, 14, 42. [Google Scholar] [CrossRef]
  41. Lü, J.; Chen, S.; Guo, M.; Ye, C.; Qiu, B.; Wu, J.; Yang, C.; Pan, H. Selection and validation of reference genes for RT-qPCR analysis of the ladybird beetle Henosepilachna vigintioctomaculata. Front. Physiol. 2018, 9, 1614. [Google Scholar] [CrossRef] [PubMed]
  42. Wang, X.; Xiong, M.; Wang, J.; Lei, C.; Zhu, F. Reference gene stability of a synanthropic fly, Chrysomya megacephala. Parasite Vector 2015, 8, 565. [Google Scholar] [CrossRef]
  43. Li, X.; Gong, P.; Wang, B.; Wang, C.; Li, M.; Zhang, Y.; Li, X.; Gao, H.; Ju, J.; Zhu, X. Selection and validation of experimental condition-specific reference genes for qRT-PCR in Metopolophium dirhodum (Walker) (Hemiptera: Aphididae). Sci. Rep. 2020, 10, 21951. [Google Scholar] [CrossRef] [PubMed]
  44. Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 2000, 25, 169–193. [Google Scholar] [CrossRef] [PubMed]
  45. Van Hiel, M.B.; Van Wielendaele, P.; Temmerman, L.; Van Soest, S.; Vuerinckx, K.; Huybrechts, R.; Broeck, J.V.; Simonet, G. Identification and validation of housekeeping genes in brains of the desert locust Schistocerca gregaria under different developmental conditions. BMC Mol. Biol. 2009, 10, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Horňáková, D.; Matoušková, P.; Kindl, J.; Valterová, I.; Pichová, I. Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages. Anal. Biochem. 2010, 397, 118–120. [Google Scholar] [CrossRef] [PubMed]
  47. Lord, J.C.; Hartzer, K.; Toutges, M.; Oppert, B. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge. J. Microbiol. Methods 2010, 80, 219–221. [Google Scholar] [CrossRef] [PubMed]
  48. Zhang, S.; An, S.; Li, Z.; Wu, F.; Yang, Q.; Liu, Y.; Cao, J.; Zhang, H.; Zhang, Q.; Liu, X. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 2015, 555, 393–402. [Google Scholar] [CrossRef]
  49. Li, M.; Li, X.; Wang, C.; Li, Q.; Zhu, S.; Zhang, Y.; Li, X.; Yang, F.; Zhu, X. Selection and validation of reference genes for qRT-PCR analysis of Rhopalosiphum padi (Hemiptera: Aphididae). Front. Physiol. 2021, 12, 663338. [Google Scholar] [CrossRef]
  50. Yang, C.; Pan, H.; Liu, Y.; Zhou, X. Temperature and development impacts on housekeeping gene expression in cowpea aphid, Aphis craccivora (Hemiptera: Aphidiae). PLoS ONE 2015, 10, e0130593. [Google Scholar]
  51. Ferguson, B.S.; Nam, H.; Hopkins, R.G.; Morrison, R.F. Impact of reference gene selection for target gene normalization on experimental outcome using real-time qRT-PCR in adipocytes. PLoS ONE 2010, 5, e15208. [Google Scholar] [CrossRef]
  52. Veazey, K.J.; Golding, M.C. Selection of stable reference genes for quantitative RT-PCR comparisons of mouse embryonic and extra-embryonic stem cells. PLoS ONE 2011, 6, e27592. [Google Scholar] [CrossRef]
  53. Wang, D.S.; Xia, Y.W.; Zhang, J.S.; Han, D.L.; Wang, C.L.; Zheng, J.; He, Y.R.; Ren, D.S.; Liu, J.; Deng, H. Problems and strategies in bed bug prevention and control in China. Chin. J. Vector Biol. Control 2020, 31, 502–507. [Google Scholar]
  54. How, Y.F.; Lee, C.Y. Survey of bed bugs in infested premises in Malaysia and Singapore. J. Vector Ecol. 2010, 35, 89–94. [Google Scholar] [CrossRef] [PubMed]
  55. Zulaikha, Z.; Hafiz, A.M.A.; Hafis, A.R.A.; Hassan, A.A. A survey on the infestation levels of tropical bed bugs in Peninsular Malaysia: Current updates and status on resurgence of Cimex hemipterus (Hemiptera: Cimicidae). Asian Pac. J. Trop. Dis. 2016, 6, 40–45. [Google Scholar] [CrossRef]
  56. Newberry, K. The tropical bedbug Cimex hemipterus near the southernmost extent of its range. Trans. R. Soc. Trop. Med. Hyg. 1990, 84, 745–747. [Google Scholar] [CrossRef]
Insects 13 00784 g001 550
Figure 1. Cycle threshold (Ct) values of 10 candidate reference genes in C. hemipterus under different experimental conditions. The boxes show the 25th and 75th percentiles, the line inside the box depicts the median value, and whiskers indicate the standard error of the mean.
Figure 1. Cycle threshold (Ct) values of 10 candidate reference genes in C. hemipterus under different experimental conditions. The boxes show the 25th and 75th percentiles, the line inside the box depicts the median value, and whiskers indicate the standard error of the mean.
Insects 13 00784 g001
Insects 13 00784 g002 550
Figure 2. Stability ranking of 10 candidate reference genes in C. hemipterus under different treatment conditions analyzed by RefFinder (integrates four major computational programs: geNorm, NormFinder, BestKeeper, and ∆Ct). The lower the value, the higher the stability.
Figure 2. Stability ranking of 10 candidate reference genes in C. hemipterus under different treatment conditions analyzed by RefFinder (integrates four major computational programs: geNorm, NormFinder, BestKeeper, and ∆Ct). The lower the value, the higher the stability.
Insects 13 00784 g002
Insects 13 00784 g003 550
Figure 3. Optimal reference-gene number was required for the normalization of target-gene expression in C. hemipterus under the different experimental conditions. The pairwise variation (V) value was calculated using geNorm to evaluate the optimal reference-gene number in the qRT-PCR analysis. A value less than 0.15 indicates that n reference genes are sufficient to normalize the expression of the target gene.
Figure 3. Optimal reference-gene number was required for the normalization of target-gene expression in C. hemipterus under the different experimental conditions. The pairwise variation (V) value was calculated using geNorm to evaluate the optimal reference-gene number in the qRT-PCR analysis. A value less than 0.15 indicates that n reference genes are sufficient to normalize the expression of the target gene.
Insects 13 00784 g003
Insects 13 00784 g004 550
Figure 4. Tissue expression patterns of HSP70 gene in C. hemipterus. The relative expression levels of HSP70 in the head (including antennae and mouthparts), thorax, abdomen, and legs were normalized to the top two most stable (A, RPL8 and RPL11) and least stable (B, RPL13 and RPS16) candidate reference genes, respectively. Different lower letters above bars represent significant differences in gene expression among different tissues (p < 0.05, Tukey’s HSD test).
Figure 4. Tissue expression patterns of HSP70 gene in C. hemipterus. The relative expression levels of HSP70 in the head (including antennae and mouthparts), thorax, abdomen, and legs were normalized to the top two most stable (A, RPL8 and RPL11) and least stable (B, RPL13 and RPS16) candidate reference genes, respectively. Different lower letters above bars represent significant differences in gene expression among different tissues (p < 0.05, Tukey’s HSD test).
Insects 13 00784 g004
Insects 13 00784 g005 550
Figure 5. Tissue expression patterns of GR21 gene in C. hemipterus. The relative expression levels of GR21 in the head (including antennae and mouthparts), thorax, abdomen, and legs were normalized to the top two most stable (A, RPL8 and RPL11) and least stable (B, RPL13 and RPS16) candidate reference genes, respectively. Different lower letters above bars represent significant differences in gene expression among different tissues (p < 0.05, Tukey’s HSD test).
Figure 5. Tissue expression patterns of GR21 gene in C. hemipterus. The relative expression levels of GR21 in the head (including antennae and mouthparts), thorax, abdomen, and legs were normalized to the top two most stable (A, RPL8 and RPL11) and least stable (B, RPL13 and RPS16) candidate reference genes, respectively. Different lower letters above bars represent significant differences in gene expression among different tissues (p < 0.05, Tukey’s HSD test).
Insects 13 00784 g005
Table
Table 1. The primer sets and amplification efficiency of the 10 candidate reference genes used for qRT-PCR.
Table 1. The primer sets and amplification efficiency of the 10 candidate reference genes used for qRT-PCR.
GenePrimer Sequence a (5′–3′)Amplicon Length (bp)Efficiency b (%)R2 c
RPL8F: AGGCACGGTTACATCAAAGG131111.070.9952
R: TCGGGAGCAATGAAGAGTTC
RPL11F: GAAGAATGTCATGCGAGATGTCAGG12992.280.9987
R: CCTTTGAGAAGACTGGCTGCTG
RPL13F: ATTGGCAGAGGTTCATTCGT131100.910.9979
R: GCATCTCACTGCTGGTCTCA
RPS16F: AATGGTCGCCCACTTGAGAT15887.460.9976
R: GCCTGCCTGATTGCGTAGAT
α-tubulinF: TCAACTACCAACCACCCACT13994.930.9990
R: TTGGCGTACATCAAGTCAAA
β-tubulinF: CCTTTGCTGGACGCCTCATT84103.670.9902
R: CGACCCGACTGGTGCATACC
GAPDHF: GCATTTAGAGTCCCTGTCGC14991.120.9806
R: ACTTCATCTTCGGTGTAGCC
EF1αF: CGTTAGGACGTTTCGCTGTC103106.650.9893
R: GCCTTTGTCACTTTGCCACT
ActinF: GACTTCGAGCAGGAAATGGC11498.080.9989
R: TTCTGGGCAACGGAACCTCT
NADHF: AAAGACGAAGGTCGGGATTA7687.110.9812
R: GCATCAAAGAAACACGCATC
a: F and R denote forward and reverse primers, respectively. b: qRT-PCR amplification efficiency, calculated by the standard curve method. c: Determination coefficient.
Table
Table 2. Cycle threshold (Ct) values (mean ± SE) of 10 candidate reference genes under five different experimental conditions.
Table 2. Cycle threshold (Ct) values (mean ± SE) of 10 candidate reference genes under five different experimental conditions.
Candidate GeneExperimental ConditionsAll *
Developmental StageSexTissueGas StimulationTemperature
RPL819.15 ± 0.1618.50 ± 0.4219.33 ± 0.1127.61 ± 0.5621.26 ± 0.2320.68 ± 0.40
RPL1118.23 ± 0.5718.62 ± 0.1619.29 ± 0.1626.97 ± 0.4922.39 ± 0.2320.78 ± 0.41
RPL1318.75 ± 0.2419.40 ± 0.6622.24 ± 1.0328.34 ± 0.6021.53 ± 0.2321.60 ± 0.48
RPS1617.94 ± 0.6517.63 ± 0.1522.73 ± 1.1929.70 ± 0.8730.44 ± 0.4124.09 ± 0.83
α-tubulin15.74 ± 0.6716.59 ± 0.6116.58 ± 0.1623.08 ± 0.4717.67 ± 0.1617.47 ± 0.33
β-tubulin20.61 ± 0.4422.18 ± 0.9719.50 ± 0.5027.67 ± 0.6520.95 ± 0.1721.46 ± 0.38
GAPDH17.88 ± 0.5318.30 ± 0.3220.25 ± 0.2027.77 ± 0.4822.67 ± 0.1921.06 ± 0.45
EF1α15.54 ± 0.5415.52 ± 0.2516.70 ± 0.1724.27 ± 0.4617.94 ± 0.2317.55 ± 0.39
Actin15.67 ± 1.2016.87 ± 0.8814.92 ± 0.3123.29 ± 0.6315.42 ± 0.1216.46 ± 0.40
NADH21.26 ± 0.3526.60 ± 2.6723.12 ± 0.5232.34 ± 0.6024.61 ± 0.1024.61 ± 0.56
*: The mean cycle threshold (Ct) values (mean ± SE) of each reference gene under five experimental conditions in C. hemipterus.
Table
Table 3. Stability of 10 reference genes in Cimex hemipterus under different conditions.
Table 3. Stability of 10 reference genes in Cimex hemipterus under different conditions.
ConditionRank *geNormNormFinderBestKeeper∆Ct
GeneStabilityGeneStabilityGeneStabilityGeneStability
Developmental stage1RPL80.118EF1α0.274NADH0.283RPL80.622
2RPL110.118NADH0.278β-tubulin0.349EF1α0.623
3EF1α0.240RPL80.334EF1α0.410RPL110.636
4RPS160.269GAPDH0.378GAPDH0.428RPS160.675
5RPL130.356RPL110.382RPL80.443NADH0.707
6GAPDH0.434RPS160.433RPL110.457GAPDH0.722
7NADH0.497β-tubulin0.588RPS160.490RPL130.837
8α-tubulin0.560RPL130.685α-tubulin0.622β-tubulin0.865
9β-tubulin0.629α-tubulin0.708RPL130.672α-tubulin0.896
10Actin0.813Actin1.513Actin0.963Actin1.551
Sex1RPS160.328RPL80.364RPS160.290RPL81.709
2EF1α0.328RPL130.428RPL110.317RPL111.794
3RPL110.640RPL110.709EF1α0.385GAPDH1.914
4GAPDH0.749GAPDH1.133GAPDH0.520RPS161.944
5RPL80.881α-tubulin1.192RPL80.691α-tubulin1.947
6α-tubulin1.002Actin1.217α-tubulin1.253EF1α1.948
7RPL131.183RPS161.380RPL131.272RPL132.039
8Actin1.325β-tubulin1.428Actin1.771Actin2.091
9β-tubulin1.421EF1α1.448β-tubulin1.986β-tubulin2.241
10NADH2.388NADH6.188NADH5.589NADH6.256
Tissue1RPL80.355RPL80.178RPL80.329EF1α1.595
2RPL110.355RPL110.178α-tubulin0.415RPL81.600
3EF1α0.484EF1α0.247RPL110.422RPL111.667
4GAPDH0.556α-tubulin0.312EF1α0.490α-tubulin1.723
5α-tubulin0.632GAPDH0.579GAPDH0.524GAPDH1.775
6Actin0.847Actin0.830Actin0.808Actin1.915
7β-tubulin1.057β-tubulin1.165β-tubulin1.173β-tubulin2.158
8NADH1.313NADH2.099NADH1.524NADH2.656
9RPL131.838RPL133.835RPL133.203RPL134.031
10RPS162.353RPS164.235RPS163.629RPS164.412
Gas stimulation1Actin0.325RPL80.241EF1α0.893RPL80.689
2β-tubulin0.325β-tubulin0.400GAPDH0.958β-tubulin0.737
3RPL80.440RPL110.435α-tubulin0.998RPL110.764
4RPL110.491Actin0.453RPL111.004Actin0.766
5α-tubulin0.588NADH0.579RPL81.100EF1α0.834
6EF1α0.624EF1α0.616RPL131.105α-tubulin0.846
7GAPDH0.644α-tubulin0.651NADH1.180NADH0.857
8NADH0.696GAPDH0.718Actin1.231GAPDH0.892
9RPL130.778RPL130.855β-tubulin1.281RPL131.041
10RPS160.864RPS161.089RPS161.767RPS161.207
Temperature1RPL80.230RPL80.279NADH0.345RPL80.616
2RPL130.230β-tubulin0.343Actin0.390NADH0.653
3EF1α0.360NADH0.361α-tubulin0.446β-tubulin0.660
4RPL110.416GAPDH0.407β-tubulin0.554EF1α0.664
5GAPDH0.464EF1α0.426GAPDH0.563GAPDH0.679
6NADH0.512RPL130.447RPL110.726RPL130.688
7β-tubulin0.528RPL110.462RPL80.764RPL110.702
8Actin0.573α-tubulin0.568EF1α0.776α-tubulin0.791
9α-tubulin0.605Actin0.593RPL130.797Actin0.795
10RPS160.766RPS161.341RPS161.211RPS161.411
*: The ranking is based on stability; the lower the value, the higher the ranking.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kong, D.; Shi, D.; Wang, C.; Zhai, R.; Lyu, L.; He, Y.; Wang, D. Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae). Insects 2022, 13, 784. https://doi.org/10.3390/insects13090784

AMA Style

Kong D, Shi D, Wang C, Zhai R, Lyu L, He Y, Wang D. Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae). Insects. 2022; 13(9):784. https://doi.org/10.3390/insects13090784

Chicago/Turabian Style

Kong, Delong, Daxia Shi, Changlu Wang, Ruyue Zhai, Lingling Lyu, Yurong He, and Desen Wang. 2022. "Identification and Validation of Reference Genes for Expression Analysis Using qRT-PCR in Cimex hemipterus (Hemiptera: Cimicidae)" Insects 13, no. 9: 784. https://doi.org/10.3390/insects13090784

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop