Next Article in Journal
Enterprise Transformation and Innovation: A Study of Performance Compensation from the Perspective of Information Asymmetry
Previous Article in Journal
Examining the Roles of Training, Fit Testing, and Safety Climate on User Confidence in Respiratory Protection: A Case Example with Reusable Respirators in Health Delivery Settings
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Sustainability
Volume 15
Issue 17
10.3390/su151712824
sustainability-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Root-Layer Fungi Native to Four Volcanic Topographies on Conserved Ocean Islands: Another Clue to Facilitate Access to Newer Natural Microbial Resources in the Extreme Terrains

by
Jong Myong Park
1,2,
Tae Won Kwak
3,
Ji Won Hong
4,5,* and
Young-Hyun You
6,*
1
Water Quality Research Institute, Waterworks Headquarters Incheon Metropolitan City, Incheon 21316, Republic of Korea
2
Incheon Metropolitan City Institute of Public Health and Environment, Incheon 22320, Republic of Korea
3
Medical Convergence Materials Commercialization Center, Gyeongbuk Technopark, Gyeongsan 38408, Republic of Korea
4
Department of Hydrogen and Renewable Energy, Kyungpook National University, Daegu 41566, Republic of Korea
5
Advanced Bio-Resource Research Center, Kyungpook National University, Daegu 41566, Republic of Korea
6
Biological Resources Utilization Division, National Institute of Biological Resources, Incheon 22689, Republic of Korea
*
Authors to whom correspondence should be addressed.
Sustainability 2023, 15(17), 12824; https://doi.org/10.3390/su151712824
Submission received: 27 July 2023 / Revised: 20 August 2023 / Accepted: 22 August 2023 / Published: 24 August 2023
(This article belongs to the Special Issue Water Quality Research and Waterborne Microbial Resources)
Browse Figures
Versions Notes

Abstract

:
This study hypothesized that geographic segregation of certain extreme natures of the same kind could be an indicator of access to new natural microbial resources. Root-layer fungi and soil properties native to well-conserved volcanic topographies from two geographically segregated ocean volcanic islands beside the Korean Peninsula were analyzed. Four segregated sampling sites that represented the ocean volcanoes’ unique natural characters (tuff layer, caldera, and two steep cliffs) were examined. A total of 1356 operational taxonomic units classified into 7 phyla and 196 genera were obtained. Soil analysis showed that the sand proportion varied from 32.0–57.4%, and silt, 39.4–64.8%. The tuff layer terrain was the only terrain classified as silt soil. Soil Corg contents ranged from 2.78–15.12%; TN, 0.159–0.843; salinity, 0.001–0.019; and pH, 5.0–7.4. The larger the island area, the less oceanic salinity inflow, but TN and Corg decreased, and pH increased. The Shannon diversity index varied from 4.81–5.23 and was higher at the larger or center of larger islands. As geographic segregation (distance) increased, the proportion of taxa commonly identified decreased. Thus, geographic isolation of certain natural features (e.g., volcanic islands) may be a preferential clue to accessing a broader range of potential microbial resources.

1. Introduction

The Korean Peninsula, located along the Pacific coast, is divided by a mountain range running through the middle, causing geographical segregation [1]. Islandic geography with different geographical formation histories is distributed around the mainland, the natural heritages of which have been well conserved [2]. These diverse ocean islands are frequently affected by both continental and oceanic climates and have, consequently, dev el oped complex natural and environmental characteristics [1]. Therefore, new microbial species are continuously reported in these natural terrains, and the relationship between unique natural conditions and microbial ecosystems is being revealed [2].
Studies of this type have also focused on the volcanic islands Dokdo and the Ulleung islands, which belong to the Republic of Korea, based on the assumption that they contain a variety of biological resources owing to their unique environments and segregation from the mainland [2]. In a particular natural terrain, a unique climax community should be formed, dominated by certain ecological types [3]. In such terrains, the emergence of natural mutations to allow adaptation to the unique environment facilitates the differ entiation and emergence of new microbial species [4]. Thus, unique natural terrains are preferred, as they act as hot spots for speciation of microbes. Based on this logic, micro biologists steadily pioneer a place or effective criteria to secure greater microbial diversity within limited specified terrains. Extreme environments, where humans or higher life forms find it difficult to survive or exploration is not conducted owing to difficulty in access, or isolated extreme environments contain a diverse variety of micro-organisms with unique metabolic capabilities based on strong resistance to adapt to their own envir on ment [5]. Therefore, such areas in nature can provide an opportunity to discover novel physiologically active substances [6]. Exploration of fungal resources that inhabit special environments has been attempted [7].
However, exploring microbial resources in extreme natural terrain is labor-intensive, time-consuming, and can be dangerous for explorers [8,9,10,11,12]; thus, more efficient indicators are required. Indicators are needed to guide the selection of sampling areas where newer microbial resources are likely to be found. It would be helpful to guess where new and different microbes might broadly exist.
Therefore, other clues for securing diverse potential microbial resources should be uncovered to achieve the sustainable securement of new natural microbial resources, rather than hypothesizing about the existence of unique microbes in such regions simply because they are special environments. Thus, using next-generation sequencing (NGS) technology, comparative analysis of microbial structures between the same kinds of specific natural environments is required to establish such indicators [13].
Such studies might prove advantageous in establishing strategies for exploring nat ural microbial resources. One topic that should be investigated is how unique microbes exist in different natural terrains. Second, whether geographical segregation could also be a factor affecting the existence of unique microbial species should be explored. If segregation of specific terrain or higher life forms living there led to the formation of distinctive symbiotic microbial species in a similar kind of specific environment, it can also be an effective method to obtain maximized new microbial species. Geographical isolation might trigger the appearance and continued emergence of new ecotypes of micro-organisms over time [14,15,16]. A quantitative investigation is, thus, required to evaluate this hypothesis.
Therefore, this study conducted an NGS investigation to reveal how distinctive fungal communities are formed in geographically segregated special terrains with the same geological formation history. This study targeted well-conserved topographies (volcanic caldera, volcanic tuff layer, and volcanic cliffs) specific to volcanic islands, which were uplifted consecutively owing to diastrophism in the deep sea of the East Sea of the Korean Peninsula. The physiochemical properties of the root-layer soil and their fungal clusters (taxon distribution and diversity) were analyzed and compared. There is a growing competition among countries to secure a variety of microbial species; therefore, various strategies and clear indicators are needed for effective exploration of microbial resources. Our findings provide insights that may aid in these efforts.

2. Materials and Methods

2.1. Site Selection and Sampling

Volcanic islands formed by volcanic activity which are under geographical segregation (Figure 1) were selected. Two sites (Dongdo and the Seodo cliffs) belonging to the Dokdo Islands in the East Sea of the Korean Peninsula [17] (Figure 1, Table 1) as well as the Nari caldera and Taeha volcanic tuff layer in the Ulleung Islands [18] were selected (Figure 1, Table 1). Sampling points which were administratively controlled and inaccessible to humans were chosen [2]. The Ulleung and Dokdo islands are remote islands, and the sampling points are areas where there is no scope for artificial development [2,15,19,20,21]. The Ulleung Islands and the Dokdo Islands are natural reserve areas promoted by the government of the Republic of Korea [19]. The area of volcanic tuff layer in the Taeha mountain pass is a terrain where the volcanic fault remains intact [18] due to its steep incline [22,23]. Additionally, soils around the root layer of well-developed vegetation or stratification were collected and sampled separately.
Three clods of soil (1000 cm3) were randomly collected at a depth of 0–0.1 m from each of the four fixed circles (10 m in diameter) on a diagonal line in the two plots. A soil sample of three replicates from each circle was taken as one sample, packed in sterile plastic, and sent to the laboratory at 4 °C, after sieving through a 2 mm screen. To maintain the temperature at 4 °C, an ice pack was used, and the samples were stored in refrigerators loaded on ships and vehicles.

2.2. Geographical Segregation

The Ulleung Islands and the Dokdo Islands are volcanic islands that share the same geological formation history; however, they have subsequently undergone geographical segregation and are now isolated, with a distance of 87,400 m between them.
The distance to the next closest landmass, the Oki Islands in the northernmost reaches of the Japanese archipelago is ~157,500 m. Furthermore, in the case of the Dokdo Islands, two sampling sites, namely, the East (Dongdo) and the west (Seodo) islands, were segregated at a distance of ~100 m by fast-flowing waterways.
Even within the Ulleung Islands, the Nari caldera and the Taeha volcanic tuff layer are separated by at least 4700 m and mountain ranges of 850 m above sea level. However, regarding topographical factors, lava and ash emitted at the Nari caldera (volcanic crater), the center of the terrains during volcanic eruption, would have flown to an area close to the coast to form the Taeha volcanic tuff layer.

2.3. Soil Analysis

Soil samples from each site were subdivided into two subsamples. The first was air-dried, sieved using a 2 mm filter, and chemically and physically analyzed, while the second was stored at −80 °C and later processed for pyrosequencing analysis. The soil texture, pH, and organic carbon contents (Corg) of the air-dried and sieved soil subsamples were analyzed. Soil texture was classified using the pipette method, without carbonate and organic matter removal but after the complete removal of soluble salts using distilled water [24]. The pH was measured in 1:2.5 (w/v) soil-to-water mixtures; Corg was measured using the Walkley and Black method [25]. Total nitrogen (TN) was analyzed using the Kjeldahl procedure [26].

2.4. DNA Extraction and Amplification

All samples were transported to National Institute of Biological Resources of the Korea Republic for DNA extraction. Combined soil, amounting to 1 kg, was gently homogenized. DNA was extracted from the samples using 0.5 g of the mixed 1 kg soil from each bag separately. Soil DNA was extracted using the Power Soil DNA extraction kit (MO BIO Laboratories, Carlsbad, CA, USA), following the manufacturer’s protocol. The extracted DNA was quantified using Quant-IT PicoGreen (Invitrogen). Fungal internal transcribed spacer (ITS) region 1 was amplified using the ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and ITS4 (5′- GCTGCGTTCTTCATCGATGC -3′) primer pair. The resulting ITS 1 amplicons were sequenced at Macrogen (Seoul, Korea) on a paired-end (2 × 300 nt) Illumina MiSeq sequencing system (Illumina, San Diego, CA, USA) [27,28]. The PCR product was purified with AMPure beads.

2.5. Sequence Processing and Statistical Analysis

Paired-end sequences were assembled using the PANDAseq software Ver 2.11 [29]. After assembly, sequenced data were processed using the Mothur pipeline [30]. For fungal community analysis, the flanking gene fragments were removed from the ITS1 region using ITSx version 1.0.9 [31]. The putative chimeric sequences were detected and removed via the Chimera Uchime algorithm contained within Mothur [32] set in the de novo mode. Taxonomic classification was performed using Mothur’s version of the naïve Bayesian classifier with the UNITE database for fungi [33]. QIIME implementation of UCLUST [34,35] was used to assign the operational taxonomic units (OTUs). OTUs were defined with a limit threshold of 97% sequence similarity for fungi. The entire singleton OTUs were removed from all datasets prior to analysis. All samples were standardized by random subsampling using the “subsampling” command (https://mothur.org/wiki/sub.sample/) in Mothur. Richness, diversity indices, and rarefaction values [3] were estimated using Mothur [36,37,38].

3. Results and Discussion

3.1. Pyrosequencing and Statistical Analysis

We obtained 1356 OTUs at 97% similarity level (Table 2). Rarefaction curves for OTUs from each site were deduced (Figure 2). A total of seven fungal phyla were identified in all sampling sites (Table 3). The identified number of fungal phyla varied between sites (Table 2). Seven fungal phyla were confirmed (Table 2 and Table 3). A total of 196 fungal genera were identified in all sampling sites (Figure 3).

3.2. Soil Texture Classification, pH, Corg, TN, and Salt Concentration

Soil analysis revealed that although the ratio of the soil constituents (sand, silt, and clay) varied between each natural site (Table 4), three sites (the volcanic cliffs of Dongdo, Seodo, and the Nari volcanic caldera of the Ulleung Islands) belong to the sandy soil class, while the volcanic tuff layer in the Taeha of the Ulleung Islands belongs to the silt class. Clay is a fine soil particle of less than 0.002 mm, with a relatively low water permeability and strong retention of moisture and nutrients, therefore providing viscosity to the soil texture [39]. However, no sites of the volcanic islands have a high proportion of clay.
Silt has a soil particle size ranging from 0.02–0.002 mm [39]; if silt was well-deposited, the capillary action of water expands, and the water permeability of the soil weakens. Silt texture is a soil characteristic commonly considered before farming. Only one volcanic island site was classified as silt class, defined as containing more than 50% silt among total soil grains. For sand, the particle size ranged from 0.02–2 mm, and the water permeability was very high; therefore, the retention capacity of moisture and nutrients was relatively lower than that of silt or clay [39].
In this analysis, the ratio of clay grains was very low (3–4%). The high proportions of silt observed in the volcanic tuff layer of Taeha (64.8%) and the Nari volcanic caldera (39.7%) are common to volcanic geography and are attributed to the following reasons: pyroclastic material created by volcanic activity are divided into various categories, including volcanoes, volcanic rocks, and ash, while those consisting of particles less than 2 mm are classified as ruffs. It is thought that such particles are deposited as fine silt soil if they have suffered considerable erosion due to the oceanic climate.
The less viscous sandy soil, a unique feature of island terrain, makes it difficult to maintain the moisture and nutrients needed for the activities of plants and, in turn, other living beings. Nevertheless, Dongdo in the Dokdo Islands and the Nari volcanic caldera, which have sandy soil properties, show well-developed herbaceous plant communities or canopy layer forest. This is thought to be related to the fungi of root-layer soil.
In the pH analysis, weak acidity was observed in the root-layer soil from two sites of the Dokdo Islands (pH 5.9 and 5.0), and neutral or weak alkalinity was observed in the soil from the root layer of the Nari volcanic caldera (pH 8.0) and volcanic tuff layer (pH 7.4). Total nitrogen contents and Corg were very low in the root layer of the Nari volcanic caldera (TN: 0.159%, Corg: 2.78%). This is presumed to be due to the rapid circulation and utilization of nitrogen and carbon sources due to the woody plants that comprise the well-developed and well-preserved canopy layer of the Nari volcanic caldera primitive forests. Soil salt pollution by salt intrusion is higher in the Dongdo (0.019%) and Seodo (0.0012%) Dokdo Islands compared to the Ulleungdo Islands (below 0.005%). We hypothesized that this is because the high altitude and steep slope of the Dokdo volcanic cliffs increases its exposure to sea breeze. Conversely, the Ulleungdo Islands have gentle slopes and canopy-developed forests, which may reduce salt intrusion from the Pacific Ocean to the central part of the islands. The interrelationships between these soils and the environment will, inevitably, affect the interaction between vegetation and soil fungi and, thus, the resulting distribution and appearance of root-layer fungal species.

3.3. Distribution of Fungal Phyla

First, a comparison of sites on the Dokdo Islands (Dongdo and Seodo) and those on the Ulleung Islands (Nari caldera and Taeha tuff layer) was conducted. Four common phyla were identified in the two sites of the Dokdo Islands (Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota) (Table 3), while two phyla were unique to the Dongdo Islands (Blastocladiomycota and Glomeromycota) (Table 3). No phylum was unique to Seodo, which showed the lowest number of fungal phyla and genera (Table 3), possibly due to the relatively harsh natural soil conditions [40,41].
Five genera were common to the two sites of the Ulleung Islands (Table 3), identified in both the Nari volcanic caldera and Taeha volcanic tuff layer (Ascomycota, Basidiomycota, Chytridiomycota, Glomeromycota, and Zygomycota) (Table 3). In addition, Rozellomycota was identified only in the Nari volcanic caldera but not in the volcanic tuff layer or in the Dokdo Islands (Table 3).
The presence of Chytridiomycota (Table 3) was confirmed in all the sampling locations. This phylum is evolutionarily primitive, with close relations to the kingdom Animalia [42]; its species have motility apparatuses (zoospore) [43] and are adapted to freshwater environments [42], with most species reported as saprophytic [44] or parasitic [45]. Notably, Chytridiomycota members can survive extreme conditions, such as high and extremely low pH [45]. The emergence of such true zoosporic fungi reflects the distinctive environment of the four volcanic, oceanic islands as maritime environments. The abundance of Chytridiomycota was higher in Dokdo (Dongdo: 0.345, Seodo: 0.263) than the Ulleung Islands (Nari volcanic caldera: 0.016, volcanic tuff layer: 0.175) (Figure 3), possibly due to the relatively barren conditions of Dokdo and subsequent stronger natural selective pressure.
Sustainability 15 12824 g003
Figure 3. Fungal genus distribution of each topography.
Figure 3. Fungal genus distribution of each topography.
Sustainability 15 12824 g003
Glomeromycota, a newly divergent fungal phylum branching off from arbuscular mycorrhizae, was commonly found in the three sites (Table 3). Notably, Archaeospora species belonging to this phylum were specifically identified. This phylum has continuously been reported to include root symbionts [46,47,48]. Logically, their existence without vegetation cannot be explained [43]. Most of the reported species belonging to Glomeromycota are not saprophytic or parasitic, but are instead symbiotic in the root layer of vegetation [43]. In this study, Glomeromycota was identified in all topographical sites except Seodo (Table 3). This result might reflect the characteristically extreme environment of Seodo. However, it should be noted that since this study did not specifically investigate rhizosphere or rhizoplane, it is not possible to conclude that interactions with native plants have not been developed in areas where Glomeromycota was not reported. However, the discovery of Glomeromycota shows the potential for secur ing plant symbiosis.
Blastocladiomycota was only identified in Dongdo (Table 3). Blastocladiomycota was originally classified within the order Blastocladiales in the phylum Chytridiomycota until molecular and zoospore ultrastructural characters were used to demonstrate that it was not monophyletic with Chytridiomycota [49]. Like Chytridiomycota, members of Blasto clad i omycota are capable of growing on refractory materials, such as pollen, keratin, cellulose, and chitin [44]. This early diverging branch of the kingdom is the first to exhibit alternation of generations [50]. The fact that Blastocladiomycota was only identified in the Dongdo Islands of Dokdo (Table 3) could be interpreted as proving the conservation of Dokdo’s primitive ecological traits.

3.4. Dominance

The most common phyla were obtained from all sites (Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota), despite their long-term geographical separation. However, phylum which dominated at each island showed differences. In the Dongdo, Zygomycota showed 30.35% dominance (Table 3, Figure 4), while in Seodo, Ascomycota showed 27.38% (Table 3, Figure 4). On the Ulleung Islands, Ascomycota dominated in both the Nari caldera and tuff layer (35.17% and 27.76%, respectively) (Table 3, Figure 4). Meanwhile, the second most dominant phyla at Dongdo, Seodo, and the Nari volcanic caldera and the Taeha volcanic tuff layer were identified as Ascomycota (30.11%), Basidiomycota (19.92%), and Zygomycota (Nari caldera, 22.84%; tuff layer, 9.24%), respectively (Table 3, Figure 4). The phylum Ascomycota was dominant in all the root layers of all islands, except in the Dongdo (Figure 4).
The most dominant fungal genera in all topographies was Mortierella (Dongdo: 27.65%, Seodo: 12.84%, Nari caldera: 11.54%, tuff layer: 8.4%) (Figure 3). Since this genera has consistently been reported as an endophytic or saprophytic plant symbiont [51,52,53,54,55,56] and marine terrains with tolerances [57,58], its emergence in all the volcanic topographies might indicate the existence of stable organic cycles [59] and their own ecology formation.
Sustainability 15 12824 g004
Figure 4. Fungal phylum ratio of each topographical soil (unit: %).
Figure 4. Fungal phylum ratio of each topographical soil (unit: %).
Sustainability 15 12824 g004

3.5. Fungal Diversity

Based on several diversity indices [37,38,60,61,62], ecological stability and fungal com mu nity diversity tend to increase on larger islands or at the center of the islands (Figure 5). The two sites within the Ulleung Islands region showed a relatively higher Shannon value compared to that of Dokdo (caldera: 5.23, tuff layer: 5.20, Dongdo Islands: 4.90, Seodo Islands: 4.81) (Figure 5). As the Dokdo Islands are more strongly affected by extreme marine environments than the Ulleung Islands owing to their small extents, the Dokdo Islands might suffer more selective pressure. This conclusion is reinforced by the fact that there is an increase in chao 1 richness in the Dongdo with a decrease in Shannon diversity values.
Another interpretation is also possible based on the islands biogeography hypoth esis. The factors that determine the higher species richness of the island are distance from land (distance effect) and area of the island (area effect) [63,64]. All volcanic islands targeted in this study are excessively isolated from the land, and it is believed that they will not be a major influencing factor on microbial species. The remaining factor is the area of the island. In this study, as the area of the island increased, various fungal species appeared, thereby increasing the species richness. This phenomenon may stem from the distribution of various ocean volcanic geography as the area of the island increases. Islands biogeography hypothesis is aimed at higher organisms; however, similar results were obtained for fungal species in this study. Islands biogeography hypothesis has been proven by a previous experimental study [65]; nevertheless, a study aiming to evaluate microbial richness native to specific terrains [66] could be also conducted to segregate ocean islands.
Sustainability 15 12824 g005
Figure 5. Fungal diversity variance according to Shannon, I. Simpson, and Chao’s richness.
Figure 5. Fungal diversity variance according to Shannon, I. Simpson, and Chao’s richness.
Sustainability 15 12824 g005

3.6. Distribution of Fungal Genera

The distinctive distributions of fungal genera were analyzed (Figure 6). The fungal genera commonly found among the four topographies and the genera unique to specific sites were identified (Figure 6). A total of 198 fungal genera were confirmed, including at the volcanic cliff of the Dongdo Islands (87 genera), the Seodo Islands (73 genera) of the Dokdo, the Nari volcanic caldera (92 genera), and the Taeha volcanic tuff layer (100 genera) of the Ulleung Islands (Figure 6).
There were only 21 fungal genera common to all topographical sites (7.04% of the total 198 genera) (Figure 6). A total of 43% of genera were common to Dongdo and Seodo, both belonging to the Dokdo Islands (Figure 6). In the case of Dokdo, 70 genera (60.8%) were not shared between Dongdo and Seodo (Figure 6). Of the 144 genera identified from two segregated topographies across the Ulleung Islands, 46 were commonly shared genera (Figure 6), but 98 (68.1%) were unique (Figure 6). By comparing the Taeha volcanic tuff layer and the volcanic cliff of Dongdo, which lie facing opposite directions geographically, 28 common fungal genera were identified. By comparing the Seodo and the Nari volcanic caldera, which are isolated (8800 m) by the sea but face each other, a total of 35 common fungal genera were identified.
Sustainability 15 12824 g006
Figure 6. Fungal genera identified independently in each volcanic topography and the proportion of common fungal genera.
Figure 6. Fungal genera identified independently in each volcanic topography and the proportion of common fungal genera.
Sustainability 15 12824 g006
This might indicate that the geographical segregation of volcanic islands in the ocean might tend to increase the distinctiveness of the fungal resources native to each topography. Therefore, we hypothesized that the geographical segregation within the kind of special terrain itself could be another factor influencing the formation of unique ness of fungal taxa. The results obtained, which point to the existence of unique fungal populations of different genera, in turn, reflecting on the unique vegetation characteristics or conservation state, stipulate the diversities within such special terrains, despite their sharing the same natural formation history. Detailed studies on various special environments are needed to confirm and expand upon these results.
Additional hypotheses may be raised from another perspective. Based on Gaia’s theory, even if the earth’s system forms an extreme natural environment through extreme geological activity, special higher life and extraordinary microbial clusters can be formed to adapt to that environment [5,6,7]. Those biospheres will continue to interact with these special geographic conditions and can co-ordinate themselves [67,68,69]. With such a special natural environment maintaining geographical segregation over time, extreme environments where higher life finds it difficult to survive can, perhaps, become moderate by biological or microbiological activity. In other words, such barren terrains can change continuously. This has a similar context to the fact that the early earth was transformed into a moderate environment where life could live through the activities of micro-organisms [70]. Based on our results, geographical segregation of a special environment itself may be a clue to securing special micro-organisms. However, prolonged geo graph ical segregation time of such an extreme nature may also be an opportunity for the emer gence of new micro-organisms. This hypothesis requires further scientific verification.

4. Conclusions

Exploring microbial resources in extreme natural terrain is labor-intensive, time-consuming, and, sometimes, dangerous for explorers, so more efficient indicators for selecting sampling sites are required. This study aimed to uncover the diversity and distinctiveness of fungal resources native to volcanic island-specific topographies that had undergone geographical segregation to plan the effective exploration of unique fungal resources. The physiochemical properties of soil and the composition of root-layer fungal clusters from each topography specific to volcanic islands which have extreme conditions unsuitable for human accessing were comparatively analyzed. Although these four topographical regions share the same natural formation history, different vegetation or stratifications were formed depending on the topography and size of each island, which affected the uniqueness of the root-layer fungal clusters. Furthermore, as geographical segregation (distance) increased, the proportion of fungal genera sharing the same taxon decreased. Thus, geographical segregation within the special extreme terrain itself could be another factor influencing the formation of fungal or microbial resources. Our findings provide insights for future microbiological exploration native to extreme geography.

Author Contributions

Conceptualization, Y.-H.Y.; methodology, J.M.P.; software, J.M.P.; validation, Y.-H.Y. and J.W.H.; formal analysis, J.M.P.; investigation, Y.-H.Y. and T.W.K.; resources, Y.-H.Y.; data curation, J.M.P.; writing—original draft preparation, J.M.P.; writing—review and editing, J.M.P.; visualization, J.M.P.; supervision, Y.-H.Y. and J.W.H.; project administration, Y.-H.Y.; funding acquisition, Y.-H.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a grant from the National Institute of Biological Resources (NIBR), funded by the Ministry of Environment (MOE) of the Republic of Korea (grant number NIBR202315101).

Informed Consent Statement

Not applicable.

Data Availability Statement

All the raw sequences obtained from this study have been deposited at the NCBI Sequence Read Archive under the project number PRJNA616035 with sample accession number of SRX8028073 (caldera of the Ulleung Islands), SRX8028074 (volcanic cliff of the Ulleung Islands), SRX8028075 (Seodo of the Dokdo Islands), and SRX8028076 (Dongdo of the Dokdo Islands).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Kong, W.S.; David, W. The Plant Geography of Korea with an Emphasis on the Alpine Zones; Springer Science & Business Media: Heidelberg, Germany, 1993. [Google Scholar]
  2. Park, J.M.; Hong, J.W.; Son, J.S.; Hwang, Y.J.; Cho, H.M.; You, Y.H.; Ghim, S.Y. A strategy for securing unique microbial resources—Focusing on Dokdo islands-derived microbial resources. Israel J. Ecol. Evol. 2018, 64, 1–15. [Google Scholar] [CrossRef]
  3. Dini-Andreote, F.; de Cássia Pereira e Silva, M.; Triadó-Margarit, X.; Casamayor, E.O.; van Elsas, J.D.; Salles, J.F. Dynamics of bacterial community succession in a salt marsh chronosequence: Evidences for temporal niche partitioning. ISME J. 2014, 8, 1989–2001. [Google Scholar] [CrossRef] [PubMed]
  4. Desai, M.M.; Fisher, D.S. Beneficial mutation selection balance and the effect of linkage on positive selection. Genetics 2007, 176, 1759–1798. [Google Scholar] [CrossRef] [PubMed]
  5. Sayed, A.M.; Hassan, M.H.A.; Alhadrami, H.A.; Hassan, H.M.; Goodfellow, M.; Rateb, M.E. Extreme environments: Microbiology leading to specialized metabolites. J. Appl. Microbiol. 2020, 128, 630–657. [Google Scholar] [CrossRef] [PubMed]
  6. Kumar, V.; Kumar, S.; Singh, D. Microbial polyhydroxyalkanoates from extreme niches: Bioprospection status, opportunities and challenges. Int. J. Biol. Macromol. 2020, 147, 1255–1267. [Google Scholar] [CrossRef] [PubMed]
  7. Ibrar, M.; Ullah, M.W.; Manan, S.; Farooq, U.; Rafiq, M.; Hasan, F. Fungi from the extremes of life: An untapped treasure for bioactive compounds. Appl. Microbiol. Biotechnol. 2020, 104, 2777–2801. [Google Scholar] [CrossRef]
  8. Demery, A.C.; Pipkin, M.A. Safe fieldwork strategies for at-risk individuals, their supervisors and institutions. Nat. Ecol. Evol. 2021, 5, 5–9. [Google Scholar] [CrossRef]
  9. Ramírez-Castañeda, V.; Westeen, E.P.; Frederick, J.; Amini, S.; Wait, D.R.; Achmadi, A.S.; Andayani, N.; Arida, E.; Arifin, U.; Bernal, M.A.; et al. A set of principles and practical suggestions for equitable fieldwork in biology. Proc. Natl. Acad. Sci. USA 2022, 119, e2122667119. [Google Scholar] [CrossRef]
  10. Sohn, E. Fieldwork: Extreme research. Nature 2016, 529, 243–245. [Google Scholar] [CrossRef]
  11. Sohn, E. Health and safety: Danger zone. Nature 2017, 541, 247–249. [Google Scholar] [CrossRef]
  12. Wharton, D. Life at the limits: Organisms in extreme environments: Chapter 8. In An Extreme Biology; Cambridge University Press: Cambridge, UK, 2009; pp. 246–278. [Google Scholar]
  13. Narware, J.; Singh, S.P.; Manzar, N.; Kashyap, A.S. Biogenic synthesis, characterization, and evaluation of synthesized nanoparticles against the pathogenic fungus Alternaria solani. Front. Microbiol. 2023, 14, 1159251. [Google Scholar] [CrossRef] [PubMed]
  14. Thorpe, R.S.; Surget-Groba, Y.; Johansson, H. Genetic tests for ecological and allopatric speciation in anoles on an island archipelago. PLoS Genet. 2010, 6, e1000929. [Google Scholar] [CrossRef] [PubMed]
  15. Zhao, C.; Wang, C.B.; Ma, X.G.; Liang, Q.L.; He, X.J. Phylogeographic analysis of a temperate-deciduous forest restricted plant (Bupleurum longiradiatum Turcz.) reveals two refuge areas in China with subsequent refugial isolation promoting speciation. Mol. Phylogenet. Evol. 2013, 68, 628–643. [Google Scholar] [CrossRef] [PubMed]
  16. Kashyap, A.S.; Manzar, N.; Meshram, S.; Sharma, P.K. Screening microbial inoculants and their interventions for cross-kingdom management of wilt disease of solanaceous crops- a step toward sustainable agriculture. Front. Microbiol. 2023, 14, 1174532. [Google Scholar] [CrossRef] [PubMed]
  17. Cultural Heritage Administration of Korea. Cultural Heritage Protection Act. (Act No. 16057); Cultural Heritage Administration: Daejeon, Republic of Korea, 2008.
  18. Kim, Y.K.; Lee, D.S. Petrology of alkali volcanic rocks in northern part of Ulrung island. Econ. Environ. Geol. 1983, 16, 19–36. [Google Scholar]
  19. Ministry of the Environment of Korea. Special Act in the Preservation of the Ecosystem in Island Area Including Dokdo (Act No. 12458); Korea Ministry of Government Legislation: Sejong Metropolitan Autonomous City, Republic of Korea, 2014.
  20. Ministry of Maritime Affairs and Fisheries. Act on the Sustainable Use of Dokdo Island. (Act No. 12147); Ministry of Government Legislation, Korea: Sejong Metropolitan Autonomous City, Republic of Korea, 2013.
  21. Ministry of Land, Infrastructure and Transport. National Land Planning and Utilization Act (Act No. 16492); Korea Ministry of Government Legislation: Sejong Metropolitan Autonomous City, Republic of Korea, 2018.
  22. Lee, J.H.; Cho, H.J.; Lee, B.C.; Oh, S.H.; Bae, K.H. Forest vegetation types and growth characteristics of Seongin-bong in Ulleung Island, Korea. Korean J. Agric. For. Meteorol. 2007, 9, 37–48. [Google Scholar] [CrossRef]
  23. Wu, L.; Chen, J.; Xiao, Z.; Zhu, X.; Wang, J.; Wu, H.; Wu, Y.; Zhang, Z.; Lin, W. Barcoded Pyrosequencing reveals a shift in the bacterial community in the rhizosphere and rhizoplane of Rehmannia glutinosa under consecutive monoculture. Int. J. Mol. Sci. 2018, 19, 850. [Google Scholar] [CrossRef]
  24. US Salinity Lab Staff. Diagnosis and Improvement of Saline and Alkali Soils (Agr. Handbook 60); United States Department of Agriculture: Washington, DC, USA, 1594; pp. 122–124.
  25. UN. FAO Standard operating procedure for soil organic carbon. In Walkley-Black Method (Titration and Colorimetric Method); Global Soil Laboratory: Rome, Italy, 2019. [Google Scholar]
  26. Bremner, J.M.; Mulvaney, C.S. “Nitrogen-total”, methods of soil analysis: Part 2. In Chemical and Microbiological Properties, 2nd ed.; Page, A.L., Miller, R.H., Keeney, D.R., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 1983; pp. 595–624. [Google Scholar]
  27. Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
  28. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  29. Masella, A.P.; Bartram, A.K.; Truszkowski, J.M.; Brown, D.G.; Neufeld, J.D. PANDAseq: Paired-end assembler for Illumina sequences. BMC Bioinform. 2012, 13, 31. [Google Scholar] [CrossRef]
  30. Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing Mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef]
  31. Bengtsson-Palme, J.; Ryberg, M.; Hartmann, M.; Branco, S.; Wang, Z.; Godhe, A.; De Wit, P.; Sánchez-García, M.; Ebersberger, I.; de Sousa, F.; et al. Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. Methods Ecol. Evol. 2013, 4, 914–919. [Google Scholar] [CrossRef]
  32. Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef] [PubMed]
  33. Abarenkov, K.; Henrik Nilsson, R.H.; Larsson, K.H.; Alexander, I.J.; Eberhardt, U.; Erland, S.; Høiland, K.; Kjøller, R.; Larsson, E.; Pennanen, T.; et al. The UNITE database for molecular identification of fungi–recent updates and future perspectives. New Phytol. 2010, 186, 281–285. [Google Scholar] [CrossRef]
  34. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
  35. Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [PubMed]
  36. Heck, K.L.; van Belle, G.; Simberloff, D. Explicit calculation of the rarefaction diversity measurement and the determination of sufficient sample size. Ecology 1975, 56, 1459–1461. [Google Scholar] [CrossRef]
  37. Chao, A.; Shen, T.J.; Program, S.P.A.D.E. (Species Prediction and Diversity Estimation) Program and User’s Guide; National Tsing Hua University, Hsinchu, Taiwan. 2010. Available online: http://chao.stat.nthu.edu.tw/wordpress/ (accessed on 17 October 2022).
  38. Lambshead, P.J.D.; Platt, H.M.; Shaw, K.M. The detection of differences among assemblages of marine benthic species based on an assessment of dominance and diversity. J. Nat. Hist. 1983, 17, 859–874. [Google Scholar] [CrossRef]
  39. Hess, D.; Tasa, D. McKnight’s Physical Geography: A Landscape Appreciation, 10th ed.; Pearson Education: London, UK, 2010. [Google Scholar]
  40. Cultural Heritage Administration Natural Heritage of Korea, Dokdo. Natural Heritage Division, Cultural; Heritage Administration of Korea: Daejeon, Republic of Korea, 2009.
  41. You, Y.H.; Park, J.M.; Park, J.H.; Kim, J.G. Specific rhizobacterial resources: Characterization and comparative analysis from contrasting coastal environments of Korea. J. Basic Microbiol. 2016, 56, 92–101. [Google Scholar] [CrossRef]
  42. Alexopoulos, C.J.; Mims, C.W.; Blackwell, M. Introductory Mycology, 4th ed.; John Wiley & Sons: Hoboken, NJ, USA, 1996. [Google Scholar]
  43. Hibbett, D.S.; Binder, M.; Bischoff, J.F.; Blackwell, M.; Cannon, P.F.; Eriksson, O.E.; Huhndorf, S.; James, T.; Kirk, P.M.; Lücking, R.; et al. A higher-level phylogenetic classification of the fungi. Mycol. Res. 2007, 111, 509–547. [Google Scholar] [CrossRef]
  44. Sparrow, F.K.; Phycomyetes, A. Ann Arbor, 2nd ed.; The University of Michigan Press: Ann Arbor, MI, USA, 1960. [Google Scholar]
  45. Gleason, F.H.; Scholz, B.; Jephcott, T.G.; van Ogtrop, F.F.; Henderson, L.; Lilje, O.; Kittelmann, S.; Macarthur, D.J. Key ecological roles for zoosporic true fungi in aquatic habitats. Microbiol. Spectr. 2017, 5, 10. [Google Scholar] [CrossRef]
  46. Bennett, A.E.; Bever, J.D. Mycorrhizal species differentially alter plant growth and response to herbivory. Ecology 2007, 88, 210–218. [Google Scholar] [CrossRef] [PubMed]
  47. Giridhar Babu, A.; Sudhakara Reddy, M. Diversity of arbuscular mycorrhizal fungi associated with plants growing in fly ash pond and their potential role in ecological restoration. Curr. Microbiol. 2011, 63, 273–280. [Google Scholar] [CrossRef] [PubMed]
  48. Wilde, P.; Manal, A.; Stodden, M.; Sieverding, E.; Hildebrandt, U.; Bothe, H. Biodiversity of arbuscular mycorrhizal fungi in roots and soils of two salt marshes. Environ. Microbiol. 2009, 11, 1548–1561. [Google Scholar] [CrossRef] [PubMed]
  49. James, T.Y.; Letcher, P.M.; Longcore, J.E.; Mozley-Standridge, S.E.; Porter, D.; Powell, M.J.; Griffith, G.W.; Vilgalys, R. A molecular phylogeny of the flagellated fungi (Chytridiomycota) and description of a new phylum (Blastocladiomycota). Mycologia 2006, 98, 860–871. [Google Scholar] [CrossRef] [PubMed]
  50. Kendrick, B. The Fifth Kingdom, 3rd ed.; Focus Publishing: Bemidji, MN, USA, 2000. [Google Scholar]
  51. Kikukawa, H.; Sakuradani, E.; Ando, A.; Shimizu, S.; Ogawa, J. Arachidonic acid production by the oleaginous fungus Mortierella alpina 1S-4: A review. J. Adv. Res. 2018, 11, 15–22. [Google Scholar] [CrossRef]
  52. Turner, M.; Pugh, G.J.F. Species of mortierella from a salt marsh. Trans. Br. Mycol. Soc. 1961, 44, 243-IN9. [Google Scholar] [CrossRef]
  53. Wani, Z.A.; Kumar, A.; Sultan, P.; Bindu, K.; Riyaz-ul-Hassan, S.; Ashraf, N. Mortierella alpina CS10E4, an oleaginous fungal endophyte of Crocus sativus L. enhances apocarotenoid biosynthesis and stress tolerance in the host plant. Sci. Rep. 2017, 7, 8598. [Google Scholar] [CrossRef]
  54. Huang, Z.D.; Wang, W.J.; Han, X.L.; Yang, X.L. Three new hydroxyphenylacetic acid derivatives and a new alkaloid from endophytic fungus Mortierella sp. in Epimedium acuminatum Franch. and their antibacterial activity. Chem. Biodivers. 2021, 18, e2100741. [Google Scholar] [CrossRef]
  55. Johnson, J.M.; Ludwig, A.; Furch, A.C.U.; Mithöfer, A.; Scholz, S.; Reichelt, M.; Oelmüller, R. The beneficial root-colonizing fungus Mortierella hyalina promotes the aerial growth of Arabidopsis and activates calcium-dependent responses that restrict Alternaria brassicae-induced disease development in roots. Mol. Plant Microbe Interact. 2019, 32, 351–363. [Google Scholar] [CrossRef]
  56. Ryszka, P.; Lichtscheidl, I.; Tylko, G.; Turnau, K. Symbiotic microbes of Saxifraga stellaris ssp. alpigena from the copper creek of Schwarzwand (Austrian Alps) enhance plant tolerance to copper. Chemosphere 2019, 228, 183–194. [Google Scholar] [CrossRef]
  57. Wei, Y.L.; Long, Z.J.; Ren, M.X. Microbial community and functional prediction during the processing of salt production in a 1000-year-old marine solar saltern of South China. Sci. Total Environ. 2022, 819, 152014. [Google Scholar] [CrossRef] [PubMed]
  58. Ogaki, M.B.; Pinto, O.H.B.; Vieira, R.; Neto, A.A.; Convey, P.; Carvalho-Silva, M.; Rosa, C.A.; Câmara, P.E.A.S.; Rosa, L.H. Fungi present in Antarctic deep-sea sediments assessed using DNA metabarcoding. Microb. Ecol. 2021, 82, 157–164. [Google Scholar] [CrossRef] [PubMed]
  59. Taylor, T.N.; Kerp, H.; Hass, H. Life history biology of early land plants: Deciphering the gametophyte phase. Proc. Natl. Acad. Sci. USA 2005, 102, 5892–5897. [Google Scholar] [CrossRef]
  60. Fierer, N.; Jackson, R.B. The diversity and biogeography of soil bacterial communities. Proc. Natl. Acad. Sci. USA 2006, 103, 626–631. [Google Scholar] [CrossRef] [PubMed]
  61. Marcon, E.; Scotti, I.; Hérault, B.; Rossi, V.; Lang, G. Generalization of the partitioning of Shannon diversity. PLoS ONE 2014, 9, e90289. [Google Scholar] [CrossRef] [PubMed]
  62. Mendes, R.S.; Evangelista, L.R.; Thomaz, S.M.; Agostinho, A.A.; Gomes, L.C. A unified index to measure ecological diversity and species rarity. Ecography 2008, 31, 450–456. [Google Scholar] [CrossRef]
  63. Lomolino, M.V.; Brown, J.H. The reticulating phylogeny of island biogeography theory. Q. Rev. Biol. 2009, 84, 357–390. [Google Scholar] [CrossRef]
  64. MacArthur, R.H.; Wilson, E.O. The Theory of Island Biogeography; Princeton University Press: Princeton, NJ, USA, 1967. [Google Scholar]
  65. Mopper, S.; Beck, M.; Simberloff, D.; Stiling, P. Local adaptation and agents of selection in a mobile insect. Evolution 1995, 49, 810–815. [Google Scholar] [CrossRef]
  66. Gomes, S.I.F.; Merckx, V.S.F.T.; Hynson, N.A. Biological invasions increase the richness of arbuscular mycorrhizal fungi from a Hawaiian subtropical ecosystem. Biol. Invasions 2018, 20, 2421–2437. [Google Scholar] [CrossRef]
  67. Cazzolla Gatti, R. Adaptation, evolution and reproduction of Gaia by the means of our species. Theor. Biol. Forum 2017, 110, 25–45. [Google Scholar]
  68. Free, A.; Barton, N.H. Do evolution and ecology need the Gaia hypothesis? Trends Ecol. Evol. 2007, 22, 611–619. [Google Scholar] [CrossRef]
  69. Pausas, J.G.; Bond, W.J. Feedbacks in ecology and evolution. Trends Ecol. Evol. 2022, 37, 637–644. [Google Scholar] [CrossRef]
  70. Shih, P.M. Photosynthesis and early Earth. Curr. Biol. 2015, 25, R855–R859. [Google Scholar] [CrossRef]
Sustainability 15 12824 g001
Figure 1. (A) Location and geological segregation of each sampling site (volcanic topography). (B) Satellite images of the Dokdo Islands, consisting of Dongdo and Seodo. (C) Satellite images of the Ulleung Islands. Sampling sites (Taeha volcanic tuff layers and Nari volcanic caldera) are segregated by the mountains and valleys.
Figure 1. (A) Location and geological segregation of each sampling site (volcanic topography). (B) Satellite images of the Dokdo Islands, consisting of Dongdo and Seodo. (C) Satellite images of the Ulleung Islands. Sampling sites (Taeha volcanic tuff layers and Nari volcanic caldera) are segregated by the mountains and valleys.
Sustainability 15 12824 g001
Sustainability 15 12824 g002
Figure 2. Rarefaction curve for the operational taxonomic units from each topography.
Figure 2. Rarefaction curve for the operational taxonomic units from each topography.
Sustainability 15 12824 g002
Table 1. Geographic information of volcanic topography of each ocean island.
Table 1. Geographic information of volcanic topography of each ocean island.
Sampling
Area		Administrative District
Including Sampling Area 		GPS
Location		Average
Altitude (m)
Dokdo
Islands		East volcanic cliff of
top part of Dongdo		Dokdo-ri, Ulleung-eup, Ulleung-gun, Gyeongsangbuk-do, Korea 37°14′21.1″ N, 131°52′10.1″ E 91
North volcanic cliff of
top part of Seodo		Dokdo-ri, Ulleung-eup, Ulleung-gun, Gyeongsangbuk-do, Korea 37°14′31.4″ N, 131°51′53.5″ E83
Ulleung
Islands		Nari volcanic calderaNari 1-gil, Buk-myeon, Ulleung-gun, Gyeongsangbuk-do37°29′51.6″ N, 130°52′6.9″ E 953
Taeha volcanic
tuff layer		Taeha-ri, Seo-myeon, Ulleung-gun, Gyeongsangbuk-do, Korea 37°29′40.78″ N, 130°49′39.42″ E412
Table 2. Pyrosequencing results and statistical analyses.
Table 2. Pyrosequencing results and statistical analyses.
Numerical AnalysisDokdo IslandsUlleung Islands
Volcanic Cliff, DongdoVolcanic Cliff, SeodoNari Volcanic
Caldera		Taeha Volcanic
Tuff Layer
Total read counts267,426247,847229,747224,912
Total bases100,788,12992,067,81788,173,46687,149,231
Number of valid sequences92,040105,78788,56887,693
GC (%)48.5949.6246.8152.3
OTUs338306329330
Fungal phyla6465
Fungal genera877392100
Total read counts: Total number of sequenced reads; total bases: total number of identified bases in reads; GC (%): GC percentage in sequenced reads; operational taxonomic unit (OUT) is an operational definition of a species or group of species often used when only DNA sequencing data are available.
Table 3. Fungal phyla constitutions from each topographical soil (unit: %).
Table 3. Fungal phyla constitutions from each topographical soil (unit: %).
Fungal PhylumDokdo IslandsUlleung Islands
Volcanic Cliff, DongdoVolcanic Cliff, SeodoNari
Volcanic Caldera		Taeha Volcanic
Tuff Layer
Ascomycota30.11127.37835.16527.761
Basidiomycota10.74419.9158.3713.830
Blastocladiomycota0.001---
Chytridiomycota0.3450.2630.0160.175
Glomeromycota0.172-0.0630.057
Rozellomycota--0.016-
Zygomycota30.34916.15922.8429.242
Table 4. Soil classification and physiochemical information of each topographical soil.
Table 4. Soil classification and physiochemical information of each topographical soil.
Islandic TerrainsGrain Size AnalysisSoil
Character		pHCorg
(%)		Total
N (%)		NaCl
(%)
Home IslandsSampling SitesSand (%)Silt (%)Clay (%)
Dokdo
Islands		Volcanic cliff of the Dongdo49.447.33.2Sandy5.915.120.8430.019
Volcanic cliff of the Seodo57.439.43.2Sandy57.610.5170.012
Ulleungdo
Islands		Volcanic tuff layer in Taeha 32.064.83.2Silt7.413.360.6420.005
Nari volcanic caldera 55.539.74.8Sandy82.780.1590.001
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Park, J.M.; Kwak, T.W.; Hong, J.W.; You, Y.-H. Root-Layer Fungi Native to Four Volcanic Topographies on Conserved Ocean Islands: Another Clue to Facilitate Access to Newer Natural Microbial Resources in the Extreme Terrains. Sustainability 2023, 15, 12824. https://doi.org/10.3390/su151712824

AMA Style

Park JM, Kwak TW, Hong JW, You Y-H. Root-Layer Fungi Native to Four Volcanic Topographies on Conserved Ocean Islands: Another Clue to Facilitate Access to Newer Natural Microbial Resources in the Extreme Terrains. Sustainability. 2023; 15(17):12824. https://doi.org/10.3390/su151712824

Chicago/Turabian Style

Park, Jong Myong, Tae Won Kwak, Ji Won Hong, and Young-Hyun You. 2023. "Root-Layer Fungi Native to Four Volcanic Topographies on Conserved Ocean Islands: Another Clue to Facilitate Access to Newer Natural Microbial Resources in the Extreme Terrains" Sustainability 15, no. 17: 12824. https://doi.org/10.3390/su151712824

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop