Anabolic Steroids Activate the NF-κB Pathway in Porcine Ovarian Putative Stem Cells Independently of the ZIP-9 Receptor
Abstract
:1. Introduction
2. Results
2.1. Exposure of poPSCs to Bdn or Ndn Has Impact Not Only on the Proteomic Profiles of NF-kB Pathway Representatives and ZIP-9 Receptor but Also on the Levels of Phosphorylated Forms of IκBα and RelA Proteins
2.2. Immunofluorescent Localization of NF-κB Pathway Proteins in poPSCs Cultured in the Presence of Ndn or Bdn
2.3. The Effects of Bdn or Ndn Treatments on the Concentration of NF-κB Pathway Proteins in poPSCs Cultured in the Presence of Selected AASs for 7 and 14 Days
2.4. Analysis of the Expression Profiles for NFKBIA, RELA, NFKB1, and SLC39A9 Genes in poPSCs Treated with AASs for 7 and 14 Days
3. Discussion
4. Materials and Methods
4.1. Collection of Porcine Ovaries and Subsequent Isolation of poPSCs
4.2. Culture of poPSCs in the Presence of Selected Doses of Nandrolone or Boldenone
4.3. Immunofluorocytochemistry-Based Analyses
4.4. Western Blot Analysis
4.5. Total RNA Isolation and cDNA Synthesis
4.6. Quantitative Real-Time qPCR
4.7. ELISA Assays
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
A20/TNIP2 | A20/tumour necrosis factor (TNF)-interacting protein 2 |
AASs | Anabolic androgenic steroids |
Akt | A member of serine/threonine-specific protein kinase family (also known as protein kinase B; PKB) that plays a pivotal function in controlling the molecular balance between survival and death pathways in cells |
AR | Androgen receptor |
ASCs | Adult stem cells |
ATF-1 | Cyclic AMP-dependent transcription factor ATF-1 |
Bdn | Boldenone |
BIRC2 | Baculoviral IAP repeat-containing protein 2 |
cAMP | Cyclic adenosine monophosphate |
CFLAR | CASP8 and FADD-like apoptosis regulator |
COX-2 | Cyclooxygenase-2 |
CREB | cAMP response element-binding protein |
CSCs | Cancer stem cells |
ENG | Endoglin |
ERK1/2 | Extracellular signal-regulated protein kinases 1 and 2; also known as p44 mitogen-activated protein (MAP) kinase (a 44-kDa isoform of MAPK) and p42 mitogen-activated protein (MAP) kinase (a 42-kDa isoform of MAPK), respectively |
ESCs | Embryonic stem cells |
FSCs | Fetal stem cells |
HUVEC | Human umbilical vein endothelial cells |
HRP | Horseradish peroxidase |
IARC | International Agency for Research on Cancer) |
ICC | Immunocytochemistry |
IκBα | Nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, α |
IκBβ | Nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, β |
IKK | IκB kinase |
IL-4 | Interleukin 4 |
ITGB1 | Integrin β1 |
mAR | Membrane androgen receptors |
MSCs | Mesenchymal stem cells |
Ndn | Nandrolone |
NF-κB1 | Nuclear factor NF-κB p105 subunit |
NF-κB2 | Nuclear factor NF-κB p100 subunit |
NF-κB | Nuclear factor-κB (nuclear factor κ-light-chain-enhancer of activated B cells); a pleiotropic inducible transcription factor that occurs in almost all cell types and is the endpoint of a series of signal transduction events that are initiated by a vast array of stimuli related to many biological processes such as cytodifferentiation, cell growth, tumorigenesis, apoptosis, inflammation, and immunity |
NLS | Nuclear localization sequence |
PI3K | Phosphatidylinositol 3-kinase; a downstream kinase activated by receptor tyrosine kinases that generates a series of phosphorylated phosphoinositides, which recruit 3-phosphoinositide-dependent protein kinase-1 (PDPK1) activity to the plasma membrane, leading to activation of Akt |
poPSCs | Porcine ovarian putative stem cells |
PSCs | Putative stem cells |
Rel | c-Rel; protein encoded by a protooncogene REL; represents a subunit of a homo- or heterodimeric complex designated as NF-κB and, simultaneously, exhibits the properties of DNA-binding transcription factor activity and chromatin binding; etymology of the name assigned to this protein stems from the involvement of Rel in the etiopathogenesis of the avian viral disease known as reticuloendotheliosis associated with the development of B- and T-cell lymphomas; a protein belonging to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family of ubiquitous NF-κB transcription factors, whose members regulate genes engaged in apoptosis, inflammation, the immune response, and oncogenic processes |
RelA | Transcription factor p65 |
RelB | Transcription factor RelB |
ROS | Reactive oxygen species |
SCs | Stem cells |
SD | Standard deviation |
SSEA-4 | Stage-specific embryonic antigen-4 |
STAT6 | Signal transducer and activator of transcription 6 |
TAD | C-terminal transactivation domain |
THY | Thymocyte differentiation antigen |
WB | Western blot |
WBff | Wash buffer |
ZIP-9 | Zinc transporter member 9; also designated as solute carrier family 39 member 9 (SLC39A9) or transmembrane zinc-influx transporter (Zrt)- and transmembrane iron-influx transporter (Irt)-like protein (ZIP) 9; Zrt- and Irt-like protein 9; represents both zinc (Zn2+)-iron (Fe2+) permease (ZIP) family and a novel membrane androgen receptor (mAR) family related to the extranuclear action of androgens |
References
- Sen, R.; Baltimore, D. Inducibility of κ immunoglobulin enhancer-binding protein NF-κB by a posttranslational mechanism. Cell 1986, 47, 921–928. [Google Scholar] [CrossRef] [PubMed]
- Nabel, G.J.; Verma, I.M. Proposed NF-κB/IκB family nomenclature. Genes Dev. 1993, 7, 2063. [Google Scholar] [CrossRef]
- Biancalana, M.; Natan, E.; Lenardo, M.J.; Fersht, A.R. NF-κB Rel subunit exchange on a physiological timescale. Protein Sci. 2021, 30, 1818–1832. [Google Scholar] [CrossRef]
- Hayden, M.S.; Ghosh, S. NF-κB, the first quarter-century: Remarkable progress and outstanding questions. Genes Dev. 2012, 26, 203–234. [Google Scholar] [CrossRef]
- May, M.J.; Ghosh, S. Rel/NF-κB and IκB proteins: An overview. Semin. Cancer Biol. 1997, 8, 63–73. [Google Scholar] [CrossRef] [PubMed]
- Marienfeld, R.; May, M.J.; Berberich, I.; Serfling, E.; Ghosh, S.; Neumann, M. RelB forms transcriptionally inactive complexes with RelA/p65. J. Biol. Chem. 2003, 278, 19852–19860. [Google Scholar] [CrossRef] [PubMed]
- Nakajima, S.; Kitamura, M. Bidirectional regulation of NF-κB by reactive oxygen species: A role of unfolded protein response. Free Radic. Biol. Med. 2013, 65, 162–174. [Google Scholar] [CrossRef]
- Lin, T.H.; Tamaki, Y.; Pajarinen, J.; Waters, H.A.; Woo, D.K.; Yao, Z.; Goodman, S.B. Chronic inflammation in biomaterial-induced periprosthetic osteolysis: NF-κB as a therapeutic target. Acta Biomater. 2014, 10, 1–10. [Google Scholar] [CrossRef]
- Li, X.; Stark, G.R. NFκB-dependent signalling pathways. Exp. Hematol. 2002, 30, 285–296. [Google Scholar] [CrossRef]
- Sempere, M.C.; Fanjul, V.R.; Pérez, I.S.; Perona, R. The role of the NFκB signalling pathway in cancer. Clin. Transl. Oncol. 2008, 10, 143–147. [Google Scholar] [CrossRef]
- Lee, C.H.; Jeon, Y.T.; Kim, S.H.; Song, Y.S. NF-κB as a potential molecular target for cancer therapy. Biofactors 2007, 29, 19–35. [Google Scholar] [CrossRef] [PubMed]
- Skórka, K.; Giannopoulos, K. The structure and the role of NF-κB proteins and their significance in chronic lymphocytic leukemia. Acta Haematol. Pol. 2012, 43, 54–62. [Google Scholar] [CrossRef]
- Hoesel, B.; Schmid, J.A. The complexity of NF-κB signalling in inflammation and cancer. Mol. Cancer 2013, 12, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Shen, S.; Verma, I.M. NF-κB, an active player in human cancers. Cancer Immunol. Res. 2014, 2, 823–830. [Google Scholar] [CrossRef] [PubMed]
- Bahrke, M.S.; Yesalis, C.E. Abuse of anabolic androgenic steroids and related substances in sport and exercise. Curr. Opin. Pharmacol. 2004, 4, 614–620. [Google Scholar] [CrossRef]
- Simão, V.A.; Berloffa Belardin, L.; Araujo Leite, G.A.; de Almeida Chuffa, L.G.; Camargo, I.C.C. Effects of different doses of nandrolone decanoate on estrous cycle and ovarian tissue of rats after treatment and recovery periods. Int. J. Exp. Pathol. 2015, 96, 338–349. [Google Scholar] [CrossRef]
- Combarnous, Y.; Nguyen, T.M.D. Comparative overview of the mechanisms of action of hormones and endocrine disruptor compounds. Toxics 2019, 7, 5. [Google Scholar] [CrossRef]
- Souza, J.P.; Cerqueira, E.D.M.M.; Meireles, J.R.C. Chromosome damage, apoptosis, and necrosis in exfoliated cells of oral mucosa from androgenic anabolic steroids users. J. Toxicol. Environ. Health A 2015, 78, 67–77. [Google Scholar] [CrossRef] [PubMed]
- Elks, J.; Ganellin, C.R. The Dictionary of Drugs: Chemical Data: Chemical Data, Structures and Bibliographies, 1st ed.; Springer Science and Business Media: Berlin/Heidelberg, Germany, 1990; pp. 44, 209, 408, 410, 640, 660. [Google Scholar]
- Llewellyn, W. Part III: Drug profiles. In Anabolics; Llewellyn, W., Ed.; Molecular Nutrition LLC: Jupiter, FL, USA, 2011; pp. 739–780. [Google Scholar]
- Forbes, G.B. The effect of anabolic steroids on lean body mass: The dose response curve. Metabolism 1985, 34, 571–573. [Google Scholar] [CrossRef] [PubMed]
- Patanè, F.G.; Liberto, A.; Maria Maglitto, A.N.; Malandrino, P.; Esposito, M.; Amico, F.; Cocimano, G.; Rosi, G.L.; Condorelli, D.; Nunno, N.D.; et al. Nandrolone Decanoate: Use, Abuse and Side Effects. Medicina 2020, 56, 606. [Google Scholar] [CrossRef] [PubMed]
- Far, H.R.M.; Ågren, G.; Lindqvist, A.S.; Marmendal, M.; Fahlke, C.; Thiblin, I. Administration of the anabolic androgenic steroid nandrolone decanoate to female rats causes alterations in the morphology of their uterus and a reduction in reproductive capacity. Eur. J. Obstet. Gynecol. Reprod. Biol. 2007, 131, 189–197. [Google Scholar]
- de Almeida Chuffa, L.G.; de Souza, R.B.; Frei, F.; de Fátima Paccola Mesquita, S.; Camargo, I.C.C. Nandrolone decanoate and physical effort: Histological and morphometrical assessment in adult rat uterus. Anat. Rec. 2011, 294, 335–341. [Google Scholar] [CrossRef] [PubMed]
- Karbalay-Doust, S.; Noorafshan, A. Stereological estimation of ovarian oocyte volume, surface area and number: Application on mice treated with nandrolone decanoate. Folia Histochem. Cytobiol. 2012, 50, 275–279. [Google Scholar] [CrossRef] [PubMed]
- Mesbah, F.; Bordbar, H.; Talaei Khozani, T.; Dehghani, F.; Mirkhani, H. The non-preventive effects of human menopausal gonadotropins on ovarian tissues in Nandrolone decanoate-treated female rats: A histochemical and ultra-structural study. Int. J. Reprod. Biomed. 2018, 16, 159–174. [Google Scholar] [CrossRef]
- Agriesti, F.; Tataranni, T.; Pacelli, C.; Scrima, R.; Laurenzana, I.; Ruggieri, V.; Cela, O.; Mazzoccoli, C.; Salerno, M.; Sessa, F.; et al. Nandrolone induces a stem cell-like phenotype in human hepatocarcinoma-derived cell line inhibiting mitochondrial respiratory activity. Sci. Rep. 2020, 10, 2287. [Google Scholar] [CrossRef]
- Gorczyca, G.; Wartalski, K.; Wiater, J.; Samiec, M.; Tabarowski, Z.; Duda, M. Anabolic steroids-driven regulation of porcine ovarian putative stem cells favors the onset of their neoplastic transformation. Int. J. Mol. Sci. 2021, 22, 11800. [Google Scholar] [CrossRef]
- Odorico, J.S.; Kaufman, D.S.; Thomson, J.A. Multilineage differentiation from human embryonic stem cell lines. Stem Cells 2001, 19, 193–204. [Google Scholar] [CrossRef]
- Grompe, M. Adult versus embryonic stem cells: It’s still a tie. Mol. Ther. 2002, 6, 303–305. [Google Scholar] [CrossRef]
- Wagers, A.J.; Weissman, I.L. Plasticity of adult stem cells. Cell 2004, 116, 639–648. [Google Scholar] [CrossRef]
- Galliot, B.; Ghila, L. Cell plasticity in homeostasis and regeneration. Mol. Reprod. Dev. 2010, 77, 837–855. [Google Scholar] [CrossRef] [PubMed]
- Catacchio, I.; Berardi, S.; Reale, A.; De Luisi, A.; Racanelli, V.; Vacca, A.; Ria, R. Evidence for bone marrow adult stem cell plasticity: Properties, molecular mechanisms, negative aspects, and clinical applications of hematopoietic and mesenchymal stem cells transdifferentiation. Stem Cells Int. 2013, 2013, 589139. [Google Scholar] [CrossRef] [PubMed]
- NIH Stem Cell Information Home Page. In Stem Cell Information [World Wide Web Site]; National Institutes of Health, U.S. Department of Health and Human Services: Bethesda, MD, USA, 2016; [cited 1 February 2021].
- Morrison, S.J.; Spradling, A.C. Stem cells and niches: Mechanisms that promote stem cell maintenance throughout life. Cell 2008, 132, 598–611. [Google Scholar] [CrossRef]
- Wartalski, K.; Tabarowski, Z.; Duda, M. Magnetic isolation and characterization of porcine ovarian putative stem cells (PSCs): An in vitro study. JFIV Reprod. Med. Genet. 2016, 4, 191. [Google Scholar]
- Yazdekhasti, H.; Hosseini, M.A.; Rajabi, Z.; Parvari, S.; Salehnia, M.; Koruji, M.; Izadyar, F.; Aliakbari, F.; Abbasi, M. Improved isolation, proliferation, and differentiation capacity of mouse ovarian putative stem cells. Cell. Reprogram. 2017, 19, 132–144. [Google Scholar] [CrossRef]
- Patel, H.; Bhartiya, D.; Parte, S. Further characterization of adult sheep ovarian stem cells and their involvement in neo-oogenesis and follicle assembly. J. Ovarian Res. 2018, 11, 1–19. [Google Scholar] [CrossRef]
- Wartalski, K.; Gorczyca, G.; Wiater, J.; Tabarowski, Z.; Palus-Chramiec, K.; Setkowicz, Z.; Duda, M. Efficient generation of neural-like cells from porcine ovarian putative stem cells—Morphological characterization and evaluation of their electrophysiological properties. Theriogenology 2020, 155, 256–268. [Google Scholar] [CrossRef]
- Wartalski, K.; Gorczyca, G.; Wiater, J.; Tabarowski, Z.; Duda, M. Porcine ovarian cortex-derived putative stem cells can differentiate into endothelial cells in vitro. Histochem. Cell Biol. 2021, 156, 349–362. [Google Scholar] [CrossRef]
- Baba, T.; Convery, P.A.; Matsumura, N.; Whitaker, R.S.; Kondoh, E.; Perry, T.; Huang, Z.; Bentley, R.C.; Mori, S.; Fujii, S.; et al. Epigenetic regulation of CD133 and tumorigenicity of CD133+ ovarian cancer cells. Oncogene 2009, 28, 209–218. [Google Scholar] [CrossRef]
- Chang, C.Y.; Hsuuw, Y.D.; Huang, F.J.; Shyr, C.R.; Chang, S.Y.; Huang, C.K.; Kang, H.Y.; Huang, K.E. Androgenic and antiandrogenic effects and expression of androgen receptor in mouse embryonic stem cells. Fertil. Steril. 2006, 85, 1195–1203. [Google Scholar] [CrossRef]
- Chung, W.M.; Chang, W.C.; Chen, L.; Lin, T.Y.; Chen, L.C.; Hung, Y.C.; Ma, W.L. Ligand-independent androgen receptors promote ovarian teratocarcinoma cell growth by stimulating self-renewal of cancer stem/progenitor cells. Stem Cell Res. 2014, 13, 24–35. [Google Scholar] [CrossRef] [PubMed]
- Chung, W.M.; Chen, L.; Chang, W.C.; Su, S.Y.; Hung, Y.C.; Ma, W.L. Androgen/androgen receptor signalling in ovarian cancer: Molecular regulation and therapeutic potentials. Int. J. Mol. Sci. 2021, 22, 7748. [Google Scholar] [CrossRef]
- Berg, A.H.; Rice, C.D.; Rahman, M.S.; Dong, J.; Thomas, P. Identification and characterization of membrane androgen receptors in the ZIP9 zinc transporter subfamily: I. Discovery in female atlantic croaker and evidence ZIP9 mediates testosterone-induced apoptosis of ovarian follicle cells. Endocrinology 2014, 155, 4237–4249. [Google Scholar] [CrossRef]
- Thomas, P.; Pang, Y.; Dong, J.; Berg, A.H. Identification and characterization of membrane androgen receptors in the ZIP9 zinc transporter subfamily: II. Role of human ZIP9 in testosterone-induced prostate and breast cancer cell apoptosis. Endocrinology 2014, 155, 4250–4265. [Google Scholar] [CrossRef]
- Converse, A.; Thomas, P. Androgens regulate follicle stage-dependent pro-and anti-apoptosis in teleost ovaries through ZIP9 activation of different G proteins. Biol. Reprod. 2019, 101, 377–391. [Google Scholar] [CrossRef] [PubMed]
- Thomas, P.; Converse, A.; Berg, H.A. ZIP9, a novel membrane androgen receptor and zinc transporter protein. Gen. Comp. Endocrinol. 2018, 257, 130–136. [Google Scholar] [CrossRef]
- Bulldan, A.; Dietze, R.; Shihan, M.; Scheiner-Bobis, G. Non-classical testosterone signalling mediated through ZIP9 stimulates claudin expression and tight junction formation in Sertoli cells. Cell. Signal. 2016, 28, 1075–1085. [Google Scholar] [CrossRef] [PubMed]
- Converse, A.; Thomas, P. Androgens promote vascular endothelial cell proliferation through activation of a ZIP9-dependent inhibitory G protein/PI3K-Akt/Erk/cyclin D1 pathway. Mol. Cell. Endocrinol. 2021, 538, 111461. [Google Scholar] [CrossRef]
- Mattioli, F.; Garbero, C.; Gosmar, M.; Manfredi, V.; Carrozzino, R.; Martelli, A.; Brambilla, G. DNA fragmentation, DNA repair and apoptosis induced in primary rat hepatocytes by dienogest, dydrogesterone and 1,4,6-androstatriene-17β-ol-3-one acetate. Mutat. Res. 2004, 564, 21–29. [Google Scholar] [CrossRef]
- Neri, M.; Bello, S.; Bonsignore, A.; Cantatore, S.; Riezzo, I.; Turillazzi, E.; Fineschi, V. Anabolic androgenic steroids abuse and liver toxicity. Mini Rev. Med. Chem. 2011, 11, 430–437. [Google Scholar] [CrossRef]
- Mehrabi, M.; Kazemzadeh, Y.; Gorzi, A.; Hosseini, S.A.; Sedaghati, S. The effect of eight weeks of testosterone enanthate consumption on antioxidant activity and NF-KB and cyclooxygenase-2 genes expression of kidney tissue in resistance trained male rats. Feyz Med. Sci. J. 2023, 27, 666–675. [Google Scholar]
- Ahmed, M.A.; El Morsy, E.M.; Ahmed, A.A. Pomegranate extract protects against cerebral ischemia/reperfusion injury and preserves brain DNA integrity in rats. Life Sci. 2014, 110, 61–69. [Google Scholar] [CrossRef]
- Bueno, A.; Carvalho, F.B.; Gutierres, J.M.; Lhamas, C.L.; Brusco, I.; Oliveira, S.M.; Amaral, M.G.; Dorneles, G.; Sorraila, J.; Duarte, M.M.; et al. Impacts of dose and time of boldenone and stanazolol exposure in inflammatory markers, oxidative and nitrosative stress and histopathological changes in the rat testes. Theriogenology 2017, 90, 101–108. [Google Scholar] [CrossRef]
- Turillazzi, E.; Neri, M.; Cerretani, D.; Cantatore, S.; Frati, P.; Moltoni, L.; Busardò, F.P.; Pomara, C.; Riezzo, I.; Fineschi, V. Lipid peroxidation and apoptotic response in rat brain areas induced by long-term administration of nandrolone: The mutual crosstalk between ROS and NF-kB. J. Cell. Mol. Med. 2016, 20, 601–612. [Google Scholar] [CrossRef]
- Perkins, N.D. Integrating cell-signalling pathways with NF-κB and IKK function. Nat. Rev. Mol. Cell Biol. 2007, 8, 49–62. [Google Scholar] [CrossRef]
- Wertz, I.E.; O’Rourke, K.M.; Zhou, H.; Eby, M.; Aravind, L.; Seshagiri, S.; Wu, P.; Wiesmann, C.; Baker, R.; Boone, D.L.; et al. De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-κB signalling. Nature 2004, 430, 694–699. [Google Scholar] [CrossRef]
- Hoffmann, A.; Levchenko, A.; Scott, M.L.; Baltimore, D. The IκB-NF-κB signalling module: Temporal control and selective gene activation. Science 2002, 298, 1241–1245. [Google Scholar] [CrossRef] [PubMed]
- Gou, Y.; Yang, D.; Tian, T.; Zhu, X.; Zhang, R.; Ren, J.; Tu, D.; Luo, Y.; Miao, Y.; Zhao, H.; et al. The transcription of ZIP9 is associated with the macrophage polarization and the pathogenesis of hepatocellular carcinoma. Front. Immunol. 2022, 13, 725595. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, M.; Fukunaka, A.; Hagihara, M.; Watanabe, K.; Kamino, S.; Kambe, T.; Enomoto, S.; Hiromura, M. Essential role of the zinc transporter ZIP9/SLC39A9 in regulating the activations of Akt and Erk in B-cell receptor signalling pathway in DT40 cells. PLoS ONE 2013, 8, e58022. [Google Scholar] [CrossRef]
- Hodosy, J.; Zelmanová, D.; Majzúnová, M.; Filová, B.; Malinová, M.; Ostatníková, D.; Celec, P. The anxiolytic effect of testosterone in the rat is mediated via the androgen receptor. Pharmacol. Biochem. Behav. 2012, 102, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Ross, J.W.; Ashworth, M.D.; Mathew, D.; Reagan, P.; Ritchey, J.W.; Hayashi, K.; Spencer, T.E.; Lucy, M.; Geisert, R.D. Activation of the transcription factor, nuclear factor kappa-B, during the estrous cycle and early pregnancy in the pig. Reprod. Biol. Endocrinol. 2010, 8, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Pawlak, P.; Warzych, E.; Chabowska, A.; Lechniak, D. Differences in cytoplasmic maturation between the BCB+ and control porcine oocytes do not justify application of the BCB test for a standard IVM protocol. J. Reprod. Dev. 2014, 60, 28–36. [Google Scholar] [CrossRef]
Antigen | ICC Dilution in PBST | WB Dilution in TBST | #cat. | Host/Clonality | Vendor |
---|---|---|---|---|---|
NF-κB p65 phosphorylated form | 1:100 | 1:1000 | ab76302 | Rabbit monoclonal | Abcam |
NF-κB p65 total form | 1:100 | 1:1000 | ab32536 | ||
NF-κB p105 | 1:100 | 1:1000 | ab32360 | ||
IKBα phosphorylated form | 1:100 | 1:1000 | ab133462 | ||
IKBα total form | 1:100 | 1:1000 | ab32518 | ||
ZIP-9 | Not applicable | 1:500 | SAB3500599 | Rabbit polyclonal | Sigma-Aldrich, Merck |
Gene (Sus Scrofa Domesticus) | F/R | Primer Sequence (5′→3′) | Tm (°C) | RefSeq Accession Number (NCBI Nucleotide Database) | Reference |
---|---|---|---|---|---|
NFKBIA | F | TGTGATCCTGAGCTCCGAGACTTT | 57.4 | NM_001005150 | [65] |
R | TTGTAGTTGGTGGCCTGCAGAATG | 57.4 | |||
RELA | F | ACATGGACTTCTCAGCCCTTCTGA | 57.4 | NM_001114281 | |
R | CCGAAGACATCACCCAAAGATGCT | 57.4 | |||
NFKB1 | F | CCCATGTAGACAGCACCACCTATGAT | 59.5 | NM_001048232 | |
R | ACAGAGGCTCAAAGTTCTCCACCA | 57.4 | |||
SLC39A9 | F | TGTTACGTGGCTGGAATCATTC | 53.0 | no data | Primers designed for this work |
R | CATGTTCATGGGCAACTGGTAT | 53.0 | |||
GAPDH | F | CCCACGAGCACACCTCAGAA | 55.9 | NM_001206359 | [66] |
R | TGCAGCCTGTACTCCCGCT | 55.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wartalski, K.; Wiater, J.; Maciak, P.; Pastuła, A.; Lis, G.J.; Samiec, M.; Trzcińska, M.; Duda, M. Anabolic Steroids Activate the NF-κB Pathway in Porcine Ovarian Putative Stem Cells Independently of the ZIP-9 Receptor. Int. J. Mol. Sci. 2024, 25, 2833. https://doi.org/10.3390/ijms25052833
Wartalski K, Wiater J, Maciak P, Pastuła A, Lis GJ, Samiec M, Trzcińska M, Duda M. Anabolic Steroids Activate the NF-κB Pathway in Porcine Ovarian Putative Stem Cells Independently of the ZIP-9 Receptor. International Journal of Molecular Sciences. 2024; 25(5):2833. https://doi.org/10.3390/ijms25052833
Chicago/Turabian StyleWartalski, Kamil, Jerzy Wiater, Patrycja Maciak, Agnieszka Pastuła, Grzegorz J. Lis, Marcin Samiec, Monika Trzcińska, and Małgorzata Duda. 2024. "Anabolic Steroids Activate the NF-κB Pathway in Porcine Ovarian Putative Stem Cells Independently of the ZIP-9 Receptor" International Journal of Molecular Sciences 25, no. 5: 2833. https://doi.org/10.3390/ijms25052833