Next Article in Journal
Cosmetic Potential of Pigments Extracts from the Marine Cyanobacterium Cyanobium sp.
Previous Article in Journal
Genome Mining as an Alternative Way for Screening the Marine Organisms for Their Potential to Produce UV-Absorbing Mycosporine-like Amino Acid
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Marine Drugs
Volume 20
Issue 8
10.3390/md20080479
marinedrugs-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1

by
Li Sha
1,2,3,
Minghai Huang
1,
Xiaonan Huang
4,
Yongtong Huang
1,
Ensi Shao
5,
Xiong Guan
2,3 and
Zhipeng Huang
1,2,3,*
1
College of Life Sciences, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
Ministerial and Provincial Joint Innovation Centre for Safety Production of Cross-Strait Crops, Fujian Agriculture and Forestry University, Fuzhou 350002, China
4
Fuzhou Ocean and Fisheries Technology Center, Fuzhou 350007, China
5
National Engineering Research Center of Juncao Technology, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
Mar. Drugs 2022, 20(8), 479; https://doi.org/10.3390/md20080479
Submission received: 9 July 2022 / Revised: 24 July 2022 / Accepted: 24 July 2022 / Published: 26 July 2022
(This article belongs to the Section Biomaterials of Marine Origin)
Browse Figures
Review Reports Versions Notes

Abstract

:
The applications of alginate lyase are diverse, but efficient commercial enzymes are still unavailable. In this study, a novel alginate lyase with high activity was obtained from the marine bacteria Vibrio sp. Ni1. The ORF of the algB gene has 1824 bp, encoding 607 amino acids. Homology analysis shows that AlgB belongs to the PL7 family. There are two catalytic domains with the typical region of QIH found in AlgB. The purified recombinant enzyme of AlgB shows highest activity at 35 °C, pH 8.0, and 50 mmol/L Tris-HCl without any metal ions. Only K+ slightly enhances the activity, while Fe2+ and Cu2+ strongly inhibit the activity. The AlgB preferred polyM as substrate. The end products of enzymatic mixture are DP2 and DP3, without any metal ion to assist them. This enzyme has good industrial application prospects.

Graphical Abstract

1. Introduction

Alginate is a linear polysaccharide in which β-d-mannuronate (M) and α-l-guluronate (G) are randomly linked by (1–4)-covalent bonds [1]. It is a natural gelling polysaccharide present in cell walls and intracellular material of the brown seaweeds, and is also produced by two families of heterotrophic, Gram-negative bacteria, namely the Pseudomonadaceae and the Azotobacteriaceae [2]. Alginate lyases (EC 4.2.2.3/4.2.2.11) can catalyze the degradation of alginate by cleaving the glycosidic bond through a β-elimination reaction, generating an unsaturated oligomer with 4-deoxy-l-erythro-hex-4-enepyranosyluronate at the nonreducing end [3,4]. In a natural environment, alginate lyases play an important role to recycle alginate.
Original research on alginate lyase was from Pseudomonas aeruginosa [5,6,7]. Currently, alginate lyase have been investigated in many species, including marine algae, marine mollusks, fungi, viruses and a wide range of marine and terrestrial bacteria [8,9,10,11,12,13]. Based on the homology of the primary sequences, alginate lyases are classified into twelve polysaccharide lyase families including PL5, PL6, PL7, PL14, PL15, PL17, PL18, PL31, PL32, PL34, PL36, and PL39, most belong to PL5 and PL7 [8,14,15].
The products produced by alginate lyases, alginate oligosaccharides, have diverse bioactivities, such as anti-oxidant [16], anti-inflammatory [17], anti-tumor proliferation [18,19], anti-apoptotic [20], and have potential value in food and pharmaceutical industries [21,22]. Since alginate lyases are effective tools to prepare alginate oligosaccharides, the attention on their research is increasing.
In the present study, a novel alginate gene was cloned from Vibrio sp. Ni1 and over-expressed in Escherichia coli. The purified recombinant enzyme has high activity toward alginate, poly M and poly G at high temperature and pH, independent of ions. The properties of the recombinant enzyme and its products were analyzed.

2. Results and Discussion

2.1. The Analysis of Alginate-Degrading Activity of Vibrio sp. Ni1

After growth on the alginate plate for 48 h, three colonies of Vibrio sp. Ni1 and their alginate-degraded circles were observed and measured (Figure 1 and Table 1). The results of plate assay showed that the central bright yellow zones were formed by iodate was reduced to I2. It suggested that Vibrio sp. Ni1 can produce alginate lyase to degrade algin and yield the unsaturated uronic acid with reducibility. The diameter of alginate-degraded zones were more than four times greater than that of the colonies. The result showed that Vibrio sp. Ni1 has good ability to degrade alginate.

2.2. The LC-MS/MS Analysis of Crude Alginate Lyase

The crude alginate lyase solution was purified by 70% (NH4)2SO4 precipitation. The majority of the extracellular proteins were exhibited in the range of 20–75 kDa in SDS-PAGE gel (Figure 2). The protein bands in lane 1 were cut-out to extract the proteins, then the proteins were analyzed by LC-MS/MS. There were 147 peptides detected and 6 peptides (Table 2) were discovered to match with one candidate alginate lyase gene. According to the homology of AIY22661.1 and WP_118120558.1, and peptide locations, No. 3 and 4 peptide sequences were chosen to design a pair of degenerate primers named algB-F0/R0 to amplify the partial algB gene.

2.3. The Characterization of the Full Length algB Gene

Based on the sequencing result of the partial algB gene, using SiteFinding-PCR technology, a series of primers were designed to obtain the full length algB gene. Finally, a pair of primers named algB-QF/QR were designed to amplify the full length of algB gene (Figure 3). It consisted of 1824 bp and encodes 607 amino acids with a sequence of 18 amino acids at the N-terminus that was predicted to be signal peptide by online software Signal P5.0. The AlgB protein had a calculated molecular weight 67.7 kDa and pI 4.34. It was subjected to Blast analysis in the NCBI database. The DNA sequence displays high similarity with only one partial genome of Vibrio penaeicida (AP025146.1, 93.81% identity of 86% length). The amino acid sequence displays high similarity of 93.87% identity with three alginate lyases (WP_148112135.1 from Vibrio penaeicida, WP_224056095.1 from Vibrio penaeicida, WP_224915578.1 from Vibrio alginolyticus). These three alginate lyases have not been characterized. Other alginate lyases have about 70–80% identities, such as AIY22661.1 from Vibrio sp. W13, 81.13%; and WP_118120558.1 from Vibrio sp. Dhg, 77.86% (Figure 4a). The algB sequence has been submitted to NCBI (GenBank accession No. MZ680650).
AlgB is classified in the polysaccharide lyase family 7 (PL7). Conserved domain analysis revealed two structural domains in AlgB (Figure 4b). Each structural domain has a predicted catalytic domain. Alginate lyases in PL7 contain three highly conserved motifs, R*E*R, Q(I/V)H, Y*KAG*Y*Q, which form the active site and play an important role in substrate binding and catalysis [23,24]. These conserved motifs also exist in each of the two structural domains in AlgB (RSEVR, QIH, YFKAGVYNQ; RSELR, QIH, YFKAGIYPH). The predicted three-dimensional structure of AlgB was generated by LOMETS (Figure 4c). The typical protein structure of PL7 is a single domain β- jelly roll [3,23]. The first structural domain is residues 78–310, the second structural domain is residues 319–606. These two structural domains connect closely with an octapeptide linking region. It is rare that PL7 alginate lyases have two catalytic domains [25,26].

2.4. Purification of the Recombinant Enzyme AlgB

To characterize the recombinant enzyme, the algB gene was cloned into the expression vector pET32a (+) and transformed to E. coli BL21. The fusion proteins of AlgB were soluble when expressed in host cells and purified by nickel affinity chromatography. Since the mass of the fusion tag protein (TrxA) is approximately 20 kDa, the recombinant AlgB is about 88 kDa. The SDS-PAGE analysis is consistent with the prediction (Figure 5). The activity of purified AlgB was measured (Figure 6). Along with the increase in time, the absorption at λ235 was enhanced rapidly within 1 min and, subsequently, increased slowly. It suggested that AlgB shows the activity of alginate lyase.

2.5. Characteristics of the Recombinant Enzyme AlgB

The optimal pH for the recombinant enzyme AlgB activity was 8.0 and the highest activity was 979 U/mL (Figure 7). More than 50% of the maximum activity was measured at a wide pH range 5.0–10.0 and the activity was stable at pH range of 6.0–10.0. The activity of AlgB sharply decreased when pH lower than 5.0. Beyond Tris-HCl buffer capacity, the activity was not measured on the condition of pH higher than 10.0. The results suggest that the AlgB has good activity at basic pH conditions. The characteristic of some alginate lyases with similar molecular mass from Vibrio strains are summarized (Table 3). These alginate lyase showed optimal pH ≥ 7.0, the highest pH 8.9 [25,26,27,28,29,30,31,32].
The optimal temperature for AlgB was 35 °C and the highest activity was 1059 U/mL (Figure 8a). More than 50% of the maximum activity was measured at a wide temperature range 20–60 °C. The activity of AlgB has sharply decreased over 60 °C. Even at 4 °C, the activity of AlgB was measured 35% maximum. The enzyme retained more than 50% of the highest activity after being incubated at 30 °C for 36 h, and the enzyme retained more than 40% of the highest activity after being incubated at 40 °C for 24 h (Figure 8b). The results show that the activity of AlgB is stable at 30–40 °C. The optimal temperature of AlgB was similar to Aly-IV from Vibrio sp. QD-5 [31].
The activity of AlgB was inhibited by 10 mmol/L Mg2+, Ca2+, Mn2+, Co2+, Ni2+, Zn2+; furthermore, strongly inhibited by Fe2+ and Cu2+. Among the metal ions, only K+ displayed slight activation of enzyme activity (Figure 9a). The enzyme retained more than 50% of the highest activity in 1–2 mol/L NaCl (Figure 9b). Enhancing the concentration of NaCl to more than 3 mol/L, the activity sharply decreases. These results suggested that AlgB has a good tolerance to NaCl. Previous investigations report that many metal ions can increase the enzyme activity, such as Mg2+ and Ca2+ (Table 3). The effect of metal ion on AlgB was similar to Aly-IV except for Mg2+ (Table 3). With the same concentration, Mg2+ strongly activates Aly-IV but slightly inhibits AlgB.
The kinetic parameters of AlgB were determined at the optimal reaction conditions. The specific activity of AlgB towards sodium alginate was 2118 U/mg, the Km value of AlgB was 8.22 mg/mL, the value of Vmax was 2.6 mg/min, and the value of Kcat was 26 min−1 at pH 8.0, 35 °C (Figure 10).

2.6. Substrate Specificity of AlgB

To investigate their substrate specificity, sodium alginate, polyM and polyG were used as substrate for the recombinant enzyme AlgB. Compared to sodium alginate, the relative activity of AlgB to polyM was 16% higher, while polyG was 14% lower at the same reaction conditions (Figure 11). This illustrates that AlgB degrades M-M links more efficiently. Both AlyA and AlyA-OU2 which were favorably to degrade polyM in activity assays (Table 3). The structure of these two alginate lyases are similar to that of AlgB. There is a double region of QIH within them which determines the enzyme has polyM specificity. Some alginate lyases from Vibrio strains were reported sodium alginate-preferred, such as the alginate lyase from Vibrio sp. YWA, Aly-IV from Vibrio sp. QD-5 and Alg7A from Vibrio sp. W13. A few polyG-preferred alginate lyases were discovered, such as AlyB and AlgNJ04. It can be inferred that the QIH region is not absolutely determined by the substrate specificity.

2.7. Analysis of AlgB Degradation Products

Degradation products of AlgB activity were analyzed by TLC and ESI-Q-TOF. The result of TLC showed that the distribution of the end products from the sodium alginate were separated to two different regions with different colors (Figure 12). The negative ESI-Q-TOF results were similar to that of TLC (Figure 13). The main products of degrading sodium alginate, polyM, and polyG were similar and consist of DP2 and DP3. It suggests that the AlgB belongs to endo- alginate lyase family. These results suggest that dimers and trimers are the primary end products of AlgB activity.
The end products from AlgB degradation are similar to Aly-IV (Table 3). It is different from most other alginate lyases currently reported. The degradation mode of AlyA is mainly DP1–4; that of AlyA-OU02 is mainly DP2–4; Algb and AlgNJ04 are mainly DP2–5; and Alg7A is mainly DP2–6 (Table 3).
The process of the recombinant enzyme AlgB was monitored in a viscosity assay (Figure 14). The viscosity of the sodium alginate solution rapidly decreased in the first 5 min, then the viscosity slowly decreased in the following 25 min. The variation trend of AlgB degradation resembled to Aly-IV [31].

3. Materials and Methods

3.1. Bacteria and Substrate

The strain of Vibrio sp. Ni1 was isolated from the sludge of the Minjiang river estuary, located in Fujian province, China. This strain was kept in our lab and China Center for Type Culture Collection (CCTCC No. M2018916). E. coli BL21(DE3) was used as an expression host. The sodium alginate donated by Haizhilin Biotechnology Development Co. Ltd. (Qingdao, China) was used as the substrate to test alginate lyase activity. The viscosity of this sodium alginate sample was 1250 mPa.s. The sodium alginate used to prepare medium was from Solarbio (Beijing, China).

3.2. Screening of Alginate-Degrading Activity

A 5 μL aliquot from a culture of Vibrio sp. Ni1 grown in liquid Luria-Bertani (LB) medium, was transferred to an alginate plate containing 1% (w/v) sodium alginate, 0.2% (w/v) glucose, 0.3% (w/v) NaCl, 0.2% (w/v) NaNO3, 0.05% (w/v) MgSO4·7H2O, 0.1% (w/v) K2HPO4, 0.01% (w/v) CaCl2, and 1% (w/v) agar, pH 7.5. The plate was incubated at 28 °C for 48 h. The plate was stained with 1 mL Lugol’s reagent (5% (w/v) I2, 10% (w/v) KI) for 1 min [33]. The plate was washed with deionized water and observed.

3.3. Extraction of Crude Alginate Lyase

The cells of Vibrio sp. Ni1 were cultured in the liquid fermentation medium containing 1% (w/v) sodium alginate, 3% (w/v) NaCl, 0.2% (w/v) NH4Cl, 0.05% (w/v) MgSO4·7H2O, 0.1% (w/v) K2HPO4, and 0.01% (w/v) CaCl2, pH 7.5, at 28 °C for 24 h. The supernatant was harvested by centrifugation at 4 °C, 8000× g, for 10 min. Solid (NH4)2SO4 was gradually added to the supernatant to a final concentration of 70% (w/v), then stirred continuously at 4 °C for 12 h. The protein precipitant was collected by centrifugation (4 °C, 10,000× g, 30 min) then dissolved in 0.05 mol/L Tris-HCl (pH 7.5). The suspended solution was dialyzing in 0.05 mol/L Tris-HCl (pH 7.5) 12–15 h. The crude protein solution was obtained after centrifugation (4 °C, 10,000× g, 20 min) to get rid of insoluble impurity inside the dialysate, then stored at 4 °C.

3.4. Identification of Alginate Lyase Fragments

The crude alginate lyase was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The 10% acrylamide gel was stained with Coomassie blue and detained with 30% acetonitrile and 0.1 mol/L NH4HCO3. The gel slice was dried in a vacuum centrifuge. The proteins were reduced in-gel with dithiothreitol (10 mmol/L DTT and 100 mmol/L NH4HCO3) for 30 min at 56 °C, then alkylated with iodoacetamide (20 mmol/L IAA and 100 mmol/L NH4HCO3) in the dark at 25 °C for 30 min. The gel slice was briefly rinsed with 100 mmol/L NH4HCO3 and acetonitrile, followed by digestion with 12.5 ng/μL trypsin in 25 mmol/L NH4HCO3 overnight. The digested peptides were extracted three times with 60% (v/v) acetonitrile and 0.1% (v/v) trifluoroacetic acid. The extracts were pooled and dried completely in a vacuum centrifuge. The peptide mass and sequence were determined by Liquid Chromatography (LC)-Electrospray Ionization (ESI) Tandem mass spectrometry (MS/MS) in a Q Extractive mass spectrometer which was coupled to Easy nLC (Proxeon Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). The MS data were analyzed using Max Quant (Version 1.6.4.0) by searching the data against the amino acid sequence of alginate lyases from Vibrio, and the intensity of sequenced peptide in the target protein was calculated.

3.5. Cloning and Sequence Analysis of the Alginate Lyase Gene

Based on the LC-MS/MS results, a pair of degenerate primers (algB-F0/R0) was designed to amplify fragments of the algB gene. According to the sequencing result of the partial algB gene, a series of primers were designed to apply the SiteFinding-PCR method to extend the target gene [34,35]. The details of primers used in this experiment are listed in Table 4. Chromosome Walking Kit and Pfu DNA polymerase (TaKaRa, Osaka, Japan) were used in this study. Finally, a pair of primers named algB-QF/R was designed to amplify the full-length gene. The expression recombinant plasmid was constructed with pET32a on sites of BamH I and Xhol I and transformed into E. coli BL21(DE3).

3.6. Purification of the Alginate Lyase

The E. coli cells harboring the recombinant plasmid pET32a-algB were cultured at 37 °C in liquid LB medium with 100 μg/mL ampicillin until OD600 reached about 0.6. Gene expression was induced with the addition of isopropyl-β-d-thiogalactoside (IPTG) to a final concentration of 0.8 mmol/L and then grown at 20 °C for 24 h. The cells were harvested by centrifugation 8000 r/min, 5 min, at 4 °C, then suspended in 0.05 mol/L Tris-HCl buffer (pH 7.4) to concentrate 1/10 volume. The cells were disrupted by ultrasonication. The lysate was harvested by centrifugation 10,000× g, 30 min, at 4 °C. The supernatant was filtered with 0.22 micrometer cellulose acetate membrane before passage through a Ni-NTA Sepharose column (GE, Boston, MA, USA). The column was washed with washing buffer (0.05 mol/L Tris-HCl buffer (pH 7.5), 0.5 mol/L NaCl, 20 mmol/L imidazole), and the recombinant alginate lyase AlgB was eluted with elution buffer (0.05 mol/L Tris-HCl buffer (pH 7.5), 0.5 mol/L NaCl, 0.3 mol/L imidazole). The eluate was dialyzed in 0.05 mol/L Tris-HCl buffer (pH 7.5) overnight and analyzed by 12% SDS-PAGE. The protein concentration was measured by the Bradford method.

3.7. Assay of the Recombinant Alginate Lyase Activity

The activity of the alginate lyase AlgB was measured in a mixture solution containing 1% (w/v) sodium alginate dissolved in 0.05 mol/L Tris-HCl buffer (pH 8.0) (0.9 mL) and enzyme solution (0.1 mL) at 40 °C for 30 min. Enzyme activity was calculated by constructing a standard curve with uronic acid under the same reaction conditions with DNS solution [36]. One unit (U) activity was defined as the amount of enzyme that generated 1 μg of uronic acid per min under standard assay conditions. In order to distinguish reaction products, the enzyme activity was also determined as the increase in the absorbance 235 nm to measure the amount of unsaturated uronic acid [15].

3.8. Characterization of the Recombinant Alginate Lyase Activity

The activity of AlgB at a specific pH range (3–10) and temperature range (4–90 °C) was determined by the enzyme assay described above using 1% alginate as substrate. The thermostability was evaluated by measuring the residual activity after different treatment time at different temperatures. Kinetic parameters of the enzyme towards alginate were calculated by the substrate at different concentrations (1–5 mg/mL). The enzyme activity was measured as described previously.
The effect of metal ions on the activity of AlgB was investigated. The reaction mixtures were added with different metal ions (KCl, MgSO4, ZnSO4, FeSO4, CuSO4, MnSO4, CaCl2, CoCl2 and NiCl2) to a final concentration of 10 mmol/L. The parallel reaction without metal ions served as the control. The activity on different concentrations of NaCl (1–5 mol/L) was also measured.

3.9. Substrate Specificity of the Recombinant Alginate Lyase Activity

The purified AlgB was added to the reaction mixture containing 1 mg/mL alginate, polyG and polyM, respectively. The average molecular weights of both polyG and polyM (Shanghai Yuanye Bio-Technology Co. Ltd., Shanghai, China) were 6–8 kDa.

3.10. Analysis of Reaction Mode and Products

The mixture of enzymatic products was purified by centrifugation (10,000 r/min, 30 min, 4 °C) after react 12 h at optimal conditions. The degraded products of AlgB were analyzed by thin-layer chromatography (TLC) (TLC Silica gel 60 F254, Merck KGaA, Darmstadt, Germany) [37]. The enzymatic products on silica gel plate were separated with a solvent solution of n-butyl alcohol/acetic acid/H2O (3:2:3) and visualized by heating 80 °C for 15 min after spraying a diphenylamine/aniline/phosphate (1:1:5) reagent. To further investigate the enzymatic products, ESI-QqQ-MS/MS was conducted. Five microliter samples were injected into a triple quadrupole tandem mass spectrometry (QqQ-MS/MS) (Aligent Technologies Inc., Palo Alto, CA, USA) after filtration with 0.22 µm cellulose acetate membrane. The products were detected in a negative ion mode using the following settings: pressure of the atomizer (N2), 50 psi; flow rate of the dryer (N2), 10 L/min; temperature of the dryer (N2), 350 °C; capillary voltage, 4000 V; scanning the mass range, 100–1000 m/z [25]. The viscosity of substrate was intermittently determined by viscometer (Shanghai Hengping No. NDJ-1, Shanghai, China) during reaction.

4. Conclusions

In this study, a novel alginate lyase of AlgB with high activity was obtained from Vibrio sp. Ni1. The purified recombinant enzyme of AlgB showed highest activity at 35 °C, pH 8.0, 50 mmol/L Tris-HCl without metal ions. The AlgB preferred polyM as substrate. The predominant end products of the enzymatic reaction are DP2 and DP3.
Some alginate lyases can catalyze the degradation in extreme environments. The optimal pH of A1m [38] and AlgNJ-07 [39] is 9.0 from Agarivorans sp. JAM and Serratia marcescens, respectively. The optima pH and temperature of AlyPL6 [14] and AlgH [40] is 45 °C, pH 10. The highest optima temperature of a known alginate lyase from PL7 family is 70 °C found in NitAly [41] and A1-II [42]. As reported here, AlgB can degrade alginate at a wide range of temperatures (20–60 °C) and pH (6–10). These properties are good for industrial applications.
Many organisms are reported to encode more than one alginate lyase gene, such as Vibrio splendidus OU02 [26,37], Vibrio splendidus 12B01 [25], Sphingomonas sp. A1 [42,43], Flavobacterium sp. UMI-01 [44], and Aplysia Kurodai [45]. As indicated in Figure 2, it is possible there are multiple alginate lyases in Vibrio sp. Ni. Work to identify additional alginate lyases from this strain are in progress.

Author Contributions

Conceptualization, L.S. and Z.H.; methodology, L.S. and M.H.; validation, L.S., M.H. and E.S.; formal analysis, M.H. and Y.H.; resources, X.H.; data curation, L.S., E.S. and X.H.; writing—original draft preparation, L.S.; writing—review and editing, Z.H.; supervision, Z.H.; project administration, X.G.; funding acquisition, Z.H. and X.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China, grant number 31772539 and Fujian Agriculture and Forestry University Construction Project for Technological Innovation and Service System of Tea Industry Chain, grant number K1520005A03.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on reasonable request from the corresponding author.

Acknowledgments

We thank for Marilyn Yoder for manuscript review, Chunji Gan for suggestion of study design, Zongwen Wang for ESI-Q-MS analysis and Hong Chen for providing the sodium alginate with high viscosity.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gacesa, P. Enzymic degradation of alginates. Int. J. Biochem. 1992, 24, 545–552. [Google Scholar] [CrossRef]
  2. Wong, T.Y.; Preston, L.A.; Schiller, N.L. Alginate Lyase: Review of Major Sources and Enzyme Characteristics, Structure-Function Analysis, Biological Roles, and Applications. Annu. Rev. Microbiol. 2000, 54, 289–340. [Google Scholar] [CrossRef]
  3. Cheng, D.; Jiang, C.; Xu, J.; Liu, Z.; Mao, X. Characteristics and applications of alginate lyases: A review. Int. J. Biol. Macromol. 2020, 164, 1304–1320. [Google Scholar] [CrossRef]
  4. Gacesa, P. Alginate-modifying enzymes: A proposed unified mechanism of action for the lyases and epimerases. FEBS Lett. 1987, 212, 199–202. [Google Scholar] [CrossRef] [Green Version]
  5. Boyd, A.; Ghosh, M.; May, T.B.; Shinabarger, D.; Keogh, R.; Chakrabarty, A. Sequence of the algL gene of Pseudomonas aeruginosa and purification of its alginate lyase product. Gene 1993, 131, 1–8. [Google Scholar] [CrossRef]
  6. Schiller, N.L.; Monday, S.R.; Boyd, C.M.; Keen, N.T.; Ohman, D.E. Characterization of the Pseudomonas aeruginosa alginate lyase gene (algL): Cloning, sequencing, and expression in Escherichia coli. J. Bacteriol. 1993, 175, 4780–4789. [Google Scholar] [CrossRef] [Green Version]
  7. Boyd, A.; Chakrabarty, A.M. Role of alginate lyase in cell detachment of Pseudomonas aeruginosa. Appl. Environ. Microbiol. 1994, 60, 2355–2359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Zhu, B.W.; Yin, H. Alginate lyase: Review of major sources and classification, properties, structure-function analysis and applications. Bioengineered 2015, 6, 125–131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Hicks, S.J.; Gacesa, P. Chemical modification of the alginate lyase from Klebsiella pneumoniae. Biochem. Soc. Trans. 1994, 22, 309S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Gimmestad, M.; Ertesvåg, H.; Heggeset, T.M.B.; Aarstad, O.; Svanem, B.I.G.; Valla, S. Characterization of Three New Azotobacter vinelandii Alginate Lyases, One of Which Is Involved in Cyst Germination. J. Bacteriol. 2009, 191, 4845–4853. [Google Scholar] [CrossRef] [Green Version]
  11. Nakagawa, A.; Ozaki, T.; Chubachi, K.; Hosoyama, T.; Okubo, T.; Iyobe, S.; Suzuki, T. An effective method for isolating alginate lyase-producing Bacillus sp. ATB-1015 strain and purification and characterization of the lyase. J. Appl. Microbiol. 1998, 84, 328–335. [Google Scholar] [CrossRef] [PubMed]
  12. Ryu, M.; Lee, E.Y. Saccharification of alginate by using exolytic oligoalginate lyase from marine bacterium Sphingomonas sp. MJ-3. J. Ind. Eng. Chem. 2011, 17, 853–858. [Google Scholar] [CrossRef]
  13. Lavín, P.; Atala, C.; Gallardo-Cerda, J.; Gonzalez-Aravena, M.; De La Iglesia, R.; Oses, R.; Torres-Díaz, C.; Trefault, N.; Molina-Montenegro, M.; Iv, H.D.L. Isolation and characterization of an Antarctic Flavobacterium strain with agarase and alginate lyase activities. Pol. Polar Res. 2016, 37, 403–419. [Google Scholar] [CrossRef]
  14. Li, Q.; Hu, F.; Wang, M.; Zhu, B.; Ni, F.; Yao, Z. Elucidation of degradation pattern and immobilization of a novel alginate lyase for preparation of alginate oligosaccharides. Int. J. Biol. Macromol. 2020, 146, 579–587. [Google Scholar] [CrossRef] [PubMed]
  15. Barzkar, N.; Sheng, R.; Sohail, M.; Jahromi, S.T.; Babich, O.; Sukhikh, S.; Nahavandi, R. Alginate Lyases from Marine Bacteria: An Enzyme Ocean for Sustainable Future. Molecules 2022, 27, 3375. [Google Scholar] [CrossRef] [PubMed]
  16. Eftekharzadeh, B.; Khodagholi, F.; Abdi, A.; Maghsoudi, N. Alginate protects NT2 neurons against H2O2-induced neurotoxicity. Carbohydr. Polym. 2010, 79, 1063–1072. [Google Scholar] [CrossRef]
  17. Zhou, R.; Shi, X.-Y.; Bi, D.-C.; Fang, W.-S.; Wei, G.-B.; Xu, X. Alginate-Derived Oligosaccharide Inhibits Neuroinflammation and Promotes Microglial Phagocytosis of β-Amyloid. Mar. Drugs 2015, 13, 5828–5846. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Chen, J.; Hu, Y.; Zhang, L.; Wang, Y.; Wang, S.; Zhang, Y.; Guo, H.; Ji, D.; Wang, Y. Alginate Oligosaccharide DP5 Exhibits Antitumor Effects in Osteosarcoma Patients following Surgery. Front. Pharmacol. 2017, 8, 623. [Google Scholar] [CrossRef]
  19. Han, Y.; Zhang, L.; Yu, X.; Wang, S.; Xu, C.; Yin, H.; Wang, S. RETRACTED ARTICLE: Alginate oligosaccharide attenuates α2,6-sialylation modification to inhibit prostate cancer cell growth via the Hippo/YAP pathway. Cell Death Dis. 2019, 10, 1–14. [Google Scholar] [CrossRef] [Green Version]
  20. Wan, J.; Zhang, J.; Chen, D.; Yu, B.; Mao, X.; Zheng, P.; Yu, J.; Luo, J.; He, J. Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs. J. Anim. Sci. Biotechnol. 2018, 9, 1–12. [Google Scholar] [CrossRef] [Green Version]
  21. Li, T.; Huang, S.; Wang, J.; Yin, P.; Liu, H.; Sun, C. Alginate oligosaccharides protect against fumonisin B1-induced intestinal damage via promoting gut microbiota homeostasis. Food Res. Int. 2021, 152, 110927. [Google Scholar] [CrossRef] [PubMed]
  22. Iacob, A.-T.; Drăgan, M.; Ionescu, O.-M.; Profire, L.; Ficai, A.; Andronescu, E.; Confederat, L.G.; Lupașcu, D. An Overview of Biopolymeric Electrospun Nanofibers Based on Polysaccharides for Wound Healing Management. Pharmaceutics 2020, 12, 983. [Google Scholar] [CrossRef] [PubMed]
  23. Yamasaki, M.; Ogura, K.; Hashimoto, W.; Mikami, B.; Murata, K. A Structural Basis for Depolymerization of Alginate by Polysaccharide Lyase Family-7. J. Mol. Biol. 2005, 352, 11–21. [Google Scholar] [CrossRef]
  24. Xu, F.; Wang, P.; Zhang, Y.-Z.; Chen, X.-L. Diversity of Three-Dimensional Structures and Catalytic Mechanisms of Alginate Lyases. Appl. Environ. Microbiol. 2018, 84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Badur, A.H.; Jagtap, S.S.; Yalamanchili, G.; Lee, J.-K.; Zhao, H.; Rao, C.V. Alginate Lyases from Alginate-Degrading Vibrio splendidus 12B01 Are Endolytic. Appl. Environ. Microbiol. 2015, 81, 1865–1873. [Google Scholar] [CrossRef] [Green Version]
  26. Zhuang, J.; Zhang, K.; Liu, X.; Liu, W.; Lyu, Q.; Ji, A. Characterization of a Novel PolyM-Preferred Alginate Lyase from Marine Vibrio splendidus OU02. Mar. Drugs 2018, 16, 295. [Google Scholar] [CrossRef] [Green Version]
  27. Wang, Y.-H.; Yu, G.-L.; Wang, X.-M.; Lv, Z.-H.; Zhao, X.; Wu, Z.-H.; Ji, W.-S. Purification and Characterization of Alginate Lyase from Marine Vibrio sp. YWA. Acta Biochim. Biophys. Sin. 2006, 38, 633–638. [Google Scholar] [CrossRef] [Green Version]
  28. Fu, X.T.; Lin, H.; Kim, S.M. Purification and characterization of a Na+/K+ dependent alginate lyase from turban shell gut Vibrio sp. YKW-34. Enzym. Microb. Technol. 2007, 41, 828–834. [Google Scholar] [CrossRef]
  29. Zhu, B.; Tan, H.; Qin, Y.; Xu, Q.; Du, Y.; Yin, H. Characterization of a new endo-type alginate lyase from Vibrio sp. W13. Int. J. Biol. Macromol. 2015, 75, 330–337. [Google Scholar] [CrossRef]
  30. Zhu, B.; Ni, F.; Ning, L.; Sun, Y.; Yao, Z. Cloning and characterization of a new pH-stable alginate lyase with high salt tolerance from marine Vibrio sp. NJ-04. Int. J. Biol. Macromol. 2018, 115, 1063–1070. [Google Scholar] [CrossRef]
  31. Chao, Y.X.; Wang, S.Y.; Wu, S.Q.; Wei, J.Q.; Chen, H. Cloning and characterization of a new endo-type polyG-specific alginate lyase from bacteria Vibrio sp. QD-5. Acta Oceanol. Sin. 2019, 38, 65–74. [Google Scholar] [CrossRef]
  32. Fineberg, S.J.; Nandyala, S.V.; Marquez-Lara, A. Preparation of trisaccharides from alginate by a novel alginate lyase Alg7A from marine bacterium Vibrio sp. W13. Int. J. Biol. Macromol. 2019, 139, 879–885. [Google Scholar] [CrossRef]
  33. Wang, M.; Chen, L.; Zhang, Z.; Wang, X.; Qin, S.; Yan, P. Screening of alginate lyase-excreting microorganisms from the surface of brown algae. AMB Express 2017, 7, 74–82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Tan, G.; Gao, Y.; Shi, M.; Zhang, X.; He, S.; Chen, Z.; An, C. SiteFinding-PCR: A simple and efficient PCR method for chromosome walking. Nucleic Acids Res. 2005, 33, e122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Ping, L.; Vogel, H.; Boland, W. Cloning of prokaryotic genes by a universal degenerate primer PCR. FEMS Microbiol. Lett. 2008, 287, 192–198. [Google Scholar] [CrossRef] [PubMed]
  36. Hou, B.B.; Liu, S.L.; Zhang, J.Y.; Bao, H.F.; Ding, Y.T. Optimization of alginate-degrading bacterial fermentation process for alginate lyase production. Fish. Sci. 2009, 28, 667–670. (In Chinese) [Google Scholar]
  37. Lyu, Q.; Zhang, K.; Shi, Y.; Li, W.; Diao, X.; Liu, W. Structural insights into a novel Ca2+-independent PL-6 alginate lyase from Vibrio OU02 identify the possible subsites responsible for product distribution. Biochim. et Biophys. Acta (BBA)-Gen. Subj. 2019, 1863, 1167–1176. [Google Scholar] [CrossRef]
  38. Kobayashi, T.; Uchimura, K.; Miyazaki, M.; Nogi, Y.; Horikoshi, K. A new high-alkaline alginate lyase from a deep-sea bacterium Agarivorans sp. Extremophiles 2008, 13, 121–129. [Google Scholar] [CrossRef]
  39. Zhu, B.W.; Hu, F.; Yuan, H.; Sun, Y.; Yao, Z. Biochemical characterization and degradation pattern of a unique pH-stable polyM-specific alginate lyase from newly isolated Serratia marcescens NJ-07. Mar. Drugs 2018, 16, 129. [Google Scholar] [CrossRef] [Green Version]
  40. Yan, J.; Chen, P.; Zeng, Y.; Men, Y.; Mu, S.; Zhu, Y.; Chen, Y.; Sun, Y. The Characterization and Modification of a Novel Bifunctional and Robust Alginate Lyase Derived from Marinimicrobium sp. H1. Mar. Drugs 2019, 17, 545. [Google Scholar] [CrossRef] [Green Version]
  41. Inoue, A.; Anraku, M.; Nakagawa, S.; Ojima, T. Discovery of a Novel Alginate Lyase from Nitratiruptor sp. SB155-2 Thriving at Deep-sea Hydrothermal Vents and Identification of the Residues Responsible for Its Heat Stability. J. Biol. Chem. 2016, 291, 15551–15563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Yoon, H.-J.; Hashimoto, W.; Miyake, O.; Okamoto, M.; Mikami, B.; Murata, K. Overexpression in Escherichia coli, Purification, and Characterization of Sphingomonas sp. A1 Alginate Lyases. Protein Expr. Purif. 2000, 19, 84–90. [Google Scholar] [CrossRef] [PubMed]
  43. Hashimoto, W.; Miyake, O.; Ochiai, A.; Murata, K. Molecular identification of Sphingomonas sp. A1 alginate lyase (A1-IV’) as a member of novel polysaccharide lyase family 15 and implications in alginate lyase evolution. J. Biosci. Bioeng. 2005, 99, 48–54. [Google Scholar] [CrossRef]
  44. Inoue, A.; Nishiyama, R.; Ojima, T. The alginate lyases FlAlyA, FlAlyB, FlAlyC, and FlAlex from Flavobacterium sp. UMI-01 have distinct roles in the complete degradation of alginate. Algal Res. 2016, 19, 355–362. [Google Scholar] [CrossRef]
  45. Rahman, M.M.; Inoue, A.; Tanaka, H.; Ojima, T. Isolation and characterization of two alginate lyase isozymes, AkAly28 and AkAly33, from the common sea hare Aplysia kurodai. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2010, 157, 317–325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Marinedrugs 20 00479 g001 550
Figure 1. Halos on alginate plate formation by Vibrio sp. Ni1. Note: The different colors depend on the degree of degradation of algin.
Figure 1. Halos on alginate plate formation by Vibrio sp. Ni1. Note: The different colors depend on the degree of degradation of algin.
Marinedrugs 20 00479 g001
Marinedrugs 20 00479 g002 550
Figure 2. SDS-PAGE analysis of extracellular protein Vibrio sp. Ni1. Lane M: Protein Marker; Lane 1: the proteins purified by the 70% ammonium sulfate precipitation.
Figure 2. SDS-PAGE analysis of extracellular protein Vibrio sp. Ni1. Lane M: Protein Marker; Lane 1: the proteins purified by the 70% ammonium sulfate precipitation.
Marinedrugs 20 00479 g002
Marinedrugs 20 00479 g003 550
Figure 3. The PCR amplification of full-length algB gene. Lane M: DNA Marker; Lane 1: The product of full-length algB gene; Lane2: negative control.
Figure 3. The PCR amplification of full-length algB gene. Lane M: DNA Marker; Lane 1: The product of full-length algB gene; Lane2: negative control.
Marinedrugs 20 00479 g003
Marinedrugs 20 00479 g004 550
Figure 4. Sequence analysis and structure prediction of AlgB. (a) Multiple sequence alignment of AlgB and related alginate lyases (AIY22661.1 WP_118120558.1). The peptide sequences which match the results of LC-MS/MS are marked with red boxes. The conservative sequences of PL7 family catalytic domain are marked with blue or purple boxes. The predicted catalytic centers are marked with ★. (b) Functional domains of AlgB. (c) Schematic diagram of AlgB. The predicted structure of AlgB has two domains. The red domain (on left) is on N-terminal (residue 78–310), the green domain (on right) is on the C-terminal (residue 319–606). The N- and C-terminal amino acid residues are labeled Met1 and Leu607.
Figure 4. Sequence analysis and structure prediction of AlgB. (a) Multiple sequence alignment of AlgB and related alginate lyases (AIY22661.1 WP_118120558.1). The peptide sequences which match the results of LC-MS/MS are marked with red boxes. The conservative sequences of PL7 family catalytic domain are marked with blue or purple boxes. The predicted catalytic centers are marked with ★. (b) Functional domains of AlgB. (c) Schematic diagram of AlgB. The predicted structure of AlgB has two domains. The red domain (on left) is on N-terminal (residue 78–310), the green domain (on right) is on the C-terminal (residue 319–606). The N- and C-terminal amino acid residues are labeled Met1 and Leu607.
Marinedrugs 20 00479 g004
Marinedrugs 20 00479 g005 550
Figure 5. SDS-PAGE analysis of purified recombinant AlgB. Proteins were electrophoresed on 10% gel and stained with CCB G250. Lane M, protein marker; Lane1, total soluble proteins after cell rupture; Lane2, purified AlgB by Ni-column.
Figure 5. SDS-PAGE analysis of purified recombinant AlgB. Proteins were electrophoresed on 10% gel and stained with CCB G250. Lane M, protein marker; Lane1, total soluble proteins after cell rupture; Lane2, purified AlgB by Ni-column.
Marinedrugs 20 00479 g005
Marinedrugs 20 00479 g006 550
Figure 6. The changes of A235 during the process of degradation.
Figure 6. The changes of A235 during the process of degradation.
Marinedrugs 20 00479 g006
Marinedrugs 20 00479 g007 550
Figure 7. The effect of pH on the enzyme activity of AlgB. Reactions were conducted at 40 °C for 30 min in 50 mmol/L Tris-HCl buffer with a pH range 3–10. The data represent the mean of three experimental repeats with SD < 5%.
Figure 7. The effect of pH on the enzyme activity of AlgB. Reactions were conducted at 40 °C for 30 min in 50 mmol/L Tris-HCl buffer with a pH range 3–10. The data represent the mean of three experimental repeats with SD < 5%.
Marinedrugs 20 00479 g007
Marinedrugs 20 00479 g008 550
Figure 8. The effect of temperature on the activity of AlgB. (a) The optimal temperature of AlgB. Reactions were conducted in 50 mmol/L Tris-HCl buffer (pH 8.0) at 4–90 °C for 30 min. (b) Thermal stability of AlgB. Black square (■) represents at 30 °C and red dot (●) represents at 40 °C. The activity of AlgB measured in 35 °C and pH 8.0 was taken as 100%. The data represent the mean of three experimental replicates with SD < 5%.
Figure 8. The effect of temperature on the activity of AlgB. (a) The optimal temperature of AlgB. Reactions were conducted in 50 mmol/L Tris-HCl buffer (pH 8.0) at 4–90 °C for 30 min. (b) Thermal stability of AlgB. Black square (■) represents at 30 °C and red dot (●) represents at 40 °C. The activity of AlgB measured in 35 °C and pH 8.0 was taken as 100%. The data represent the mean of three experimental replicates with SD < 5%.
Marinedrugs 20 00479 g008
Marinedrugs 20 00479 g009 550
Figure 9. The effects of metal ions on the activity of AlgB. (a) Different metal ions on the activity of AlgB. The enzyme activity was measured at 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) containing 10 mmol/L metal ions. (b) The effect of NaCl concentration on the activity of AlgB. The enzyme activity was measured at 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) containing 1–5 mol/L NaCl. The activity of AlgB measured in 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) without any metal ions was taken as 100%. The data represents the mean of three experimental repeats with SD ≤ 5%.
Figure 9. The effects of metal ions on the activity of AlgB. (a) Different metal ions on the activity of AlgB. The enzyme activity was measured at 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) containing 10 mmol/L metal ions. (b) The effect of NaCl concentration on the activity of AlgB. The enzyme activity was measured at 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) containing 1–5 mol/L NaCl. The activity of AlgB measured in 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) without any metal ions was taken as 100%. The data represents the mean of three experimental repeats with SD ≤ 5%.
Marinedrugs 20 00479 g009
Marinedrugs 20 00479 g010 550
Figure 10. Lineweaver-Burke plots for the degradation of alginate by AlgB. Enzyme activity was determined at different alginate concentration of 1.0–5.0 mg/mL, 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) according to Nelson method. The data represents the mean of three experimental repeats with SD ≤ 5%.
Figure 10. Lineweaver-Burke plots for the degradation of alginate by AlgB. Enzyme activity was determined at different alginate concentration of 1.0–5.0 mg/mL, 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) according to Nelson method. The data represents the mean of three experimental repeats with SD ≤ 5%.
Marinedrugs 20 00479 g010
Marinedrugs 20 00479 g011 550
Figure 11. Substrate specificity of AlgB. The concentration of substrate was 1 mg/mL. The activity measured in 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) using sodium alginate as substrate was taken as 100%. The data represent the mean of three experimental repeats with SD ≤ 5%.
Figure 11. Substrate specificity of AlgB. The concentration of substrate was 1 mg/mL. The activity measured in 35 °C and 50 mmol/L Tris-HCl buffer (pH 8.0) using sodium alginate as substrate was taken as 100%. The data represent the mean of three experimental repeats with SD ≤ 5%.
Marinedrugs 20 00479 g011
Marinedrugs 20 00479 g012 550
Figure 12. TLC analysis of degradation products of AlgB towards sodium alginate. Lane 1, the enzymatic products after reaction with AlgB for 12 h; Lane 2, mannuronic acid.
Figure 12. TLC analysis of degradation products of AlgB towards sodium alginate. Lane 1, the enzymatic products after reaction with AlgB for 12 h; Lane 2, mannuronic acid.
Marinedrugs 20 00479 g012
Marinedrugs 20 00479 g013a 550Marinedrugs 20 00479 g013b 550
Figure 13. ESI−Q−TOF analyses of the end products of AlgB. The enzymatic products were harvested after AlgB incubation for 12 h. (a) sodium alginate, (b) polyM, and (c) polyG. DP indicates the degree of depolymerization of oligosaccharides released from the substrate.
Figure 13. ESI−Q−TOF analyses of the end products of AlgB. The enzymatic products were harvested after AlgB incubation for 12 h. (a) sodium alginate, (b) polyM, and (c) polyG. DP indicates the degree of depolymerization of oligosaccharides released from the substrate.
Marinedrugs 20 00479 g013aMarinedrugs 20 00479 g013b
Marinedrugs 20 00479 g014 550
Figure 14. Viscosity variation during enzymatic degradation of alginate. The viscosity was measured in a 100 mL reaction system with 1% (w/v) sodium alginate, 50 mmol/L Tris-HCl buffer (pH 8.0) and RT. The data represents the mean of three repeats with SD ≤ 5%.
Figure 14. Viscosity variation during enzymatic degradation of alginate. The viscosity was measured in a 100 mL reaction system with 1% (w/v) sodium alginate, 50 mmol/L Tris-HCl buffer (pH 8.0) and RT. The data represents the mean of three repeats with SD ≤ 5%.
Marinedrugs 20 00479 g014
Table
Table 1. The analysis of alginate-degraded zones produced by Vibrio sp. Ni1.
Table 1. The analysis of alginate-degraded zones produced by Vibrio sp. Ni1.
No.Colony Diameter/cmAlginate-Degraded Circle Diameter/cmRatio
11.134.584.05
21.024.824.72
30.864.625.37
Average value1.004.674.67
Table
Table 2. The details of matched peptide sequences.
Table 2. The details of matched peptide sequences.
No.Peptides Seq.Candidate Protein IDLength
1NSITGHYWAVVKAIY22661.112
2AGVYNQFENGEAKAIY22661.113
3LLWEGDNKPVRAIY22661.111
4VVWEQERWP_118120558.17
5AGVYNQFENGEAKWP_118120558.113
6ADMGYGTSTENSSYIRWP_118120558.116
Table
Table 3. The summary of some alginate lyases reported from Vibrio.
Table 3. The summary of some alginate lyases reported from Vibrio.
Protein NameMolecular Mass (kDa)Optimal pH/Temperature (°C)Substrate SpecificityEnzymatic ProductActivating CationReference
AlyA67.48.5/25alginate, polyM DP1–4Na+, Ca2+[25]
AlyB57.57.5/20–25polyG DP1–5Na+, Ca2+[25]
AlyA-OU02658.0/30polyMDP2–4Mg2+, Fe2+ [26]
alginate lyase 62.57.0/25polyM/Zn2+[27]
alginate lyase 607.0/40polyMG/Na+, K+[28]
Algb558.0/30polyMG,DP2–5Na+, Mg2+ Ca2+, Fe2+ Co2+[29]
AlgNJ04507.0/40polyGDP2–5Na+, K+, Ca2+[30]
Aly-IV628.9/35alginateDP2–3K+, Mg2+[31]
Alg7A 567.0/30polyMG, alginateDP2–6Ca2+, K+, Na+, Ba2+, Co2+, Mn2+[32]
AlgB67.78.0/35polyMDP2–3Not foundThis study
Table
Table 4. Primers used for cloning algB.
Table 4. Primers used for cloning algB.
NameSequenceProduct
algB-F0GTGGTBTGGGAACARGARPartial algB fragment
algB-R0YGGTTTRTTATCRCCYTCCCA
SP1CTCCACCCGTCCCATACCAAGAATUpstream flank sequences
SP2GCACCTTCGCCTCGCCATTTTCAA
SP3AGTTGTCGAGGTCAGCTTCACCT
P1ACCCATTACTGCGGGTTGTTTGGGADownstream flank sequences
P2AATGGCGAGGCGAAGGTGCAATTTA
P3AGACCCAGATTGTAGCACCAGTGATG
algB-QFCGCGGATCCATGAATTCAGCAAAACTTATTTTGGTFull algB
gene
algB-QRCCGCTCGAGCTACAGATGATTTACGTTCAAAGAGC
Notes: the underline is restriction enzyme site.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sha, L.; Huang, M.; Huang, X.; Huang, Y.; Shao, E.; Guan, X.; Huang, Z. Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1. Mar. Drugs 2022, 20, 479. https://doi.org/10.3390/md20080479

AMA Style

Sha L, Huang M, Huang X, Huang Y, Shao E, Guan X, Huang Z. Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1. Marine Drugs. 2022; 20(8):479. https://doi.org/10.3390/md20080479

Chicago/Turabian Style

Sha, Li, Minghai Huang, Xiaonan Huang, Yongtong Huang, Ensi Shao, Xiong Guan, and Zhipeng Huang. 2022. "Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1" Marine Drugs 20, no. 8: 479. https://doi.org/10.3390/md20080479

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop