Next Article in Journal
Evening Primrose Extract Modulates TYMS Expression via SP1 Transcription Factor in Malignant Pleural Mesothelioma
Next Article in Special Issue
New Insights on the Progesterone (P4) and PGRMC1/NENF Complex Interactions in Colorectal Cancer Progression
Previous Article in Journal
International Variations in Surgical Morbidity and Mortality Post Gynaecological Oncology Surgery: A Global Gynaecological Oncology Surgical Outcomes Collaborative Led Study (GO SOAR1)
Previous Article in Special Issue
An Update of G-Protein-Coupled Receptor Signaling and Its Deregulation in Gastric Carcinogenesis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cancers
Volume 15
Issue 20
10.3390/cancers15205002
cancers-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Modulatory Properties of Aloe secundiflora’s Methanolic Extracts on Targeted Genes in Colorectal Cancer Management

by
John M. Macharia
1,*,
Timea Varjas
2,
Ruth W. Mwangi
3,4,
Zsolt Káposztás
5,
Nóra Rozmann
1,
Márton Pintér
1,
Isabel N. Wagara
4 and
Bence L. Raposa
5
1
Doctoral School of Health Sciences, Faculty of Health Science, University of Pẻcs, 7621 Pẻcs, Hungary
2
Department of Public Health Medicine, Medical School, University of Pẻcs, 7621 Pẻcs, Hungary
3
Department of Vegetable and Mushroom Growing, Hungarian University of Agriculture and Life Sciences, 1118 Budapest, Hungary
4
Department of Biological Sciences, Egerton University, Nakuru P.O. Box 3366-20100, Kenya
5
Faculty of Health Sciences, University of Pécs, 7621 Pécs, Hungary
*
Author to whom correspondence should be addressed.
Cancers 2023, 15(20), 5002; https://doi.org/10.3390/cancers15205002
Submission received: 20 September 2023 / Revised: 8 October 2023 / Accepted: 12 October 2023 / Published: 16 October 2023
(This article belongs to the Special Issue Advances in Molecular Mechanisms of Gastrointestinal Tumors)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

This study focused on understanding the potential use of Aloe secundiflora (AS) extracts in managing colorectal cancer (CRC). As colon tumors present complex challenges, the research aimed to assess how the AS methanolic extracts impacted the expression of specific genes related to CRC, namely CASPS9, 5-LOX, Bcl2, Bcl-xL, and COX-2. The results demonstrated that the AS extracts, when applied to CRC cell lines, effectively upregulated CASPS9 expression, promoting apoptosis in a dose-dependent manner. Simultaneously, the extracts downregulated the expressions of 5-LOX, Bcl2, and Bcl-xL, crucial in curbing cancer progression. The study suggests that using AS extracts and methanol as an extraction solvent could be beneficial in managing CRC. Furthermore, the researchers recommend exploring the specific metabolites in AS involved in these pathways to better understand how they impede the development and spread of CRC. This research provides promising insights into potential natural treatments for colorectal cancer, offering hope for improved therapies in the future.

Abstract

Colon tumors have a very complicated and poorly understood pathogenesis. Plant-based organic compounds might provide a novel source for cancer treatment with a sufficient novel mode of action. The objective of this study was to analyze and evaluate the efficacy of Aloe secundiflora’s (AS) methanolic extracts on the expression of CASPS9, 5-LOX, Bcl2, Bcl-xL, and COX-2 in colorectal cancer (CRC) management. Caco-2 cell lines were used in the experimental study. In the serial exhaustive extraction (SEE) method, methanol was utilized as the extraction solvent. Upon treatment of CASPS9 with the methanolic extracts, the expression of the genes was progressively upregulated, thus, dose-dependently increasing the rate of apoptosis. On the other hand, the expressions of 5-LOX, Bcl2, and Bcl-xL were variably downregulated in a dose-dependent manner. This is a unique novel study that evaluated the effects of AS methanolic extracts in vitro on CRC cell lines using different dosage concentrations. We, therefore, recommend the utilization of AS and the application of methanol as the extraction solvent of choice for maximum modulatory benefits in CRC management. In addition, we suggest research on the specific metabolites in AS involved in the modulatory pathways that suppress the development of CRC and potential metastases.

1. Introduction

1.1. Background Information on Colon Cancer and Prevention Approaches

In the developed world, colon cancer is currently the third leading cause of cancer-related fatalities [1]. In general, cancer is the second leading cause of death, behind cardiovascular disorders [2]. The pathophysiology of colon tumors is very complex and poorly understood. On the other hand, the process of its onset has been linked to the interactions between risk factors such as lifestyle, inheritance, and environmental factors, among other identified causes [3,4]. Understanding the processes that swiftly proliferating malignant cells utilize to regulate their metabolism can help scientists create more effective cancer treatments [5].
To investigate and identify efficient bioactive compounds that can destroy malignant cells without harming or killing healthy cells has a huge impact in human medicine [6]. Due to this, management utilizing plant-based dietary supplements is beginning to receive attention as the most efficient way to lower the burden of colon-cancer-associated mortality [7]. Organic components found in plants may offer a fresh source for cancer treatment with a sufficiently revolutionary method of action [8]. Plant extracts have been shown to exhibit astounding therapeutic activities to treat a variety of infectious diseases, in contrast to synthetic pharmaceuticals, which are frequently observed as being associated with serious drawbacks [9].
Because of Africa’s diversity and abundance of aloe species, these plants are commonly used as a source of phytotherapeutic medication to improve human health and welfare. There are 500 species of Aloe L. (Asphodeloideae), a genus of flowering succulents that includes trees, shrubs, and perennials [10]. The largest genus in the Asphodelaceae family, Aloe, has over 400 species that range in size from tiny shrubs to enormous trees and are distributed throughout dry regions of Africa, India, and other places [11]. In South Africa, there is the greatest variety of Aloe. The two primary ingredients are Aloe exudates and Aloe leaf gel. Exudates come from the inner epidermal layers, while parenchymatous cells are the source of the gel. The exudates are primarily a combination of phenolic chemicals, whereas the gel is primarily composed of polysaccharides [12]. In nations such as Ethiopia, Sudan, Kenya, and Tanzania, wide grasslands and bushlands are home to numerous AS (Asphodelaceae) bushes. Aloe engleri, Aloe marsabitensis, and Aloe floramaculata are all synonyms of AS [12]. In our previous research [10], we postulated the potential effects of A. secundiflora’s active metabolites in colorectal cancer management. In the current study, we substantiate the claims postulated using specific genes present in human cells.

1.2. Phytoconstituent Biomolecules Present in A. secundiflora

Studies on the phytochemical and pharmacological activities of Aloe species have led to the discovery of various active compounds. In past decades, herbalists have used them to treat a range of diseases [11]. Most of the biologically active substances found in Aloe originate as anthraquinones naturally [13], as we have previously reported [10]. Terpenes, flavonoids, and tannins have been identified in the leaves (Table 1), according to preliminary phytochemical analysis [14], while naphthoquinones have been identified in the roots [15]. Anthraquinones, which are structurally related to anthracene [16], are primarily composed of Anthracenedione (9,10-anthracenedione). They are sometimes referred to as 9,10-dioxoanthracene. Anthraquinones typically occur in their glycosidic state [10]. These elements constitute the pigmentation that gives plants their hue, and they are commonly employed as natural dyes [16]. Aloin (AL) is employed in pharmacotherapy for a variety of purposes, one of which is as a laxative [17]. In both in vivo and in vitro experimental settings, AL was shown to be beneficial in lowering tumor angiogenesis and development by blocking STAT3 activation in CRC cells [18].
In the current study, we demonstrate the activity of AS in regulating the expression of CASPS9, 5-LOX, Bcl2, Bcl-xL, and COX-2 genes associated with colon carcinogenesis. In addition, HPRT1 was employed as a housing keeping gene for internal control. CASPS9, the primary enzyme in the mitochondrial caspase pathway, plays a critical role in mediating apoptosis control [22,23]. The relationship between CASPS9 and CRC is currently undetermined in a tangible and substantial manner. Its correlation with clinicopathological characteristics and longevity may provide insightful data that can be used to estimate survival and choose additional treatment options [24]. While the exact sequence of events relating cancer development to 5-LOX gene expression is equally unknown, it is clear that 5-LOX expression is occasionally increased during neoplastic transformation [25]. LOX inhibitors decrease cancer cell proliferation in both in vivo and in vitro experiments and cause death through mitochondrial induction [26,27]. Targeted modulatory strategies call for knowledge of CASPS9, 5-LOX, Bcl2, Bcl-xL, and COX-2 for effective CRC medical intervention. This is a unique novel study that evaluated the effects of AS methanolic extracts in vitro on CRC cell lines at different dosage/concentration levels. We do, however, support additional research into the specific AS metabolites implicated in the modulatory pathways that prevent the growth of CRC and potential metastases.

2. Materials and Methods

2.1. Colorectal Cancer Cell Lines (Caco-2 Cell Lines)

The Caco-2 cell lines were purchased from American Type Culture Collection (ATCC) and directly delivered to our laboratory (Department of Public Health) by the University of Pecs’ Department of Biochemistry and Medical Chemistry. This type of cell line is ideally suited to be employed in studies on cancer and cytotoxicity and serves as a superb transfection carrier. In conformance with the supplier’s guidelines, the Caco-2 cell lines were preserved until use [28].

2.2. Plant Extract Extraction Using Methanol and Region of Acquisition

Shade-dried leaves were pulverized into a fine powder. Methanol was used in the serial exhaustive extraction (SEE). One thousand grams of AS plant organs were placed in a flask and extracted for 3 days with methanol with frequent shaking to adequately extract phytoconstituents. The crude solvent extracts were dechlorophyllated after being filtered via Whatman filter paper with varying pore diameters (Nos. 4 and 1). This technique was performed three times until all soluble elements were extracted completely [29]. The filtrate was concentrated using a rotavapor apparatus paired to a vacuum pump, a condenser apparatus to recover the solvent, and a round-bottomed flask at a temperature of 50 °C. In order to allow the samples to air dry, the concentrated solution was placed in small glass universal bottles and covered with perforated aluminum foil [12]. The dried solvent-free metabolites were stored in tightly sealed sample bottles with parafilm tape in a desiccator at 4 °C in a fridge until use [30]. The identified plant organs were collected from Kampi ya Moto in Rongai constituency, Nakuru County, Kenya and located at 0.1244° S, 35.9431° E, GPS coordinates. The annual temperature in the district is 18.75 °C (65.75 °F), which is −3.75% lower than the national average for Kenya. Furthermore, 118.62 mm (4.67 inches) of precipitation and 221.53 days of rain are typical yearly totals for Kampi Ya Moto.

2.3. Dissipation of Plant Extracts in DMSO

Dimethyl sulfoxide (DMSO) is a multipurpose solvent that is used in toxicology and pharmacology to improve medication delivery, dissolve various pharmaceuticals, and dissolve plant extracts [31]. It served as a suspending medium for water-insoluble crude plant extracts, as well as an inert diluent. A stock solution of 30 mg/mL was created using 0.5% DMSO and double-distilled phosphate buffer saline (ddPBS) as the dissolving and diluent solvents. The final Caco-2 cell line concentrations of 2 mg/mL, 1 mg/mL, and 0.5 mg/mL were then made using the stock solution.

2.4. Passaging Caco-2 Cell Lines for Bioassays

The lamina hood, which was kept sterile, was carefully placed over the petri dish or flask holding the Caco-2 cells. The utilized medium was sucked out after the dish or flask was opened. PBS was used twice to wash it. After pouring PBS-EDTA over the area, it was set aside for a while. It was then cautiously and softly sucked. To separate and detach the Caco-2 cells from clumps and the surface, respectively, 2 mL of trypsin was applied. Trypsin was applied to the surface by gently swiping the dish side to side across it. For five minutes, the dish was placed in the thermostat. The dish was removed after 5 min, and following a successful visible detachment, the Caco-2 medium was carefully added to it. The Caco-2 cells are adherent and have a propensity to stick to surfaces. The dish’s whole contents were sucked into a tube and centrifuged for five minutes at 125 rpm. The Caco-2 cells stayed at the tube’s bottom as the supernatant was sucked away. A pipette was used to gently disrupt the cells by sucking up and down while adding fresh media into the tube. The suspension was divided into fresh dishes, the medium was added, and the thermostat for growth was then turned on. The confluence was watched until it reached 70–80% so that it could be treated.

2.5. Exposure of Caco-2 Cell Lines to Solvent Extracts

Various quantities of the extract solutions (0.5 mg/mL, 1 mg/mL, and 2 mg/mL) were applied to 200 μL of passed Caco-2 cell lines that were refilled with new Caco-2 medium. Following that, the treated cells were incubated at 37 °C for 36 h. The condition of the cells was examined under a light microscope following the incubation period. The typical cell-doubling time of cancer cell lines, which is between 36 and 48 h, was used for the estimation of the duration of the exposure (36 h). Treatments were administered to the cells at concentrations ranging from 0.5 mg/mL at the lowest point to 2 mg/mL at the highest point to test the cells’ dose and time responsiveness. This allowed us to identify and analyze the pharmacological modulatory effects of the treatments with the greatest accuracy. The growth and potential biological impacts of exposure were assessed every 12 h.

2.6. Isolation of RNA

The media was removed from the cell cultures, trypsin-EDTA was applied, and they were then washed twice with PBS. After centrifuging, the cell suspension was pipetted into a 4 cm3 centrifuge tube. ExtraZol Tri-reagent solution diluted to 1 cm3 was added and allowed to sit at room temperature for 5 min. Chloroform 0.2 cm3 was added. The sample was centrifuged at 12,000× g for 10 min at 2–8 °C after a 2–3 min incubation period. A clean tube was used to transfer the aqueous phase. Isopropyl alcohol (0.2 cm3) was added. The sample was centrifuged once more at 12,000× g for 10 min at 2–8 °C after being incubated for 10 min.
The RNA precipitate is frequently invisible prior to centrifugation but produces a gel-like pellet at the tube’s bottom following centrifugation. The supernatant was removed before washing the RNA pellet with 1 cm3 of 75% alcohol. The pellet was then centrifuged at 7500× g for 5 min at 2–8 °C after vortexing. The pellet was dried after the supernatant was drained off. It was then dissolved in 50–100 L of DEPC water, which is RN-ase free. After being vortexed, the sample was incubated for 10 min at 55 °C. Before usage, the isolated total RNA was kept at −80 °C.

2.7. Protocol and Equipment Used for qRT-PCR (SYBR Green Protocol)

Nucleic acid quantification is sensitive, specific, and repeatable with real-time quantitative PCR. According to the manufacturer’s instructions, one-step PCR was carried out using the One-Step Detect SyGreen Lo-ROX one-step RT-PCR kit (Nucleotest Bio Ltd. PB25.11–12) on a 96-well plate using a LightCycler 480 qPCR platform. The thermal program was set up as follows: 45 cycles of 95 °C for 5 s, 56 °C for 15 s, and 72 °C for 5 s, with a fluorescence readout being obtained at the conclusion of each cycle. The sample was incubated at 42 °C for 5 min, followed by incubation at 95 °C for 3 min. A melting curve analysis (95 °C—5 s, 65 °C—60 s, 97 °C) was performed after each run to validate amplification specificity. The reaction mixture was as follows: 10 l Master Mix, 0.4 l RT Mix, 0.4 l dUTP, 0.4 l primers, and 5 l mRNA template added to a total volume of 20 l of sterile double-distilled water. Integrated DNA Technologies (Bio-Sciences) created the primers, and Primer Express™ Software v3.0.1 was used to create the sequences (Table 2).

2.8. qRT-PCR Result Analysis

The Cp numbers used to express the PCR findings represent the intersection of the amplification curve and the threshold value. Using the 2-Cp (Livak method) and the Cp values, the fold changes of the target genes from the control sample were calculated [32].

2.9. Data Analysis

IBM SPSS 26.0 (IBM Corp. Released 2019. IBM SPSS Statistics for Windows, Version 26.0. Armonk, NY, USA: IBM Corp) and MS Excel (Microsoft Corp., released in 2013, Redmond, WA, USA) were used to calculate the statistical analysis. IBM SPSS Statistics for Windows, version 26.0.3. From the collected data, the normality analysis was conducted using the Kolmogorov–Smirnov test, and the means of the relevant variables were then compared using the ANOVA test. If the results were significant at the 95% confidence level, the p value was p ≤ 0.05.

3. Results

3.1. Upregulatory Effects of AS Extracts on CASPS9 Expression

When the CASPS9 genes were treated with AS’s leaf extracts, apoptosis was observed to gradually occur upon exposure. Of interest, the increased optimal activity of apoptotic expressions was observed at a dosage concentration of 1 mg/mL. However, the apoptotic activity diminished and was at minimum in a concentration of 2 mg/mL. Observably, the expressions of CASPS9 were progressively upregulated in a dose-dependent manner on exposure to the treatment extracts. In addition, the effects were statistically significant (p < 0.001), (Figure 1, Table 3 and Table 4).

3.2. Downregulatory Effects of AS Extracts on 5-LOX Expression

After the 5-LOX genes were treated with AS extract, a characteristic decrease in expression was gradually observed across the varying concentrations of exposure. An optimal mechanism of action resulting in a high decrease in expression was seen to occur at a concentration of 0.5 mg/mL. While the mechanism of action steadily increased at a dose of 2 mg/mL, very little transcriptional activity was seen at a concentration of 1 mg/mL. It is appropriate to state that the downregulatory effects in this investigation were dose dependent. The analysis yielded statistically significant findings (Figure 2, Table 3 and Table 4).

3.3. Downregulatory Effects of AS Extracts on Bcl2 Expressions

In all treatment concentrations, the decreased expression of Bcl2 was observed to be dose-dependent. Even though the statistical output was not statistically significant (p = 0.235), the extract treatments exhibited significant downregulatory effects required to stimulate inhibitory cellular growth effects, as shown in Figure 3, Table 3 and Table 4.

3.4. Downregulatory Effects of AS Extracts on Bcl-xL Gene Expressions

The downregulatory effects were progressively dose-dependent with optimal activities observed at 0.50 mg/mL (Figure 4). The treatments exhibited significant modulatory and beneficial properties as required to stimulate downregulation. The downregulatory effects were sufficient to elicit beneficial inhibitive properties (Table 3 and Table 4).

3.5. Downregulatory Effects of AS Extracts on COX-2 Expression at High Concentrations

When the Caco-2 cell lines were treated with methanolic leaf extracts, the COX-2 genes were modulated variably with an increasing dosage across the concentration gradients. Notably, at a low concentration, the extract products stimulated upregulation of COX-2 genome expression. However, downregulatory effects were observed at high concentrations (2.0 mg/mL), indicating potential optimal benefits at a high dosage concentration, as exhibited in (Figure 5). In summary, the concentration of AS extract treatment poses a direct impact on molecular activities, resulting in relative changes in gene expression (Figure 6, Table 3 and Table 4).

4. Discussion

4.1. Phytotherapeutic Effects of AS Leaf Extracts on CASPS9 Expression

An essential mediator in the regulation of apoptosis is CASPS9, the starter of the mitochondrial caspase cascade. These enzymes (Caspases) are a component of a cascade that is triggered by pro-apoptotic cues and causes the fragmentation of cells, as well as the dissociation of many peptides. For the aim of medical treatment, it is essential to selectively modulate apoptosis [22,23]. In a variety of biological events, apoptosis is a crucial physiological process that involves the selective elimination of cells [33]. According to some of the research, inhibiting spontaneous apoptosis raises the risk of developing cancer [34,35]. Similarly, it has been noted that a lower rate of apoptosis is strongly associated with a higher frequency of colorectal adenoma [36]. Aloin was shown to significantly decrease tumor sizes and weight in mice xenografts while inducing apoptosis and lowering tumor cell viability in vitro [18]. It was demonstrated that natural plant-based constituents found in AS, such as flavonoids [37], terpenoids, tannins [38], and saponins [39,40,41], can cause and enhance apoptosis via a caspase-dependent cascade. In addition to their powerful anti-inflammatory, anti-tumor, anti-mutagenic, and antioxidant characteristics, flavonoids also have the capacity to regulate key cellular enzyme functions [42]. The findings of this study showed that methanolic extracts demonstrated high efficacy with significant activity in the upregulation of CASPS9 in a dose-dependent manner. The increased upregulation of CASPS9 resulted in decreased tumor development and, thus, an important breakthrough in CRC growth inhibition. The capacity to cause apoptosis in gastrointestinal epithelial cells is one potential chemo-prevention technique [35]. Cancer incidence has been postulated to increase when spontaneous apoptosis is suppressed [34,35]. Similar findings have been made regarding the relationship between colorectal adenoma prevalence and apoptosis [36]. One of the prospective chemoprevention techniques is the ability to cause apoptosis in epithelial cells with gastrointestinal origin [35]. For this reason, a promising direction for colorectal cancer research is the study of the apoptotic process. Therefore, the level of expression of the apoptosis-associated CASPS9 genes may be helpful in predicting the prognosis for people with stage II colorectal cancer. From our findings, methanol is, thus, highly recommended for use as an efficient extraction solvent for bioactive ingredients in AS with demonstrated upregulatory effects of CASPS9 in CRC treatment. Of great significance, the dose-dependent variation of these genes under the influence of AS leaf extracts has not been investigated in the previous literature. Thus, highlighting the importance of this research, which evaluates and documents the activity of A. secundiflora’s active metabolites in modulation of the CRC CASPS9 genes responsible for programmed cell death (apoptosis), for deployment in CRC treatment.

