Next Article in Journal
An Overview of the Role of MicroRNAs on Carcinogenesis: A Focus on Cell Cycle, Angiogenesis and Metastasis
Next Article in Special Issue
Synergistic Effect of Melatonin and Lysinibacillus fusiformis L. (PLT16) to Mitigate Drought Stress via Regulation of Hormonal, Antioxidants System, and Physio-Molecular Responses in Soybean Plants
Previous Article in Journal
HIV-Differentiated Metabolite N-Acetyl-L-Alanine Dysregulates Human Natural Killer Cell Responses to Mycobacterium tuberculosis Infection
Previous Article in Special Issue
Melatonin Alleviates Chromium Toxicity in Maize by Modulation of Cell Wall Polysaccharides Biosynthesis, Glutathione Metabolism, and Antioxidant Capacity
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 8
10.3390/ijms24087269
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Morphological and Physiological Mechanisms of Melatonin on Delaying Drought-Induced Leaf Senescence in Cotton

by
Kai Yang
1,†,
Hongchun Sun
1,†,
Mengxing Liu
1,
Lingxiao Zhu
1,
Ke Zhang
1,
Yongjiang Zhang
1,
Anchang Li
1,
Haina Zhang
2,
Jijie Zhu
3,
Xiaoqing Liu
1,
Zhiying Bai
1,
Liantao Liu
1,* and
Cundong Li
1,*
1
State Key Laboratory of North China Crop Improvement and Regulation, Key Laboratory of Crop Growth Regulation of Hebei Province, College of Agronomy, Hebei Agricultural University, Baoding 071001, China
2
Cotton Research Institute, Hebei Academy of Agriculture and Forestry Sciences, Shijiazhuang 050051, China
3
Institute of Cereal and Oil Crops, Hebei Academy of Agriculture and Forestry Sciences, Shijiazhuang 050051, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(8), 7269; https://doi.org/10.3390/ijms24087269
Submission received: 10 March 2023 / Revised: 5 April 2023 / Accepted: 13 April 2023 / Published: 14 April 2023
(This article belongs to the Special Issue The Role of Melatonin in Plants 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Leaf senescence reduces the photosynthetic capacity of leaves, thus significantly affecting the growth, development, and yield formation of cotton. Melatonin (MT) is a multipotent substance proven to delay leaf senescence. However, its potential mechanism in delaying leaf senescence induced by abiotic stress remains unclear. This study aimed to explore the effect of MT on delaying drought-induced leaf senescence in cotton seedlings and to clarify its morphological and physiological mechanisms. Drought stress upregulated the leaf senescence marker genes, destroyed the photosystem, and led to excessive accumulation of reactive oxygen species (ROS, e.g., H2O2 and O2−), thus accelerating leaf senescence. However, leaf senescence was significantly delayed when 100 μM MT was sprayed on the leaves of the cotton seedlings. The delay was embodied by the increased chlorophyll content, photosynthetic capacity, and antioxidant enzyme activities, as well as decreased H2O2, O2−, and abscisic acid (ABA) contents by 34.44%, 37.68%, and 29.32%, respectively. MT significantly down-regulated chlorophyll degradation-related genes and senescence marker genes (GhNAC12 and GhWRKY27/71). In addition, MT reduced the chloroplast damage caused by drought-induced leaf senescence and maintained the integrity of the chloroplast lamellae structure under drought stress. The findings of this study collectively suggest that MT can effectively enhance the antioxidant enzyme system, improve photosynthetic efficiency, reduce chlorophyll degradation and ROS accumulation, and inhibit ABA synthesis, thereby delaying drought-induced leaf senescence in cotton.

1. Introduction

Leaf senescence is the final process of leaf development and leads to the loss of crop organ function [1]. Senescence plays an essential role in plant development through the recycling of many important nutrients. It is easily induced by various stress factors, such as drought, salinity, high or low temperature, darkness, nutrient deficiency, and pathogen infection [2]. Premature leaf senescence is a degenerative physiological process that affects crop yield because it reduces photosynthetic efficiency and nutrient accumulation [3,4]. Cotton (Gossypium hirsutum L.) is the most essential fiber crop and is a valuable oil crop worldwide [5]. Premature leaf senescence significantly restricts cotton yield and quality [6]. In China, the yield reduction can reach 225–300 kg/hm2 [7]. Premature leaf senescence is closely associated with drought stress (DS) during the early growth of cotton [8]. It is attributed to cotton’s extreme sensitivity to water shortage because of its origin in tropical regions with abundant water [9].
Leaf senescence is correlated with various biochemical changes [10]. Chlorophyll degradation is the most significant characteristic of natural leaf senescence caused by stress [11]. The senescence process is closely associated with the destruction of the chloroplast structure, an increase of membrane lipid peroxide content, and a significant decrease in the net photosynthetic rate (Pn) and photosystem II (PSII) photochemical efficiency [12,13]. Excessive accumulation of reactive oxygen species (ROS) is also an essential feature of leaf senescence [14]. For example, there is excessive accumulation of superoxide anions (O2−) and hydrogen peroxide (H2O2) in the dark-induced senescence of grape (Vitis vinifera L.) leaves [15], heat-induced senescence of tomato (Solanum lycopersicum L.) leaves [16], and postharvest storage of cabbage (Brassica rapa ssp. parachinensis) leaves [17]. In addition, various plant hormones, such as abscisic acid (ABA), auxin (IAA), cytokinin (CTK), and gibberellin (GA), participate in regulating leaf senescence [18]. Notably, the content of endogenous ABA is higher in senescent leaves, while IAA, CTK, and GA delay leaf senescence [19,20,21,22]. Leaf senescence is also reflected by the differential expression of senescence marker genes and NAC and WRKY transcription factors [23,24].
Leaf senescence and accelerated shedding are often manifestations of plant drought tolerance in the wild because they help plants to maintain water balance [25,26], thereby increasing their survival chances under DS [27]. However, leaf senescence in field crops is closely associated with yield reduction [28]. Abiotic stress-induced leaf senescence significantly affects crop yield and quality [29]. Notably, the area and degree of arid and semi-arid regions are increasing because of global warming, insufficient rainfall, and uneven rainfall distribution [30]. The loss of crop yield caused by drought-induced leaf senescence thus exceeds losses attributed to other abiotic stress factors [31]. Delaying leaf senescence can enhance drought resistance and improve photosynthesis, which is the basis of high yields [32]. Exploring methods to delay leaf senescence are thus prerequisites for maintaining and enhancing agricultural production under abiotic stress conditions.
Melatonin (N-acetyl-5-methoxytryptamine, MT) is a multi-effect small molecule indole widely found in animals, prokaryotes, and plants [33]. MT can regulate plant growth and development and is a powerful antioxidant and ROS scavenger that activates seed germination [34], regulates root development [35], promotes plant growth [36], and delays leaf senescence [37]. MT removes excess ROS and prolongs the function of leaves during leaf senescence [38]. The root application of MT delays drought-induced senescence of apple (Malus domestica Borkh.) leaves by scavenging ROS and reducing chlorophyll degradation [39]. MT delays dark-induced ryegrass (Lolium perenne L.) senescence by activating the ROS scavenging pathway and down-regulating senescence marker genes [40]. Moreover, MT delays dark-induced cucumber (Cucumis sativus L.) leaf senescence by improving photosynthetic efficiency, protecting PSII activity, and maintaining chloroplast ultrastructure [41]. The level of MT in a plant is correlated with the content of hormones regulating leaf senescence [42]. Pretreatment of tomatoes with MT can delay high temperature-induced leaf senescence by inhibiting ABA formation and increasing the GA content [16]. Similarly, foliar spraying of tobacco (Nicotiana tabacum L.) with MT enhances its resistance to dehydration-induced leaf senescence by regulating the phytohormone-gene regulatory networks, mainly up-regulation of the IAA content and down-regulation of the ABA content [43]. MT also alleviates heat-induced leaf senescence by increasing the CTK content (t-ZR and iPA) and endogenous MT in perennial ryegrass [44].
In conclusion, MT has a huge potential to delay leaf senescence [45]. However, it remains unclear how it regulates the morphology, physiology, biochemical, and the ultra-microstructure of cotton leaves to alleviate drought-induced leaf senescence. This study mainly focused on the mechanisms of MT in regulating photosynthesis, membrane damage, root morphology, chloroplast structure, and ROS dynamic balance of cotton seedlings during drought-induced leaf senescence. The study also probed the MT mechanism in regulating the antioxidant oxidase defense system and endogenous hormone levels. The findings of this study provide a theoretical basis for applying MT to alleviate drought-induced premature leaf senescence in cotton.

2. Results

2.1. Effects of MT on the Growth and Development of Cotton Seedlings under DS

Cotton seedlings were irrigated with PEG-6000 for 14 days to simulate DS and subsequent leaf senescence. DS inhibited the growth of cotton seedlings. However, this phenomenon was alleviated by spraying exogenous MT (Figure 1A). Plant height, stem diameter, and leaf area were decreased by 19.69%, 16.36%, and 24.49% at 14 days after treatment (DAT), respectively, under DS compared to the corresponding parameters of CK seedlings. Notably, spraying MT increased plant height, stem diameter, and leaf area by 16.71%, 3.70%, and 20.82% compared to DS (p < 0.05) (Figure 1B–D). The SPAD value of leaves increased by 5.45% after spraying MT compared to DS (p < 0.05) at 14 DAT (Figure 1E), indicating that MT reduced and prevented chlorophyll degradation.
Compared to CK, DS treatment significantly reduced the fresh shoot, dry shoot, fresh root, and dry root weights of cotton seedlings (Figure 2A–D). Compared to DS, MT + DS treatment increased the fresh shoot and root weights by 24.29% and 50.14% and the dry shoot and root weights by 9.64% and 12.27%, respectively (p < 0.05). DS inhibited the root growth of cotton seedlings (Figure 2E–H). Compared to CK, DS reduced the root length, root surface area, and root volume by 57.18%, 58.59%, and 58.75% (p < 0.05), respectively. However, MT + DS treatment increased these indicators by 17.57%, 31.73%, and 41.30% (p < 0.05), respectively, compared to the corresponding indicators under DS treatment, indicating that MT can alleviate the growth inhibition of both the cotton shoots and the roots during drought-induced senescence.

2.2. Effects of MT on the Photosynthetic Characteristics

Compared to CK, the Pn under DS treatment decreased by 39.92% and 61.71% (p < 0.05), while the Pn under MT + DS treatment decreased by 25.68% and 43.19% (p < 0.05) at 7 DAT and 14 DAT, respectively (Figure 3A). There was a significant decrease in transpiration rate (Tr), intercellular CO2 concentration (Ci), and stomatal conductance (Gs) under DS treatment compared to CK (Figure 3B–D). Compared to DS, Tr, Ci, and Gs under MT + DS treatment increased by 63.68%, 17.80%, and 62.23%at 14 DAT (p < 0.05), respectively. In addition, DS significantly decreased the CO2 assimilation rate after fitting the parameters of the light response curve. Compared to DS, MT + DS treatment significantly improved the photosynthetic capacity of cotton, especially under high light levels (Figure S1). Compared to DS, the maximum net photosynthetic rate (Pmax), light compensation point (LCP), and respiratory rate (Rd) of MT increased by 35.74%, 99.67%, and 154.13% (p < 0.05), respectively (Table 1). In summary, MT alleviated the decrease of photosynthetic capacity during drought-induced leaf senescence.
DS treatment significantly decreased the maximum photochemical efficiency (Fv/Fm). However, Fv/Fm reduction under MT + DS treatment was significantly lower than under DS treatment but increased by 1.82% compared to that of DS at 14 DAT (p < 0.05) (Figure 4A). DS treatment also significantly decreased the actual photochemical quantum yield of PSII (ΦPSII) and apparent electron transfer efficiency (ETR) compared to CK (Figure 4B,C). Non-photochemical quenching (NPQ) showed an increasing trend during the process of drought-induced senescence. Of note, NPQ under DS treatment was significantly higher than that under CK and MT + DS treatments at 14 DAT (Figure 4D). These data show that MT can effectively increase the Fv/Fm, ΦPSII, and ETR of cotton seedlings to alleviate the photosynthetic inhibition induced by DS.

2.3. Effects of MT on Relative Water Content (RWC) and Malondialdehyde (MDA) Content

The leaves of cotton seedlings subjected to DS using PEG-6000 were gradually dehydrated. Notably, the RWC of the leaves decreased from 90.51% at 0 DAT to 75.67% at 14 DAT (Figure 5A). In contrast, the content of MDA in the leaves increased rapidly, with the MDA content at 14 DAT being 3.57 times higher than that at 0 DAT (Figure 5B). Compared to DS, MT + DS treatment significantly increased the RWC of leaves and maintained it at 84.93% at 14 DAT. However, MT + DS treatment significantly reduced the MDA content by 86.42% (p < 0.05). This phenomenon shows that MT can delay leaf senescence by maintaining a high RWC of leaves and reducing the MDA content in cotton seedlings.

2.4. Effects of MT on the Antioxidant Enzyme Activity

The activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) under DS and MT + DS treatments showed a similar change pattern; their activities first increased and then decreased. However, there were no apparent changes in enzyme activity in cotton seedlings under CK treatment (Figure 6A–D). Compared to CK, the activities of SOD, POD, and APX under DS treatment were significantly increased, while the activities of several enzymes tended to decrease with the aggravation of drought-induced leaf senescence. Compared to DS treatment, MT + DS treatment increased the activities of SOD, POD, and APX by 6.72%, 5.61%, and 50% at 14 DAT (p < 0.05), respectively (Figure 6A,B,D). The activity of CAT under DS and MT + DS treatments was significantly lower than that of CK treatment at 14 DAT. However, CAT activity under MT + DS treatment was 22.82% higher than under DS treatment (p < 0.05) (Figure 6C). This phenomenon indicated that CAT activity was more sensitive to leaf senescence. However, spraying MT effectively increased the activity of CAT. MT can thus delay drought-induced leaf senescence by increasing antioxidant enzyme activity.

2.5. Effect of MT on the ROS Content

Figure 7A,B shows the level of H2O2 and O2− in cotton leaves detected through 3,3-diaminobenzidine (DAB) and nitro-blue tetrazolium (NBT) staining methods. Notably, brown and blue spots were spread over the entire leaf area under DS treatment but only in a small area under MT + DS treatment. Histochemical staining showed that MT significantly decreased the H2O2 and O2− contents during drought-induced senescence. H2O2 and O2− contents in cotton leaves exhibited an increasing trend as the DS continued. The levels of H2O2 and O2− under DS treatment increased by 4.20 times and 1.47 times compared to those of CK-treated seedlings at 14 DAT (p < 0.05) (Figure 7C,D). However, the contents of H2O2 and O2− in MT-treated seedlings were reduced by 34.44% and 37.68% (p < 0.05), respectively, compared to those under DS treatment (Figure 7C,D). These results indicated that MT could effectively inhibit ROS accumulation in cotton seedlings under DS, thereby delaying leaf senescence.

2.6. Effects of MT on the Endogenous Hormone Content

The IAA level of seedlings under CK treatment gradually increased with the growth of seedlings. However, the IAA level of DS-treated seedlings decreased by 61.76% compared to the corresponding IAA level in CK seedlings at 14 DAT. In the same line, the IAA level of MT-treated seedlings increased by 110.32% compared to that of DS-treated seedlings (p < 0.05) (Figure 8A). Compared to CK seedlings, the ABA level of DS-treated seedlings increased by 61.69% and 110.19% at 7 DAT and 14 DAT (p < 0.05), respectively. Compared to DS-treated seedlings, the ABA level of MT-treated seedlings decreased by 24.57% and 29.32% at 7 DAT and 14 DAT (p < 0.05), respectively (Figure 8B). The contents of GA3 and iPA gradually decreased with the aggravation of drought-induced senescence. The contents of GA3 and iPA in DS treatment reduced by 15.76% and 34.98% at 14 DAT, respectively, compared to the corresponding contents in CK seedlings. In contrast, the contents of GA3 and iPA in MT-treated seedlings increased by 26.15% and 87.42% at 14 DAT, respectively, compared to the corresponding contents in DS-treated seedlings (Figure 8C,D). In the same line, the endogenous melatonin content of MT-treated seedlings increased by 33.14% at 14 DAT compared to the corresponding contents in DS-treated seedlings (Figure 8E). In summary, MT delayed drought-induced leaf senescence by increasing the levels of IAA, GA3, and iPA and reducing the level of ABA in the leaves.

2.7. Effects of MT on the Ultrastructural Alterations in the Chloroplast

In this study we observed the ultrastructure of the mesophyll cell structure during drought-induced leaf senescence to determine the effect of MT on the ultrastructural alterations in the chloroplast (Figure 9A–F). The chloroplasts under CK treatment had a regular oval shape, which was neatly and tightly attached to the cell wall (Figure 9A,D). In contrast, the structure of mesophyll cells in leaves under DS treatment was severely damaged. Of note, plasmolysis occurred despite their morphology not being significantly deformed (Figure 9B). In addition, drought-induced leaf senescence reduced the length, increased the width, and decreased the aspect ratio of the chloroplasts. The number of basal grains in the chloroplasts was significantly reduced, and the lamella structure was disordered, tending to be degraded and broken (Figure 9E). However, the mesophyll cells of the leaves under MT + DS treatment did not have plasmolysis, and the shape of the chloroplasts was relatively regular oval, which was basically similar to the shape of the chloroplasts under CK treatment. The grana lamellar structure was complete, and the arrangement was relatively orderly (Figure 9C,F). These results demonstrated that drought-induced leaf senescence caused severe damage to the cell structure. Of note, MT + DS treatment significantly alleviated the membrane lipid damage caused by leaf senescence and maintained the basic structure of the chloroplasts.

2.8. Effects of MT on the Transcript Abundance of Chlorophyll Degradation Genes, Senescence Marker Genes, and Hormone Synthesis Genes during Leaf Senescence

This study determined the mRNA levels of chlorophyll degradation genes, senescence-related genes, and hormone synthesis genes in the cotton leaves at 14 DAT to further verify the role of MT in delaying drought-induced leaf senescence (Figure 10). Notably, MT + DS treatment up-regulated the large subunit of Rubisco, ribulose-1, 5-bisphosphate carboxylase/oxygenase (GhRBCL) but down-regulated non-yellow coloring 1 (GhNYC1) (Figure 10A,B). This phenomenon suggests that MT potentially inhibits chlorophyll degradation by increasing the level of GhRBCL and decreasing the level of GhNYC1. WRKY27/71 and NAC12 are positive leaf senescence regulators significantly upregulated during drought-induced senescence. However, their expression was significantly reduced by MT + DS treatment (Figure 10C–E), effectively delaying leaf senescence.
The expression level of hormone synthesis genes was generally consistent with that of endogenous hormone content. The expression levels of flavin-binding monooxygenase family protein (GhYUC5), gibberellin 3-oxidase 2 (GhGA3ox2), and tRNAisopentenyltransferase 2 (GhIPT2) decreased significantly under DS treatment but increased significantly under MT + DS treatment compared to the corresponding levels under CK treatment. Senescence significantly upregulated the expression of the ABA synthesis gene nine-cis-epoxycarotenoid dioxygenase 2 (GhNCED2). However, MT effectively inhibited the up-regulation of GhNCED2 (Figure 10F–I) and the down-regulation of serotonin N-acetyltransferase (GhSNAT) caused by leaf senescence. In addition, a Pearson’s coefficient test on the levels of endogenous IAA, ABA, GA3, iPA, and MT and the expression levels of related synthetic genes was performed to understand the relationship between hormone biosynthesis (Figure S2). There was a significant positive correlation between IAA, GA3, iPA, MT, GhYUC5, GhGA3ox2, GhIPT2, and GhSNAT and between ABA and GhNCED2. This phenomenon indicated that the content of endogenous hormones is closely associated with the expression of its related synthetic genes. Moreover, spraying MT can inhibit the synthesis of ABA and play a positive regulatory role in IAA, GA3, and iPA.

2.9. Correlation and Principal Component Analyses

A Pearson correlation analysis of 21 representative traits was performed to identify their correlation (Figure S3). SPAD, Pn, Fv/Fm, and RWC were negatively correlated with MDA, H2O2, O2−, and ABA but positively correlated with CAT, IAA, GA3, iPA, MT, and RBCL. NYC1, WRKY27/71, and NAC12 were positively correlated with MDA, H2O2, O2−, and ABA but negatively correlated with SPAD, Pn, Fv/Fm, RWC, CAT, and RBCL.
The contribution rate of principal component 1 was 74.4%. NYC1, WRKY27, WRKY71, NAC12, MDA, H2O2, O2−, and ABA were close to the positive direction of the x-axis, while RWC, CAT, SPAD, Pn, Fv/Fm, and RBCL are in the positive direction of the x-axis negative direction (Figure S4). The contribution rate of principal component 2 was 18.1% and mainly included APX, POD, and SOD. The total contribution rate of 92.9% explained most of the information and revealed that MT significantly affected the expression of senescence marker genes, ROS, and ABA levels, thus regulating leaf senescence.

3. Discussion

Potted vermiculite was used in this study to determine the changes in seedling biomass, photosynthesis, fluorescence parameters, antioxidant enzyme activity, endogenous hormone content, chloroplast ultrastructure, and senescence marker genes expression during drought-induced cotton leaf senescence. This study aimed to test the hypothesis that MT acts morphologically and physiologically to delay cotton leaf senescence.
The phenotypic yellowing and wilting of leaves during leaf senescence are attributed to the degradation of chlorophyll and the increase of membrane lipid peroxidation, thus impeding normal photosynthesis [46]. Pn, MDA, and chlorophyll contents are usually used as effective physiological indicators of leaf senescence [47]. Herein, DS treatment disordered the lamellar structure of the chloroplast, significantly decreased SPAD, Pn, and Fv/Fm, significantly increased MDA, H2O2, and O2− content, and upregulated the expression of senescence marker genes and chlorophyll degradation genes at 14 DAT. These changes showed that 15% PEG-6000 simulated drought, thereby causing leaf senescence at 14 DAT. Notably, the specific symptoms of drought-induced leaf senescence were chlorophyll degradation, chloroplast ultrastructure changes, a sharp decrease in photosynthetic capacity, a significant increase in membrane lipid peroxidation, excessive accumulation of ROS, and differential expression of senescence marker genes [43,48].

3.1. MT Delays Leaf Senescence by Regulating Phytohormone Biosynthesis and Expression of Senescence Marker Genes

Plant hormones are essential in regulating leaf senescence [18]. Notably, plant hormone signal transduction is vital in regulating plant response to drought and water shortage [49]. MT interacts with plant hormones and plays a beneficial role in the aging process and stress response [50]. ABA is the promoter of senescence under biotic and abiotic stress [51]. Dong et al. [52] reported that the ABA content increased gradually during cotton leaf senescence. Interestingly, MT significantly inhibits ABA accumulation and expression of ABA biosynthesis genes (NCED1 and NCED2) in plants [16]. In this study, MT alleviated drought-induced leaf senescence by reducing ABA levels (Figure 7B). Subsequent qPCR assays confirmed that MT decreased the expression of the ABA synthesis gene GhNCED2 (Figure 2G). In contrast, IAA, GA3, and CTK play active roles in delaying leaf senescence. MT can alleviate the inhibition of senescence by regulating IAA, GA3, and CTK biosynthesis [53]. The findings of this study were consistent with previous studies affirming that MT delays leaf senescence under DS by up-regulating IAA, GA3, and iPA biosynthesis-related genes (GhYUC5, GhGA3ox2, and GhIPT2) and increasing the endogenous IAA, GA3, and iPA content (Figure 7).
The synergistic regulation of these hormones is closely associated with the increase of endogenous MT levels through the addition of exogenous MT (Figure 8E). The increase in endogenous MT is attributed to the absorption of exogenous MT or the induction of MT biosynthesis genes in cotton leaves under DS. MT pretreatment increases the expression of MT biosynthesis genes, such as NtSNAT and acetylserotonin O-methyltransferase 1 (NtASMT1), in drought-induced senescence in tobacco leaves [43]. In this study, the MT biosynthesis gene GhSNAT was significantly down-regulated in drought-induced leaf senescence (Figure 10J). This phenomenon demonstrated that exogenous MT can affect the level of endogenous MT, thereby upregulating the levels of IAA, GA3, and iPA and inhibiting ABA biosynthesis, thus delaying leaf senescence.
Leaf senescence is regulated by hormones and the expression of senescence marker genes [54]. GhNAC12 is a candidate gene for the early senescence of upland cotton varieties [55]. Overexpression of GhWRKY27 can promote leaf senescence by reducing the chlorophyll content. GhWRKY71 plays a positive role in regulating leaf senescence [56]. Herein, DS treatment significantly upregulated senescence marker genes. However, MT significantly inhibited the expression of GhWRKY27/71 and GhNAC12 at 14 DAT (Figure 1C–E), suggesting that MT delays leaf senescence by inhibiting the expression of senescence marker genes, such as GhWRKY27/71 and GhNAC12.

3.2. MT Delays Leaf Senescence by Inhibiting Chlorophyll Degradation

Chlorophyll degradation is a sign of the initiation of leaf senescence [57]. Drought-induced leaf senescence accelerates chlorophyll degradation. In this study, MT maintained the SPAD of cotton seedlings at a high level (Figure 1D). A previous study postulated that the exogenous application of MT also alleviates chlorophyll degradation during drought-induced leaf senescence in creeping bentgrass (Agrostis stolonifera L.) [58]. Chlorophyll and chlorophyll-degrading enzymes are distributed in different parts of the chloroplast. The structural damage of chloroplasts during senescence leads to their combination, thereby accelerating chlorophyll degradation [11]. In addition, exogenous MT can alleviate chlorophyll degradation by down-regulating the expression of critical genes, such as non-yellow coloring (NYC) and pheophorbide a oxygenase (PAO), thereby delaying the leaf senescence of tomatoes [16]. This study confirmed that MT could inhibit the expression of the chlorophyll degradation gene NYC1 (Figure 10B). MT-mediated regulation of the expression of critical genes in chlorophyll degradation is thus a potential mechanism for delaying leaf senescence during abiotic stress-induced senescence.
Importantly, this study also demonstrated that MT can maintain a relatively intact chloroplast structure during drought-induced leaf senescence (Figure 9). Notably, DS treatment gradually shortened the chloroplast length and ruptured the chloroplast membrane, matrix lamella, grana, and thylakoid membrane [59]. However, there was a significant reduction in chloroplast damage caused by DS under MT + DS treatment.

3.3. MT Delays Leaf Senescence by Regulating Redox Homeostasis

ROS generation and scavenging ability in plants tend to be unbalanced during leaf senescence. The biological macromolecules are also damaged, leading to membrane lipid peroxidation, cell senescence, and apoptosis [60]. Spraying MT can significantly reduce ROS accumulation and membrane lipid peroxidation in maize (Zea mays L.) [37], soybean (Glycine max L.) [61], and cotton [62]. In this study, the levels of MDA, H2O2, and O2− increased significantly with the aggravation of leaf senescence (Figure 5 and Figure 7). Notably, there was a significant increase in MDA, H2O2, and O2− under MT + DS treatment compared to DS treatment, suggesting that MT can act as an antioxidant to alleviate the damage caused by ROS accumulation in cotton leaves, thereby delaying leaf senescence.
Antioxidant enzymes participate in important pathways that aid plants in removing excess ROS. The defense system of antioxidant enzymes in plants is activated during abiotic stress-induced leaf senescence, causing the activities of SOD, POD, CAT, and APX to increase [63]. The exogenous application of MT significantly increases the activities of antioxidant enzymes in marjoram (Origanum marjorana L.) [64]. In this study, MT significantly increased the activity of the antioxidant enzymes during senescence (Figure 6). Compared to other antioxidant enzymes, CAT was more sensitive to DS and exogenous melatonin. This result is inconsistent with the inference of Tan et al. [17] that CAT has a delayed response to melatonin, possibly because of organelle specificity or other unknown genetic factors. The increase in the activity of antioxidant enzymes indicated that MT alleviates the oxidative damage of cells by strengthening the defense system of antioxidant enzymes, thus delaying leaf senescence.

3.4. MT Delays Leaf Senescence and Promotes Plant Growth by Increasing Photosynthetic Efficiency

A typical feature of leaf senescence is a decrease in photosynthesis caused by changes in the chloroplast structure and function [65,66]. The reduction of photosynthesis induced by premature senescence causes a huge loss in cotton yield and quality in field production [67]. MT can protect the photosynthetic system, thereby improving the Pn, Tr, and Gs during senescence [68]. Herein, the Pn of cotton seedlings was significantly reduced during drought-induced leaf senescence. However, MT-treated seedlings had higher Pn, Gs, Tr, and Ci (Figure 3). MT-mediated protection of the leaf chloroplast structures from oxidative damage is the primary reason for the melatonin-mediated improvement of photosynthesis during drought-induced leaf senescence [69]. Kong et al. [70] reported that the expression level of RBCL gradually decreased with the senescence of cotton leaves. Of note, a decrease in the RBCL level may lead to the degradation of Rubisco, thus reducing the Pn. RBCL protein levels decrease during darkness-induced cucumber leaf senescence. However, MT + DS treatment has been reported to increase the stability of the RBCL protein to maintain a high Pn in cucumber leaves, thus delaying senescence [41]. Herein, MT effectively inhibited the downregulation of RBCL during leaf senescence, thus improving the photosynthetic capacity (Figure 10A).
MT maintains the RWC of plant leaves during DS [71], thus enhancing stomatal opening and conductivity. This phenomenon contributes to the movement of water and carbon dioxide, thereby improving photosynthesis [72]. In this study, MT maintained a high RWC in cotton leaves during drought-induced senescence (Figure 5A). Moreover, the Gs and Tr of cotton seedlings increased significantly under MT + DS treatment. Previous studies postulate that MT increases stomatal opening by regulating anion channel proteins and dehydrin in the guard cells [73]. MT may thus not regulate stomatal opening to reduce transpiration but may promote root growth to improve the water absorption capacity of the plant (Figure 2E–H). These findings suggest that MT can maintain the RWC and high chlorophyll levels of leaves during drought-induced senescence to preserve the stability and efficiency of the photosynthetic organs.
The response centers of photosynthesis in plants are PSII and PSI. Notably, PSII is extremely sensitive to DS [74,75]. Leaf senescence is often accompanied by decreased PSII activity [76,77]. Studies postulate that leaf senescence can lead to a significant decrease in ΦPSII, Fv/Fm, and ETR and an increase in NPQ [78]. Exogenous MT can alleviate the photoinhibition of PSII and improve the tolerance of plants to abiotic stress [79]. These reports are consistent with the results of this study where there was a significant decrease in ΦPSII, Fv/Fm, and ETR and an increase in NPQ during drought-induced cotton leaf senescence. However, exogenous MT effectively reversed this process and inhibited the decrease of potential NPQ activity during leaf senescence (Figure 4). Fv/Fm reflects the damage degree of photosynthetic equipment during stress [80]. Studies report that exogenous MT effectively increases the Fv/Fm of tomato during leaf senescence [81]. In addition, plants can convert excess light energy into heat energy during the actual production process by inducing NPQ under high light conditions to avoid oxidative damage [82]. However, this photoprotection mechanism can cause photosynthetic loss to some extent [83]. The induction and relaxation of NPQ is the primary mechanism affecting the photosynthetic efficiency of crops [84]. The reduction of the NPQ level by exogenous MT provides an opportunity to further improve the photosynthetic capacity of crops, which helps to delay leaf senescence.
Phenotypically, DS treatment significantly inhibited the growth of cotton seedlings, with the leaves showing symptoms of premature senescence. However, MT + DS treatment alleviated DS-induced growth inhibition. MT promoted the growth of cotton during leaf senescence, embodied by higher aboveground and root morphological indexes (Figure 1 and Figure 2). Similar studies postulate that MT promotes the growth of wheat [85], tomato [86], and tobacco [43] under DS. These findings thus further confirm that MT also phenotypically alleviates drought-induced cotton leaf senescence.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

This study used Nongdamian 601, a local commercial cotton (Gossypium hirsutum L.) cultivar widely grown in the Yellow River Basin in China. Sterile cotton seeds were germinated in an incubator at 25 °C for 24 h in the dark, sown in plastic pots (11 cm diameter) containing vermiculite, and then maintained in a greenhouse. The growth conditions in the greenhouse were 14/10 h day/night cycle, 28/25 °C (day/night), with a light intensity of 300 μmol m−2 s−1 during the day, and 45 ± 5% relative humidity. Each pot was irrigated with 100 mL Hoagland nutrient solution (complete nutrient solution) once every two days for one month after the unfolding of the cotyledons.

4.2. Experimental Design

The cotton seedlings were treated with MT and drought treatments upon reaching the five-leaf stage: (1) well-watered and 0 μM MT (CK), (2) drought stress and 0 μM MT (DS), (3) drought stress and 100 μM MT (MT + DS). A randomized complete block design was adopted for the experiment, with each treatment replicated thirty times. Seedlings in the CK treatment were irrigated with 100 mL nutrient solution once every two days for 14 days. Seedlings in the DS treatment were irrigated with 100 mL of 15% PEG-6000-containing nutrient solution to induce severe DS in cotton [87]. Seedlings in the MT + DS treatment were sprayed with MT during the dark cycle until the leaves started dripping [88], once every two days for 14 days. This treatment was extremely successful in reducing DS in a prior trial [86,89]. Pot positions were randomly shuffled daily to reduce the positional effects in the artificial climate chamber. The physiological indices of cotton plants were measured from the third leaf (from the top of the plant) at 0, 7, and 14 days after treatment (DAT). In the index measurements, six repeats were employed during non-destructive sampling, while three repeats were employed during destructive sampling.

4.3. Plant Growth and Root Morphology

Plant heights were measured using a ruler, while the main stem diameter was determined using Vernier calipers. The green leaf area of the whole plant was calculated using the length and width coefficient method based on ruler measurements [90]. Fresh shoots and roots were weighed using an electric balance, while the dry shoot and root weights were determined following the method of Jiang et al. [62]. The root samples were carefully separated from the growth medium using slow-flowing water. Root length, surface area, diameter, and volume were obtained using the method of Zhu et al. [91].

4.4. Evaluation of the Photosynthesis Parameters

The chlorophyll content was measured using SPAD-502 (Konica Minolta, Tokyo, Japan). Leaf photosynthesis parameters, including the net photosynthetic rate (Pn), stomal conductance (Gs), transpiration rate (Tr), and intercellular CO2 concentration (Ci), were measured using an LI-6800 photosynthetic instrument (LI-COR, Lincoln, NE, USA). The instrument was set at a light intensity of 300 μmol m−2 s−1. The light-response curve of photosynthesis was measured at 14 DAT with the light intensity set at 0, 30, 70, 100, 150, 200, 300, 600, 900, 1200, 1500, and 1800 μmol m−2 s−1. Each treatment was replicated three times and the averages used to fit the light response curve [92]. Chlorophyll fluorescence parameters were measured using a PAM2500 portable chlorophyll fluorometer (Heinz Walz GmbH, Effeltrich, Germany). The parameters included the maximum photochemical efficiency (Fv/Fm) of PSII, the actual photochemical quantum yield of PSII (ΦPSII), non-photochemical quenching (NPQ), and apparent electron transfer efficiency (ETR). There were six repeats in each treatment.

4.5. Relative Water Content of the Leaves

The relative water content (RWC) of the leaves was measured following the method of Barrs and Weatherley [93].

4.6. The Antioxidant Enzyme Activity and Contents of Reactive Oxygen Species (ROS) and Malondialdehyde (MDA)

The activity of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX), and the contents of hydrogen peroxide (H2O2), superoxide anions (O2−), and MDA, were determined following the instructions of the corresponding kits (Nanjing Jiancheng Institute of Biological Engineering, Nanjing, China).
Cotton leaves were stained with 1 mg/mL 3,3-diaminobenzidine (DAB) and 1 mg/mL nitro-blue tetrazolium (NBT) at 14 DAT to determine the accumulation of H2O2 and O2− in the leaves [94].

4.7. Determination of the Hormone Content

Frozen samples (0.2 g) were ground into powder in liquid nitrogen. The contents of auxins (IAA), abscisic acid (ABA), gibberellin acid (GA3), and isopentenyladenine (iPA) were subsequently measured using ELISA as described by Duan et al. [95]. The content of endogenous melatonin was determined using the plant melatonin Assay Kit (YJ036336, Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China).

4.8. Transmission Electron Microscope (TEM) Analysis

Cotton leaves were sampled at 14 DAT and were subsequently sliced and prepared as described by Jiang et al. [62]. The leaf slices were subsequently examined using a transmission electron microscope (FEI Tecnai Spirit 120kv, FEI Company, Hillsborough, OR, USA).

4.9. qRT-PCR

Total plant RNA was isolated using the FastPure Plant Total RNA isolation Kit (Vazyme, Nanjing, China), followed by cDNA synthesis using the HiScript® Ⅱ Q RT SuperMix for qPCR Kit (Vazyme, Nanjing, China). Primers were designed using the Primer5.0 software (Primer Premier, Oakville, ON, Canada), and their specificity was detected using the Primer-BLAST tool on NCBI. The primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and their sequences are outlined in Table 2. The gene expression level per treatment was the average of three biological replicates.

4.10. Statistical Analysis

IBM SPSS Statistics 26.0 software (IBM Corp, Armonk, NY, USA) was used for one-way analysis of variance (ANOVA) among the treatment groups. Figures were drawn using GraphPad Prism 8.0 (Graph Pad Software, San Diego, CA, USA) and Origin Pro 2022b (OriginLab, Northampton, MA, USA) based on the statistical analysis results.

5. Conclusions

This study revealed that spraying MT can increase the content of endogenous melatonin, coordinate the up-regulation of IAA, GA3, and iPA, inhibit ABA synthesis and chlorophyll degradation, and inhibit the expression of senescence genes, thus delaying leaf senescence (Figure 11). MT also enhanced the antioxidant enzyme activity, decreased the membrane lipid peroxidation level and excessive accumulation of ROS, and reduced H2O2 and O2− by 33.44% and 37.68%, respectively, thus alleviating the inhibition of DS-induced leaf senescence on the growth of cotton seedlings. Chloroplast ultrastructure analysis further demonstrated that MT protected the integrity of the chloroplast lamellar structure during drought-induced leaf senescence. The reduction of oxidative damage in cotton leaves can be attributed to the maintenance of higher chlorophyll content and RWC and increased photosynthetic capacity. Moreover, exogenous MT delayed leaf senescence by inhibiting the expression of senescence genes, such as GhWRKY27/71 and GhNAC12. The morphological, physiological, biochemical, and chloroplast ultrastructure analysis findings of this study collectively highlight that spraying MT can potentially delay drought-induced cotton leaf senescence.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24087269/s1.

Author Contributions

K.Y., L.L. and C.L. conceived the research idea and proposed the methodology. K.Y., H.S., L.Z., Y.Z. and K.Z. contributed to equipment preparation and data acquisition. A.L., J.Z., X.L., Z.B., M.L. and H.Z. validated the results. K.Y. wrote the paper. L.L. and C.L. revised the paper. L.L. and C.L. acquired the grants that actualized this project leading to this publication. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the National Natural Science Foundation of China (No. 32272220 and 32172120) and the Natural Science Foundation of Hebei Province (No. C2020204066 and C2021204140).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Woo, H.R.; Masclaux-Daubresse, C.; Lim, P.O. Plant Senescence: How Plants Know When and How to Die. J. Exp. Bot. 2018, 69, 715–718. [Google Scholar] [CrossRef]
  2. Sade, N.; del Mar Rubio-Wilhelmi, M.; Umnajkitikorn, K.; Blumwald, E. Stress-Induced Senescence and Plant Tolerance to Abiotic Stress. J. Exp. Bot. 2018, 69, 845–853. [Google Scholar] [CrossRef] [PubMed]
  3. Pettigrew, W.T.; McCarty, J.C.; Vaughn, K.C. Leaf Senescence-like Characteristics Contribute to Cotton’s Premature Photosynthetic Decline. Photosynth. Res. 2000, 65, 187–195. [Google Scholar] [CrossRef] [PubMed]
  4. Djanaguiraman, M.; Prasad, P.V.V.; Djanaguiraman, M.; Prasad, P.V.V. Ethylene Production under High Temperature Stress Causes Premature Leaf Senescence in Soybean. Funct. Plant Biol. 2010, 37, 1071–1084. [Google Scholar] [CrossRef]
  5. Constable, G.A.; Bange, M.P. The Yield Potential of Cotton (Gossypium hirsutum L.). Field Crops Res. 2015, 182, 98–106. [Google Scholar] [CrossRef]
  6. Abdelraheem, A.; Adams, N.; Zhang, J. Effects of Drought on Agronomic and Fiber Quality in an Introgressed Backcross Inbred Line Population of Upland Cotton under Field Conditions. Field Crops Res. 2020, 254, 107850. [Google Scholar] [CrossRef]
  7. Qi, F.; Jian, G.; Li, J. Discrimination on the Relationship among Cotton Premature Senescence, Red Leaf Disease and Alternaria Leaf Spot Disease. Cotton Sci. 2013, 25, 81–85. (In Chinese) [Google Scholar]
  8. Radin, J.W. Water Relations of Cotton Plants under Nitrogen Deficiency. IV. Leaf Senescence during Drought and Its Relation to Stomatal Closure. Physiol. Plant. 1981, 51, 145–149. [Google Scholar] [CrossRef]
  9. Abdelraheem, A.; Esmaeili, N.; O’Connell, M.; Zhang, J. Progress and Perspective on Drought and Salt Stress Tolerance in Cotton. Ind. Crops Prod. 2019, 130, 118–129. [Google Scholar] [CrossRef]
  10. Panigrahi, P.K.; Biswal, U.C. Ageing of Chloroplasts in Vitro I. Quantitative Analysis of the Degradation of Pigments, Proteins and Nucleic Acids. Plant Cell Physiol. 1979, 20, 775–779. [Google Scholar] [CrossRef]
  11. Hörtensteiner, S. Chlorophyll Degradation during Senescence. Annu. Rev. Plant Biol. 2006, 57, 55–77. [Google Scholar] [CrossRef]
  12. Rajcan, I.; Dwyer, L.M.; Tollenaar, M. Note on Relationship between Leaf Soluble Carbohydrate and Chlorophyll Concentrations in Maize during Leaf Senescence. Field Crops Res. 1999, 63, 13–17. [Google Scholar] [CrossRef]
  13. Sakuraba, Y. Light-Mediated Regulation of Leaf Senescence. Int. J. Mol. Sci. 2021, 22, 3291. [Google Scholar] [CrossRef]
  14. Khanna-Chopra, R. Leaf Senescence and Abiotic Stresses Share Reactive Oxygen Species-Mediated Chloroplast Degradation. Protoplasma 2012, 249, 469–481. [Google Scholar] [CrossRef] [PubMed]
  15. Shi, X.; Xu, S.; Mu, D.; Sadeghnezhad, E.; Li, Q.; Ma, Z.; Zhao, L.; Zhang, Q.; Wang, L. Exogenous Melatonin Delays Dark-Induced Grape Leaf Senescence by Regulation of Antioxidant System and Senescence Associated Genes (SAGs). Plants 2019, 8, 366. [Google Scholar] [CrossRef] [Green Version]
  16. Jahan, M.S.; