Identification of Molecular Mechanisms in Radiation Cystitis: Insights from RNA Sequencing
Abstract
:1. Introduction
2. Results
2.1. RNA-Seq Quality Control
2.2. Differential Expression Analysis
3. Discussion
3.1. Gene Expression Changes Post-Radiation
3.2. Study Limitations and Future Directions
4. Materials and Methods
4.1. Radiation Cystitis Pre-Clinical Model
4.2. RNA Isolation
4.3. RNA Sequencing, Quality Control, and Sequence Alignment
4.4. Differential Expression Analysis
4.5. Reverse Transcription of RNA
4.6. Quantitative PCR Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Longo, N.; Celentano, G.; Napolitano, L.; La Rocca, R.; Capece, M.; Califano, G.; Colla Ruvolo, C.; Mangiapia, F.; Fusco, F.; Morra, S.; et al. Metastasis-Directed Radiation Therapy with Consolidative Intent for Oligometastatic Urothelial Carcinoma: A Systematic Review and Meta-Analysis. Cancers 2022, 14, 2373. [Google Scholar] [CrossRef] [PubMed]
- Abbaspour, S.; Barahman, M.; Abdollahi, H.; Arabalibeik, H.; Hajainfar, G.; Babaei, M.; Iraji, H.; Barzegartahamtan, M.; Ay, M.R.; Mahdavi, S.R. Multimodality radiomics prediction of radiotherapy-induced the early proctitis and cystitis in rectal cancer patients: A machine learning study. Biomed. Phys. Eng. Express 2023, 10, 015017. [Google Scholar] [CrossRef] [PubMed]
- Abdollahi, H.; Tanha, K.; Mofid, B.; Razzaghdoust, A.; Saadipoor, A.; Khalafi, L.; Bakhshandeh, M.; Mahdavi, S.R. MRI Radiomic Analysis of IMRT-Induced Bladder Wall Changes in Prostate Cancer Patients: A Relationship with Radiation Dose and Toxicity. J. Med. Imaging Radiat. Sci. 2019, 50, 252–260. [Google Scholar] [CrossRef]
- Addley, H.C.; Vargas, H.A.; Moyle, P.L.; Crawford, R.; Sala, E. Pelvic imaging following chemotherapy and radiation therapy for gynecologic malignancies. Radiographics 2010, 30, 1843–1856. [Google Scholar] [CrossRef] [PubMed]
- Peterson, C.M.; Menias, C.O.; Katz, D.S. Radiation-induced effects to nontarget abdominal and pelvic viscera. Radiol. Clin. N. Am. 2014, 52, 1041–1053. [Google Scholar] [CrossRef] [PubMed]
- Dohm, A.; Sanchez, J.; Stotsky-Himelfarb, E.; Willingham, F.F.; Hoffe, S. Strategies to Minimize Late Effects From Pelvic Radiotherapy. Am. Soc. Clin. Oncol. Educ. Book 2021, 41, 158–168. [Google Scholar] [CrossRef] [PubMed]
- Brossard, C.; Lefranc, A.C.; Pouliet, A.L.; Simon, J.M.; Benderitter, M.; Milliat, F.; Chapel, A. Molecular Mechanisms and Key Processes in Interstitial, Hemorrhagic and Radiation Cystitis. Biology 2022, 11, 972. [Google Scholar] [CrossRef] [PubMed]
- Zwaans, B.M.; Nicolai, H.G.; Chancellor, M.B.; Lamb, L.E. Challenges and Opportunities in Radiation-induced Hemorrhagic Cystitis. Rev. Urol. 2016, 18, 57–65. [Google Scholar]
- Helissey, C.; Cavallero, S.; Brossard, C.; Dusaud, M.; Chargari, C.; François, S. Chronic Inflammation and Radiation-Induced Cystitis: Molecular Background and Therapeutic Perspectives. Cells 2020, 10, 21. [Google Scholar] [CrossRef]
- Martin, S.E.; Begun, E.M.; Samir, E.; Azaiza, M.T.; Allegro, S.; Abdelhady, M. Incidence and Morbidity of Radiation-Induced Hemorrhagic Cystitis in Prostate Cancer. Urology 2019, 131, 190–195. [Google Scholar] [CrossRef]
- Makino, K.; Sato, Y.; Takenaka, R.; Yamashita, H.; Akiyama, Y.; Yamada, Y.; Nakamura, M.; Kawai, T.; Yamada, D.; Suzuki, M.; et al. Cumulative Incidence and Clinical Risk Factors of Radiation Cystitis after Radiotherapy for Prostate Cancer. Urol. Int. 2023, 107, 440–446. [Google Scholar] [CrossRef] [PubMed]
- Zwaans, B.M.M.; Wegner, K.A.; Bartolone, S.N.; Vezina, C.M.; Chancellor, M.B.; Lamb, L.E. Radiation cystitis modeling: A comparative study of bladder fibrosis radio-sensitivity in C57BL/6, C3H, and BALB/c mice. Physiol. Rep. 2020, 8, e14377. [Google Scholar] [CrossRef] [PubMed]
- Zwaans, B.M.M.; Carabulea, A.L.; Bartolone, S.N.; Ward, E.P.; Chancellor, M.B.; Lamb, L.E. Voiding defects in acute radiation cystitis driven by urothelial barrier defect through loss of E-cadherin, ZO-1 and Uroplakin III. Sci. Rep. 2021, 11, 19277. [Google Scholar] [CrossRef] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Harris, M.A.; Clark, J.; Ireland, A.; Lomax, J.; Ashburner, M.; Foulger, R.; Eilbeck, K.; Lewis, S.; Marshall, B.; Mungall, C.; et al. The Gene Ontology (GO) database and informatics resource. Nucleic Acids Res. 2004, 32, D258–D261. [Google Scholar] [CrossRef]
- Brossard, C.; Pouliet, A.L.; Lefranc, A.C.; Benadjaoud, M.; Dos Santos, M.; Demarquay, C.; Buard, V.; Benderitter, M.; Simon, J.M.; Milliat, F.; et al. Mesenchymal stem cells limit vascular and epithelial damage and restore the impermeability of the urothelium in chronic radiation cystitis. Stem Cell Res. Ther. 2023, 14, 5. [Google Scholar] [CrossRef]
- Li, J.; Shen, C.; Qiu, H.; Wang, J.; Yue, X.; Dai, L.; Huang, Y.; Li, T.; Fang, Q.; Zhi, Y.; et al. Intravesical IR-780 instillation prevents radiation cystitis by protecting urothelial integrity. Neurourol. Urodyn. 2023, 42, 40–48. [Google Scholar] [CrossRef]
- Ohki, R.; Nemoto, J.; Murasawa, H.; Oda, E.; Inazawa, J.; Tanaka, N.; Taniguchi, T. Reprimo, a new candidate mediator of the p53-mediated cell cycle arrest at the G2 phase. J. Biol. Chem. 2000, 275, 22627–22630. [Google Scholar] [CrossRef]
- Xiao, S.; Qin, D.; Hou, X.; Tian, L.; Yu, Y.; Zhang, R.; Lyu, H.; Guo, D.; Chen, X.Z.; Zhou, C.; et al. Cellular senescence: A double-edged sword in cancer therapy. Front. Oncol. 2023, 13, 1189015. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, C.M.; Dolgonos, L.; Zemans, R.L.; Young, S.K.; Robertson, J.; Briones, N.; Suzuki, T.; Campbell, M.N.; Gauldie, J.; Radisky, D.C.; et al. Matrix metalloproteinase 3 is a mediator of pulmonary fibrosis. Am. J. Pathol. 2011, 179, 1733–1745. [Google Scholar] [CrossRef] [PubMed]
- Bauer, Y.; White, E.S.; de Bernard, S.; Cornelisse, P.; Leconte, I.; Morganti, A.; Roux, S.; Nayler, O. MMP-7 is a predictive biomarker of disease progression in patients with idiopathic pulmonary fibrosis. ERJ Open Res. 2017, 3, 00074-2016. [Google Scholar] [CrossRef] [PubMed]
- Ke, B.; Fan, C.; Yang, L.; Fang, X. Matrix Metalloproteinases-7 and Kidney Fibrosis. Front. Physiol. 2017, 8, 21. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Sato, Y. KEGG Mapper for inferring cellular functions from protein sequences. Protein Sci. 2020, 29, 28–35. [Google Scholar] [CrossRef]
- Maglott, D.; Ostell, J.; Pruitt, K.D.; Tatusova, T. Entrez Gene: Gene-centered information at NCBI. Nucleic Acids Res. 2011, 39, D52–D57. [Google Scholar] [CrossRef]
1 Week Post-IRR | 6 Months Post-IRR | |
---|---|---|
Total Measured Genes | 17,893 | 22,132 |
Differentially Expressed Genes * | 246 | 607 |
Significant Pathways | 50 | 53 |
Gene Ontology (GO) | 1510 | 1741 |
1 Week Post-IRR vs. Age-Matched Control | |||||
---|---|---|---|---|---|
Pruning Type: None | Pruning Type: High-Specificity | Pruning Type: Smallest Common Denominator | |||
GO | p-Value | GO | p-Value | GO | p-Value |
Ion transport | 2.60 × 10−10 | Intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 1.54 × 10−2 | Intrinsic apoptotic signaling pathway by p53 class mediator | 1.33 × 10−3 |
Signaling | 6.90 × 10−8 | Positive regulation of release of cytochrome c from mitochondria | 9.14 × 10−2 | Regulation of cysteine-type endopeptidase activity involved in apoptotic process | 1.33 × 10−3 |
Regulation of cell motility | 1.60 × 10−7 | Endocardial cell differentiation | 9.14 × 10−2 | Positive regulation of release of cytochrome c from mitochondria | 6.38 × 10−2 |
Intrinsic apoptotic signaling pathway by p53 class mediator | 2.00 × 10−7 | Negative regulation of fibroblast proliferation | 9.14 × 10−2 | Endocardial cell differentiation | 7.11 × 10−2 |
Regulation of cellular component movement | 3.40 × 10−7 | Blood vessel remodeling | 9.14 × 10−2 | Negative regulation of fibroblast proliferation | 7.62 × 10−2 |
6 Months Post-IRR vs Age-Matched Ctrl | |||||
---|---|---|---|---|---|
Pruning Type: None | Pruning Type: High-Specificity | Pruning Type: Smallest Common Denominator | |||
GO | p-Value | GO | p-Value | GO | p-Value |
Immune system process | 6.50 × 10−21 | Collagen catabolic process | 2.08 × 10−2 | Response to another organism | 2.05 × 10−5 |
Response to external stimulus | 1.70 × 10−18 | Pyroptosis | 2.08 × 10−2 | Pyroptosis | 6.24 × 10−3 |
Immune response | 7.30 × 10−17 | Negative regulation of mast cell degranulation | 2.41 × 10−2 | Collagen catabolic process | 6.24 × 10−3 |
Response to another organism | 3.20 × 10−16 | Antigen processing and presentation of exogenous peptide antigen via MHC class II | 2.41 × 10−2 | Positive regulation of cytokine production | 6.24 × 10−3 |
Response to external biotic stimulus | 3.40 × 10−16 | Positive regulation of dendritic cell antigen processing and presentation | 2.66 × 10−2 | B-cell-mediated immunity | 6.24 × 10−3 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Mmp3 | GGACCAGGGATTAATGGAGATG | TGAGCAGCAACCAGGAATAG |
Mmp8 | TCAACCAGGCCAAGGTATTG | ATGAGCAGCCACGAGAAATAG |
Mmp13 | GACACAGCAAGCCAGAATAAAG | GGAAAGCAGAGAGGGATTAACA |
Mmp10 | GGTGTGGTGTTCCTGATGTT | CCTGTAGGTGATGTGGGATTTC |
Mmp12 | GACATCTTGGCTCCCTATCTTC | TGGACAATACACCAGTCAGTTT |
Mmp27 | AGAGGATTCCCACAGAGGATAA | CCTCGACCCATGGAAGAAATAG |
Mmp7 | GAGTGCCAGATGTTGCAGAATA | ATCCACTACGATCCGAGGTAAG |
Mdm2 | AGCTGACAGAGAATGATGCTAAA | GGAAGTCGATGGTTGGGAATAG |
Noxa1 | GCCATCCTCATCTACGTGTAAG | TCCAGATGCCAGCAAACTATC |
Bax | GGAGATGAACTGGACAGCAATA | GAAGTTGCCATCAGCAAACAT |
Puma | CTGGAGGGTCATGTACAATCTC | ACCTAGTTGGGCTCCATTTC |
Fas | CCTCCAGTCGTGAAACCATAC | TCTTGCCCTCCTTGATGTTATT |
Dr5 | GATGGAGCCAGGAAGATCAAG | AGTCAGCTCTCAGCAAGTTTAG |
18s | CCGCAGCTAGGAATAATGGA | CGGTCCAAGAATTTCACCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mota, S.; Ward, E.P.; Bartolone, S.N.; Chancellor, M.B.; Zwaans, B.M.M. Identification of Molecular Mechanisms in Radiation Cystitis: Insights from RNA Sequencing. Int. J. Mol. Sci. 2024, 25, 2632. https://doi.org/10.3390/ijms25052632
Mota S, Ward EP, Bartolone SN, Chancellor MB, Zwaans BMM. Identification of Molecular Mechanisms in Radiation Cystitis: Insights from RNA Sequencing. International Journal of Molecular Sciences. 2024; 25(5):2632. https://doi.org/10.3390/ijms25052632
Chicago/Turabian StyleMota, Sabrina, Elijah P. Ward, Sarah N. Bartolone, Michael B. Chancellor, and Bernadette M. M. Zwaans. 2024. "Identification of Molecular Mechanisms in Radiation Cystitis: Insights from RNA Sequencing" International Journal of Molecular Sciences 25, no. 5: 2632. https://doi.org/10.3390/ijms25052632