4.2. Phytotherapeutic Effects of AS Leaf Extracts on 5-LOX Expression

Inhibiting the expression of 5-LOX, which is upregulated in colorectal cancer, could be helpful in both the prevention and therapy of the disease [43]. It has been demonstrated that when arachidonic acid, a polyunsaturated fatty acid, is metabolized by either the COX pathway or the LOX mechanism, eicosanoids such as prostaglandins, thromboxanes, and leukotrienes, among others, operate as potent autocrine and paracrine regulators of cell biology. Only a few of the physiological and pathological responses that these compounds are known to alter include the growth and invasiveness of tumor cells, as well as the suppression of immune surveillance [44]. Targeting arachidonic acid pathways may be useful in delaying the progression of CRC and other types of malignancies, since LOXs enzymes produce metabolites in the arachidonic acid pathway that seem to promote carcinogenesis.
The results of this study demonstrated that downregulatory properties were observed to occur in a dose-dependent manner, with the expressions of 5-LOX being suppressed with increasing concentration. Although prostaglandins (PGs) and other COX-derived metabolites have received most of the attention, the new research indicates that leukotrienes (LTs) and hydroxyeicosatetraenoic acids (HETEs), two products catalyzed by LOX enzymes, also have a significant biological impact on the initiation and progression of human cancers. In several human cancer cell lines and tissues, including those of the colon [43,45,46], an increase in the expression of 5-LOX and their metabolites has been found. This over-expression was reported to be significantly linked to tumor cell proliferation, resistance to apoptosis, and angiogenesis [47,48]. Additionally, it was discovered that the direct suppression of 5-LOX or 12-LOX significantly reduced the development of tumor cells [44,47,48,49].
Our most important finding was the substantial correlation between extract dose concentration and 5-LOX expression level. This finding is consistent with other research, which showed that gastric or colorectal [47] tumors with higher 5-LOX and COX-2 levels grew deeper and larger. Additionally, it lends credence to the idea that 5-LOX and COX-2 share features of expression and function that are proangiogenic and anti-apoptotic [50] as well as substrate preference in human cancer. Like COX-2 and PGs, 5-LOX enzymes and their products may operate on tumor cells by inhibiting apoptosis, increasing cell proliferation, and stimulating angiogenesis, according to a number of experimental investigations [48,50]. The degree of 5-LOX expression and LTB4 synthesis in cancer cell lines was recently found to be correlated with the dose- and time-dependent reduction in cell viability and induction of apoptosis caused by 5-LOX inhibitors [48]. A key mechanism of 5-LOX activities on proliferation and apoptosis was the release of endothelial growth factor (VEGF) and mRNA levels by 5-LOX activity in malignant mesothelial cells [48].
The abundance of biomolecules found in AS, as we have previously described [10], suggests the value of using this plant as a potential anti-CRC agent with the assurance of phytotherapeutic effects. The overwhelming evidence is in congruent support of our findings with regards to the benefits of suppressing the expression of 5-LOX. A. secundiflora (AS) is a promising phytotherapeutic plant, and based on our thorough research, this is among the first studies to assess the levels of expression and clinicopathologic significance of the 5-LOX gene on human CRC using AS. AS leaf extracts are, therefore, unreservedly perfect natural 5-LOX inhibitors whose exploitation for therapy is of paramount importance in CRC management. Thus, our findings imply that 5-LOX overexpression may have a significant impact on the emergence of CRC. Therefore, blocking this metabolic pathway might be a timely and useful therapeutic strategy for both the prevention and treatment of CRC.

4.3. Phytotherapeutic Effects of AS Leaf Extracts on Bcl2 and Bcl-xL Expression

The best-defined protein family involved in the regulation of apoptotic cell death is the Bcl-2 protein family, which comprises members that are both anti- and pro-apoptotic. The anti-apoptotic members of this family include, among others, Bcl2 and Bcl-xL. In the present study, it was exclusively demonstrated that in all treatments, the downregulatory effects of the extracts on Bcl-xL and Bcl2 were progressively influenced dose-dependently. All of the extract treatments exhibited significant downregulatory and beneficial properties as required to stimulate inhibitory properties on genome expression. Other investigators have also asserted that aloin is effective in lowering tumor angiogenesis and growth by blocking STAT3 activation in CRC cells, which, in turn, controls the expression of the antiapoptotic protein Bcl-xL gene [18].
One of the latent self-signaling transcription factors in the cytoplasm is STAT3 (e.g., VEGF), which is activated by cytokines (such as IL-6) and progenitor cells. The stimulation of STAT3 homodimerization and nuclear translocation modulates the transcription of responsive genes encoding apoptotic-cell-death inhibitors (e.g., Bcl-xL, Bcl2) and inducers of angiogenesis (e.g., VEGF) [51]. These genes play roles in human defense evasion, angiogenesis, metastatic spread, cell survival, differentiation, and programmed cell death [52]. In recent years, there has been an abundance of research demonstrating that blocking constitutive STAT3 signaling substantially inhibits tumor development and triggers apoptosis [51,53]. By downregulating the biosynthesis of Bcl2 and Bcl-xL through the p53 signaling pathway, a notable apoptotic target in many cancer types, flavonoids diminish a significant dysregulated pathway in cancer [54]. Therefore, it is crucial to realize that Bcl2 and Bcl-xL suppression causes advantageous apoptotic effects, which subsequently reduce CRC cancer growth. Pharmacological manipulation of the Bcl-2 family activities will be limited until a deeper scientific knowledge of how Bcl-2 family proteins control apoptosis in cells is established [55]. This is, therefore, the first study that has successfully evaluated the downregulatory effects of A. secundiflora’s extracts on the expression of Bcl2 and Bcl-xL in colorectal cancer cell lines. In line with these fundamental findings, the methanolic leaf extracts of AS are recommended for considerable deployment for further in vivo and subsequent clinical trials for therapeutic management of CRC in humans, with substantial beneficial effects postulated.

4.4. Phytotherapeutic Effects of AS Leaf Extracts on COX-2 Expression

With regards to COX-2 expression, cancer risk is increased by persistent inflammation [56], while strong induction of COX-2 occurs during inflammation. This study demonstrates that downregulatory effects were quite minimal across all doses applied but sufficient to elicit beneficial properties. Of significance to note is that one of the crucial enzymes involved in the manufacture of prostaglandins, which is linked to inflammatory processes, is the COX-2 enzyme. Relief from these inflammatory conditions may result from inhibition of the COX-2 enzyme, and consequently, of the prostaglandin biosynthetic pathway [57]. Tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) expression are all downregulated by aloin (highly abundant in the Aloe species), which has been shown to suppress lipopolysaccharide-induced pro-inflammatory cytokine secretion and nitric oxide production [58]. Phenols such as anthrones that are also abundant in AS were reported to strongly inhibit the expression of COX-2 [59]. Aloin and aloe-emodin are said to limit the expression of iNOS and COX-2 mRNA, hence, reducing inflammatory responses. The authors further assert that aloe-emodin may be a crucial component behind aloe’s anti-inflammatory properties [60]. The phenolic components of the methanolic extract may have contributed to the downregulatory effects of the extracts. Therefore, it was presupposed that the radical scavenging capabilities of naphthalene analogs and the inhibition of COX-2 by anthraquinones and naphthalene derivatives were the mechanisms by which the inhibitory properties were mediated. Remarkably, this is one of the first studies that has demonstrated an explicit link between AS leaf extracts and COX-2 downregulation in CRC cell lines, with prospective application for CRC management.

5. Conclusions

In this remarkable study, CRC cell lines were exposed to various AS methanolic extract doses in vitro. In our investigation, AS’s leaf extracts were arduously proven and listed as being incredibly effective at modulating the activities of CASPS9, 5-LOX, Bcl2, Bcl-xL, and COX-2 genes for pharmacotherapeutic beneficial effects. Methanol was also demonstrated to be a promising extraction solvent for the effective metabolites responsible for the modulatory properties discussed in our study. Given the copious amounts of phytoconstituent biomolecules present in AS, it is beneficial to use the plant as a prospective CRC inhibiting agent with potent phytotherapeutic benefits. To treat CRC, targeted apoptotic modulation necessitates an understanding of genome programming. The regulatory effects exhibited in this research establish AS as an important plant of choice, one whose extracts have demonstrated significant CRC inhibitory properties. This is one of the initial studies that explicitly hyperlinks the positive effects of AS leaf extracts on the targeted genes in our study for potential applications for therapeutic management of CRC. We, therefore, strongly recommend the utilization of AS for further in vivo and subsequent clinical trials for CRC management. In addition, we suggest the application of methanol as a promising AS extraction solvent for maximum regulatory benefits towards CASPS9, 5-LOX, Bcl2, Bcl-xL, and COX-2 expression. Finally, we also encourage further investigation into the particular AS metabolites involved in the modulatory pathways that inhibit the development of CRC, as well as potential metastases.

Author Contributions

Conceptualization, J.M.M.; data curation, R.W.M. and Z.K.; formal analysis, J.M.M., N.R. and M.P.; funding acquisition, J.M.M. and B.L.R.; investigation, R.W.M., I.N.W. and Z.K.; methodology, J.M.M., T.V. and M.P.; project administration, B.L.R.; supervision, Z.K. and B.L.R.; validation, N.R., I.N.W. and B.L.R.; visualization, T.V., R.W.M., I.N.W. and M.P.; writing—original draft, J.M.M., T.V. and M.P.; writing—review and editing, T.V., Z.K., N.R. and B.L.R. All authors have read and agreed to the published version of the manuscript.

Funding

Our work was funded by the Tempus Public Foundation, through the Doctoral School of Health Sciences, University of Pecs. In addition, the APC was fully paid by the University of Pẻcs.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

We express our gratitude to Stipendium Hungaricum Programme/Tempus Public Foundation for the study and research grant awarded to John M. Macharia, Doctoral School of Health Sciences, University of Pecs, Hungary. We are also grateful to Ruth W. Mwangi, Hungarian University of Agriculture and Life Sciences, Institute of Horticultural Sciences, Budapest, Hungary for collection and identification of the plant species.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Arnold, C.N.; Goel, A.; Blum, H.E.; Boland, C.R. Molecular pathogenesis of colorectal cancer: Implications for molecular diagnosis. Cancer 2005, 104, 2035–2047. [Google Scholar] [CrossRef] [PubMed]
  2. Halder, S.; Modak, P.; Sarkar, B.K.; Das, A.; Sarkar, A.P.; Chowdhury, A.R.; Kundu, S.K. Traditionally Used Medicinal Plants with Anticancer Effect: A Review. Int. J. Pharm. Sci. Rev. Res. 2020, 65, 1–13. [Google Scholar] [CrossRef]
  3. Colussi, D.; Brandi, G.; Bazzoli, F.; Ricciardiello, L. Molecular Pathways Involved in Colorectal Cancer: Implications for Disease Behavior and Prevention. Int. J. Mol. Sci. 2013, 14, 16365–16385. [Google Scholar] [CrossRef]
  4. Carvalho, C.; Marinho, A.; Leal, B.; Bettencourt, A.; Boleixa, D.; Almeida, I.; Farinha, F.; Costa, P.P.; Vasconcelos, C.; Silva, B.M. Association between vitamin D receptor (VDR) gene polymorphisms and systemic lupus erythematosus in Portuguese patients. Lupus 2015, 24, 846–853. [Google Scholar] [CrossRef] [PubMed]
  5. Macharia, J.M.; Kaposztas, Z.; Varjas, T.; Budán, F.; Zand, A.; Bodnar, I.; Bence, R.L. Targeted lactate dehydrogenase genes silencing in probiotic lactic acid bacteria: A possible paradigm shift in colorectal cancer treatment? Biomed. Pharmacother. 2023, 160, 114371. [Google Scholar] [CrossRef] [PubMed]
  6. Hashemzaei, M.; Delarami Far, A.; Yari, A.; Heravi, R.E.; Tabrizian, K.; Taghdisi, S.M.; Sadegh, S.E.; Tsarouhas, K.; Kouretas, D.; Tzanakakis, G.; et al. Anticancer and apoptosis-inducing effects of quercetin in vitro and in vivo. Oncol. Rep. 2017, 38, 819–828. [Google Scholar] [CrossRef] [PubMed]
  7. Macharia, J.M.; Mwangi, R.W.; Rozmann, N.; Zsolt, K.; Varjas, T.; Uchechukwu, P.O.; Wagara, I.N.; Raposa, B.L. Medicinal plants with anti-colorectal cancer bioactive compounds: Potential game-changers in colorectal cancer management. Biomed. Pharmacother. 2022, 153, 113383. [Google Scholar] [CrossRef]
  8. Macharia, J.M.; Káposztás, Z.; Bence, R.L. Medicinal Characteristics of Withania somnifera L. in Colorectal Cancer Management. Pharmaceuticals 2023, 16, 915. [Google Scholar] [CrossRef]
  9. Kaur, R.; Kaur, H. The Antimicrobial activity of essential oil and plant extracts of Woodfordia fruticosa. Arch. Appl. Sci. Res. 2011, 2, 373–383. [Google Scholar]
  10. Macharia, J.M.; Ngure, V.; Emődy, B.; Király, B.; Káposztás, Z.; Rozmann, N.; Erdélyi, A.; Raposa, B. Pharmacotherapeutic Potential of Aloe secundiflora against Colorectal Cancer Growth and Proliferation. Pharmaceutics 2023, 15, 1558. [Google Scholar] [CrossRef]
  11. Diriba, T.F.; Deresa, E.M. Botanical description, ethnomedicinal uses, phytochemistry, and pharmacological activities of genus Kniphofia and Aloe: A review. Arab. J. Chem. 2022, 15, 104111. [Google Scholar] [CrossRef]
  12. Kaingu, F.; Kibor, A.; Waihenya, R.; Shivairo, R.; Mungai, L. Efficacy of Aloe secundiflora Crude Extracts on Ascaridia galli in Vitro. Sustain. Agric. Res. 2012, 2, 49. [Google Scholar] [CrossRef]
  13. Puia, A.; Puia, C.; Moiș, E.; Graur, F.; Fetti, A.; Florea, M. The phytochemical constituents and therapeutic uses of genus Aloe: A review. Not. Bot. Horti Agrobot. Cluj-Napoca 2021, 49, 12332. [Google Scholar] [CrossRef]
  14. Okemo, P.; Kirimuhuzya, C.; Otieno, J.N.; Magadula, J.J.; Mariita, R.M.; Orodho, J. Methanolic extracts of Aloe secundiflora Engl. inhibits in vitro growth of tuberculosis and diarrhea-causing bacteria. Pharmacogn. Res. 2011, 3, 95–99. [Google Scholar] [CrossRef] [PubMed]
  15. Induli, M.; Cheloti, M.; Wasuna, A.; Wekesa, I.; Wanjohi, J.M.; Byamukama, R.; Heydenrich, M.; Makayoto, M.; Yenesew, A. Naphthoquinones from the roots of Aloe secundiflora. Phytochem. Lett. 2012, 5, 506–509. [Google Scholar] [CrossRef]
  16. Simpson, D.; Amos, S. Other Plant Metabolites. Pharmacognosy 2017, 267–280. [Google Scholar] [CrossRef]
  17. Patel, K.; Patel, D.K. Medicinal importance, pharmacological activities, and analytical aspects of aloin: A concise report. J. Acute Dis. 2013, 2, 262–269. [Google Scholar] [CrossRef]
  18. Pan, Q.; Pan, H.; Lou, H.; Xu, Y.; Tian, L. Inhibition of the angiogenesis and growth of Aloin in human colorectal cancer in vitro and in vivo. Cancer Cell Int. 2013, 13, 1–9. [Google Scholar] [CrossRef]
  19. Cardarelli, M.; Rouphael, Y.; Pellizzoni, M.; Colla, G.; Lucini, L. Profile of bioactive secondary metabolites and antioxidant capacity of leaf exudates from eighteen Aloe species. Ind. Crop. Prod. 2017, 108, 44–51. [Google Scholar] [CrossRef]
  20. Rachuonyo, H.O.; Ogola, P.E.; Arika, W.M.; Wambani, J.R. Efficacy of Crude Leaf Extracts of Aloe secundiflora on Selected Enteric Bacterial Pathogens and Candida albicans. J. Antimicrob. Agents 2016, 2, 2. [Google Scholar] [CrossRef]
  21. Waithaka, P.N.; Gathuru, E.M.; Githaiga, B.M.; Kazungu, R.Z. Antimicrobial Properties of Aloe vera, Aloe volkensii and Aloe secundiflora from Egerton University. Acta Sci. Microbiol. 2018, 1, 6–10. [Google Scholar]
  22. Thornberry, N.A.; Lazebnik, Y. Caspases: Enemies within. Science 1998, 281, 1312–1316. [Google Scholar] [CrossRef] [PubMed]
  23. Raff, M. Cell suicide for beginners. Nature 1998, 396, 119–122. [Google Scholar] [CrossRef] [PubMed]
  24. Prabhu, A. Anti-angiogenic, apoptotic and matrix metalloproteinase inhibitory activity of Withania somnifera (ashwagandha) on lung adenocarcinoma cells. Phytomedicine 2021, 90, 153639. [Google Scholar] [CrossRef] [PubMed]
  25. Ye, Y.N.; Wu, W.K.K.; Shin, V.Y.; Bruce, I.C.; Wong, B.C.Y.; Cho, C.H. Dual inhibition of 5-LOX and COX-2 suppresses colon cancer formation promoted by cigarette smoke. Carcinogenesis 2005, 26, 827–834. [Google Scholar] [CrossRef] [PubMed]
  26. Ding, X.; Zhu, C.; Qiang, H.; Zhou, X.; Zhou, G. Enhancing antitumor effects in pancreatic cancer cells by combined use of COX-2 and 5-LOX inhibitors. Biomed. Pharmacother. 2011, 65, 486–490. [Google Scholar] [CrossRef]
  27. Rådmark, O.; Shimizu, T.; Jörnvall, H.; Samuelsson, B. Leukotriene A4 hydrolase in human leukocytes. Purification and properties. J. Biol. Chem. 1984, 259, 12339–12345. [Google Scholar] [CrossRef]
  28. American Type Culture Collection. Caco-2 [Caco2]—HTB-37|ATCC 2022. Available online: https://www.atcc.org/products/htb-37 (accessed on 17 May 2023).
  29. Nelson, V.K.; Sahoo, N.K.; Sahu, M.; Sudhan, H.H.; Pullaiah, C.P.; Muralikrishna, K.S. In vitro anticancer activity of Eclipta alba whole plant extract on colon cancer cell HCT-116. BMC Complement. Med. Ther. 2020, 20, 1–8. [Google Scholar] [CrossRef]
  30. Saravanakumar, D.S.D.; Karthiba, L.K.L.; Ramjegathesh, R.R.R.; Prabakar, K.P.K.; Raguchander, T.R.T. Characterization of Bioactive Compounds from Botanicals for the Management of Plant Diseases. In Sustainable Crop Disease Management Using Natural Products; CABI: Wallingford, UK, 2015; pp. 1–18. [Google Scholar] [CrossRef]
  31. Sangweni, N.F.; Dludla, P.V.; Chellan, N.; Mabasa, L.; Sharma, J.R.; Johnson, R. The Implication of Low Dose Dimethyl Sulfoxide on Mitochondrial Function and Oxidative Damage in Cultured Cardiac and Cancer Cells. Molecules 2021, 26, 7305. [Google Scholar] [CrossRef]
  32. Doak, S.H.; Zaïr, Z.M. Real-Time Reverse-Transcription Polymerase Chain Reaction: Technical Considerations for Gene Expression Analysis. Methods Mol. Biol. 2012, 817, 251–270. [Google Scholar] [CrossRef]
  33. Morimoto, Y.; Takada, K.; Takeuchi, O.; Watanabe, K.; Hirohara, M.; Hamamoto, T.; Masuda, Y. Bcl-2/Bcl-xL inhibitor navitoclax increases the antitumor effect of Chk1 inhibitor prexasertib by inducing apoptosis in pancreatic cancer cells via inhibition of Bcl-xL but not Bcl-2. Mol. Cell. Biochem. 2020, 472, 187–198. [Google Scholar] [CrossRef] [PubMed]
  34. Sjöström, J.; Bergh, J. How apoptosis is regulated, and what goes wrong in cancer. BMJ 2001, 322, 1538–1539. [Google Scholar] [CrossRef] [PubMed]
  35. Wong, B.C.Y.; Zhu, G.H.; Lam, S.K. Aspirin induced apoptosis in gastric cancer cells. Biomed. Pharmacother. 1999, 53, 315–318. [Google Scholar] [CrossRef] [PubMed]
  36. Martin, C.; Connelly, A.; Keku, T.O.; Mountcastle, S.B.; Galanko, J.; Woosley, J.T.; Schliebe, B.; Lund, P.; Sandler, R.S. Nonsteroidal anti-inflammatory drugs, apoptosis, and colorectal adenomas. Gastroenterology 2002, 123, 1770–1777. [Google Scholar] [CrossRef]
  37. Yang, H.; Dou, Q.P. Targeting apoptosis pathway with natural terpenoids: Implications for treatment of breast and prostate cancer. Curr. Drug Targets 2010, 11, 733–744. [Google Scholar] [CrossRef]
  38. Larrosa, M.; Tomás-Barberán, F.A.; Espín, J.C. The dietary hydrolysable tannin punicalagin releases ellagic acid that induces apoptosis in human colon adenocarcinoma Caco-2 cells by using the mitochondrial pathway. J. Nutr. Biochem. 2006, 17, 611–625. [Google Scholar] [CrossRef]
  39. Jiang, X.-P.; Jin, S.; Shao, W.; Zhu, L.; Yan, S.; Lu, J. Saponins of Marsdenia Tenacissima promotes apoptosis of hepatocellular carcinoma cells through damaging mitochondria then activating cytochrome C/Caspase-9/Caspase-3 pathway. J. Cancer 2022, 13, 2855–2862. [Google Scholar] [CrossRef]
  40. Elekofehinti, O.O.; Iwaloye, O.; Olawale, F.; Ariyo, E.O. Saponins in Cancer Treatment: Current Progress and Future Prospects. Pathophysiology 2021, 28, 250–272. [Google Scholar] [CrossRef]
  41. Cheng, Y.; He, W.; He, Y. Gleditsia Saponin C Induces A549 Cell Apoptosis via Caspase-Dependent Cascade and Suppresses Tumor Growth on Xenografts Tumor Animal Model. Front. Pharmacol. 2018, 8, 988. [Google Scholar] [CrossRef]
  42. Vetrivel, P.; Kim, S.M.; Saralamma, V.V.G.; Ha, S.E.; Kim, E.H.; Min, T.S.; Kim, G.S. Function of flavonoids on different types of programmed cell death and its mechanism: A review. J. Biomed. Res. 2019, 33, 363–370. [Google Scholar] [CrossRef]
  43. Soumaoro, L.T.; Iida, S.; Uetake, H.; Ishiguro, M.; Takagi, Y.; Higuchi, T.; Yasuno, M.; Enomoto, M.; Sugihara, K. Expression of 5-Lipoxygenase in human colorectal cancer. World J. Gastroenterol. 2006, 12, 6355–6360. [Google Scholar] [CrossRef] [PubMed]
  44. Ghosh, J.; Myers, C.E. Inhibition of arachidonate 5-lipoxygenase triggers massive apoptosis in human prostate cancer cells. Proc. Natl. Acad. Sci. USA 1998, 95, 13182–13187. [Google Scholar] [CrossRef]
  45. Öhd, J.F.; Nielsen, C.K.; Campbell, J.; Landberg, G.; Löfberg, H.; Sjölander, A. Expression of the leukotriene D4 receptor CysLT1, COX-2, and other cell survival factors in colorectal adenocarcinomas. Gastroenterology 2003, 124, 57–70. [Google Scholar] [CrossRef] [PubMed]
  46. Gupta, S.; Srivastava, M.; Ahmad, N.; Sakamoto, K.; Bostwick, D.G.; Mukhtar, H. Lipoxygenase-5 is overexpressed in prostate adenocarcinoma. Cancer 2001, 91, 737–743. [Google Scholar] [CrossRef] [PubMed]
  47. Avis, I.; Hong, S.H.; Martínez, A.; Moody, T.; Choi, Y.H.; Trepel, J.; Das, R.; Jett, M.; Mulshine, J.L. Five-lipoxygenase inhibitors can mediate apoptosis in human breast cancer cell lines through complex eicosanoid interactions. FASEB J. 2001, 15, 2007–2009. [Google Scholar] [CrossRef]
  48. Hoque, A.; Lippman, S.M.; Wu, T.T.; Xu, Y.; Liang, Z.D.; Swisher, S. Increased 5-lipoxygenase expression and induction of apoptosis by its inhibitors in esophageal cancer: A potential target for prevention. Carcinogenesis 2005, 26, 785–791. [Google Scholar] [CrossRef]
  49. Romano, M.; Clària, J. Cyclooxygenase-2 and 5-lipoxygenase converging functions on cell proliferation and tumor angiogenesis: Implications for cancer therapy. FASEB J. 2003, 17, 1986–1995. [Google Scholar] [CrossRef]
  50. Romano, M.; Catalano, A.; Nutini, M.; D’Urbano, E.; Crescenzi, C.; Claria, J.; Libner, R.; Davi, G.; Procopio, A. 5-Lipoxygenase regulates malignant mesothelial cell survival: Involvement of vascular endothelial growth factor. FASEB J. 2001, 15, 2326–2336. [Google Scholar] [CrossRef]
  51. Gamero, A.M.; Young, H.A.; Wiltrout, R.H. Inactivation of Stat3 in tumor cells: Releasing a brake on immune responses against cancer? Cancer Cell 2004, 5, 111–112. [Google Scholar] [CrossRef]
  52. Johnston, P.A.; Grandis, J.R. STAT3 SIGNALING: Anticancer Strategies and Challenges. Mol. Interv. 2011, 11, 18–26. [Google Scholar] [CrossRef]
  53. Chen, J.; Wang, J.; Lin, L.; He, L.; Wu, Y.; Zhang, L.; Yi, Z.; Chen, Y.; Pang, X.; Liu, M. Inhibition of STAT3 Signaling Pathway by Nitidine Chloride Suppressed the Angiogenesis and Growth of Human Gastric Cancer. Mol. Cancer Ther. 2012, 11, 277–287. [Google Scholar] [CrossRef] [PubMed]
  54. Rahman, N.; Khan, H.; Zia, A.; Khan, A.; Fakhri, S.; Aschner, M.; Gul, K.; Saso, L. Bcl-2 Modulation in p53 Signaling Pathway by Flavonoids: A Potential Strategy towards the Treatment of Cancer. Int. J. Mol. Sci. 2021, 22, 11315. [Google Scholar] [CrossRef] [PubMed]
  55. Macharia, J.M.; Mwangi, R.W.; Szabó, I.; Zand, A.; Kaposztas, Z.; Varjas, T.; Rozmann, N.; Raposa, B.L. Regulatory activities of Warbugia ugandensis ethanolic extracts on colorectal cancer-specific genome expression dose-dependently. Biomed. Pharmacother. 2023, 166, 115325. [Google Scholar] [CrossRef] [PubMed]
  56. Ezziyyani, M. Advances in Intelligent Systems and Computing 1103 Advanced Intelligent Systems for Sustainable Development (AI2SD’2019) Volume 2-Advanced Intelligent Systems for Sustainable Development Applied to Agriculture and Health, Conference Proceeding Held in Marrakech, Morocco, from 8 to 11 July 2019. Available online: https://link.springer.com/conference/aisd (accessed on 18 May 2023).
  57. Lindsey, K.L.; Jäger, A.K.; Viljoen, A.M.; van Wyk, B.-E. Cyclooxygenase inhibitory activity of Aloe species. S. Afr. J. Bot. 2002, 68, 47–50. [Google Scholar] [CrossRef]
  58. Luo, X.; Zhang, H.; Wei, X.; Shi, M.; Fan, P.; Xie, W.; Zhang, Y.; Xu, N. Aloin Suppresses Lipopolysaccharide-Induced Inflammatory Response and Apoptosis by Inhibiting the Activation of NF-κB. Molecules 2018, 23, 517. [Google Scholar] [CrossRef]
  59. Capes, I.C.; Universidade, U.; Lib, D. Copyrighted I. Inhibitory, and Free Radical Scavenging Effects of Rumex nepalensis. Planta Medicaica 2010, 1564–1569. [Google Scholar]
  60. Park, M.-Y.; Kwon, H.-J.; Sung, M.-K. Evaluation of Aloin and Aloe-Emodin as Anti-Inflammatory Agents in Aloe by Using Murine Macrophages. Biosci. Biotechnol. Biochem. 2009, 73, 828–832. [Google Scholar] [CrossRef]
Cancers 15 05002 g001
Figure 1. Gradual upregulatory activities were observed in CASPS9 after treatment with AS leaf extracts, as clearly shown in sub-figures (a,b). The regulatory characteristics were statistically significant.
Figure 1. Gradual upregulatory activities were observed in CASPS9 after treatment with AS leaf extracts, as clearly shown in sub-figures (a,b). The regulatory characteristics were statistically significant.
Cancers 15 05002 g001
Cancers 15 05002 g002
Figure 2. Downregulatory effects were observed in 5-LOX upon treatment with AS leaf extracts, as clearly shown in sub-figures (a,b). The modulatory expressions were statistically significant. (a) Box plot, (b) mean plot.
Figure 2. Downregulatory effects were observed in 5-LOX upon treatment with AS leaf extracts, as clearly shown in sub-figures (a,b). The modulatory expressions were statistically significant. (a) Box plot, (b) mean plot.
Cancers 15 05002 g002
Cancers 15 05002 g003
Figure 3. Downregulatory properties recorded in Bcl2 after treatment with AS leaf extracts. Sub-figures (a,b) represent the box and mean lots, respectively.
Figure 3. Downregulatory properties recorded in Bcl2 after treatment with AS leaf extracts. Sub-figures (a,b) represent the box and mean lots, respectively.
Cancers 15 05002 g003
Cancers 15 05002 g004
Figure 4. Downregulatory properties recorded in Bcl-xL after treatment with AS leaf extracts. Sub-figures (a,b) represent the box and mean lots, respectively.
Figure 4. Downregulatory properties recorded in Bcl-xL after treatment with AS leaf extracts. Sub-figures (a,b) represent the box and mean lots, respectively.
Cancers 15 05002 g004
Cancers 15 05002 g005
Figure 5. Varied regulatory properties observed in COX-2 after treatment with AS leaf extracts. Sub-figures (a,b) represent the box and mean lots, respectively.
Figure 5. Varied regulatory properties observed in COX-2 after treatment with AS leaf extracts. Sub-figures (a,b) represent the box and mean lots, respectively.
Cancers 15 05002 g005
Cancers 15 05002 g006
Figure 6. A summarized mechanistic schematic presentation of CASPS9, 5-LOX, Bcl2/Bcl-xL, and COX-2 relative expressions with increasing AS extract concentration.
Figure 6. A summarized mechanistic schematic presentation of CASPS9, 5-LOX, Bcl2/Bcl-xL, and COX-2 relative expressions with increasing AS extract concentration.
Cancers 15 05002 g006
Table 1. Phytoconstituent biomolecules present in A. secundiflora [10].
Table 1. Phytoconstituent biomolecules present in A. secundiflora [10].
PlantPhytoconstituents Present in RootsPhytoconstituents Present in LeavesRef.
Aloe secundifloraAnthraquinones (Chrysophanol, Helminthosporin, Aloe-emodin, Aloesaponarin II, and Aloesaponarin I), laccaic acid D, methyl ester, and asphodelin.
Naphthoquinones (5-hydroxy-3,6-dimethoxy-2-methylnaphthalene-1,4-dione and 5,8-dihydroxy-3-methoxy-2-methylnaphthalene-1,4-dione)		Phenols such as anthrones (aloenin, aloenin B, isobarbaloin, barbaloin, and other aloin derivatives), chromones and phenylpyrones,
Alkaloids, Saponin, Tannins, Flavonoids (nthoxanthins, flavanones, flavanols, flavans, and anthocyanidin), Steroids,
Cardiac Glycosides, Aloeresin,
Anthraquinones Aloin, Hydro-xyaloins, Polyphenols, and Terpenoids		[14,15,16,19,20,21]
Table 2. Forward and reverse primer sequences adopted and applied in the experimental study.
Table 2. Forward and reverse primer sequences adopted and applied in the experimental study.
Primer IDForward PrimerReverse Primer
COX-2CGGTGAAACTCTGGCTAGACAGGCAAACCGTAGATGCTCAGGGA
5-LOXGGAGAACCTGTTCATCAACCGCCAGGTCTTCCTGCCAGTGATTC
Bcl2ATCGCCCTGTGGATGACTGAGTGCCAGGAGAAATCAAACAGAGGC
Bcl-xLGCCACTTACCTGAATGACCACCAACCAGCGGTTGAAGCGTTCCT
Casp9GTTTGAGGACCTTCGACCAGCTCAACGTACCAGGAGCCACTCTT
HPRT1TGCTTCTCCTCAGCTTCACTCAGGAGGAGGAAGCC
Table 3. Post hoc computed test analysis of multiple relationships showing the targeted gene expressions at increasing concentrations (Tukey HSD, multiple comparisons a).
Table 3. Post hoc computed test analysis of multiple relationships showing the targeted gene expressions at increasing concentrations (Tukey HSD, multiple comparisons a).
Dependent
Variable		(I) Conc(J) ConcMean
Difference (I–J)		Std. ErrorSig.95% Confidence Interval
Lower BoundUpper Bound
COX20.000.50−0.00110000.00507800.996−0.0173620.015162
1.00−0.00303330.00507800.930−0.0192950.013228
2.00−0.00183330.00507800.983−0.0180950.014428
0.500.000.00110000.00507800.996−0.0151620.017362
1.00−0.00193330.00507800.980−0.0181950.014328
2.00−0.00073330.00507800.999−0.0169950.015528
1.000.000.00303330.00507800.930−0.0132280.019295
0.500.00193330.00507800.980−0.0143280.018195
2.000.00120000.00507800.995−0.0150620.017462
2.000.000.00183330.00507800.983−0.0144280.018095
0.500.00073330.00507800.999−0.0155280.016995
1.00−0.00120000.00507800.995−0.0174620.015062
Lox50.000.500.2052000 *0.05968280.0360.0140750.396325
1.000.2887667 *0.05968280.0060.0976410.479892
2.000.3763333 *0.05968280.0010.1852080.567459
0.500.00−0.2052000 *0.05968280.036−0.396325−0.014075
1.000.08356670.05968280.533−0.1075590.274692
2.000.17113330.05968280.080−0.0199920.362259
1.000.00−0.2887667 *0.05968280.006−0.479892−0.097641
0.50−0.08356670.05968280.533−0.2746920.107559
2.000.08756670.05968280.497−0.1035590.278692
2.000.00−0.3763333 *0.05968280.001−0.567459−0.185208
0.50−0.17113330.05968280.080−0.3622590.019992
1.00−0.08756670.05968280.497−0.2786920.103559
Bcl20.000.50−0.00013330.00076050.998−0.0025690.002302
1.000.00033330.00076050.970−0.0021020.002769
2.000.00143330.00076050.306−0.0010020.003869
0.500.000.00013330.00076050.998−0.0023020.002569
1.000.00046670.00076050.925−0.0019690.002902
2.000.00156670.00076050.244−0.0008690.004002
1.000.00−0.00033330.00076050.970−0.0027690.002102
0.50−0.00046670.00076050.925−0.0029020.001969
2.000.00110000.00076050.508−0.0013350.003535
2.000.00−0.00143330.00076050.306−0.0038690.001002
0.50−0.00156670.00076050.244−0.0040020.000869
1.00−0.00110000.00076050.508−0.0035350.001335
Bcl-xL0.000.50−0.72220000.42819580.389−2.0934340.649034
1.00−0.24323330.42819580.939−1.6144671.128000
2.000.03710000.42819581.000−1.3341341.408334
0.500.000.72220000.42819580.389−0.6490342.093434
1.000.47896670.42819580.689−0.8922671.850200
2.000.75930000.42819580.351−0.6119342.130534
1.000.000.24323330.42819580.939−1.1280001.614467
0.50−0.47896670.42819580.689−1.8502000.892267
2.000.28033330.42819580.911−1.0909001.651567
2.000.00−0.03710000.42819581.000−1.4083341.334134
0.50−0.75930000.42819580.351−2.1305340.611934
1.00−0.28033330.42819580.911−1.6515671.090900
CASPS90.000.500.8094667 *0.10021330.000.4885481.130385
1.000.7833000 *0.10021330.000.4623821.104218
2.000.7052000 *0.10021330.000.3842821.026118
0.500.00−0.8094667 *0.10021330.000−1.130385−0.488548
1.00−0.02616670.10021330.993−0.3470850.294752
2.00−0.10426670.10021330.732−0.4251850.216652
1.000.00−0.7833000 *0.10021330.000−1.104218−0.462382
0.500.02616670.10021330.993−0.2947520.347085
2.00−0.07810000.10021330.862−0.3990180.242818
2.000.00−0.7052000 *0.10021330.000−1.026118−0.384282
0.500.10426670.10021330.732−0.2166520.425185
1.000.07810000.10021330.862−0.2428180.399018
* The mean difference is significant at the 0.05 level; a treatment = methanolic leaf extracts.
Table 4. Statistical analysis of the effects of methanolic leaf extracts on the targeted genes.
Table 4. Statistical analysis of the effects of methanolic leaf extracts on the targeted genes.
Target GenesSum of SquaresdfMean SquareFSig.
COX2Between Groups0.00030.0000.1260.942
Within Groups0.00080.000
Total0.00011
Lox5Between Groups0.23330.07814.5540.001
Within Groups0.04380.005
Total0.27611
Bcl2Between Groups0.00030.0001.7480.235
Within Groups0.00080.000
Total0.00011
Bcl-xLBetween Groups1.10030.3671.3330.330
Within Groups2.20080.275
Total3.30011
Caspase9Between Groups1.33830.44629.6030.000
Within Groups0.12180.015
Total1.45811
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Macharia, J.M.; Varjas, T.; Mwangi, R.W.; Káposztás, Z.; Rozmann, N.; Pintér, M.; Wagara, I.N.; Raposa, B.L. Modulatory Properties of Aloe secundiflora’s Methanolic Extracts on Targeted Genes in Colorectal Cancer Management. Cancers 2023, 15, 5002. https://doi.org/10.3390/cancers15205002

AMA Style

Macharia JM, Varjas T, Mwangi RW, Káposztás Z, Rozmann N, Pintér M, Wagara IN, Raposa BL. Modulatory Properties of Aloe secundiflora’s Methanolic Extracts on Targeted Genes in Colorectal Cancer Management. Cancers. 2023; 15(20):5002. https://doi.org/10.3390/cancers15205002

Chicago/Turabian Style

Macharia, John M., Timea Varjas, Ruth W. Mwangi, Zsolt Káposztás, Nóra Rozmann, Márton Pintér, Isabel N. Wagara, and Bence L. Raposa. 2023. "Modulatory Properties of Aloe secundiflora’s Methanolic Extracts on Targeted Genes in Colorectal Cancer Management" Cancers 15, no. 20: 5002. https://doi.org/10.3390/cancers15205002

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop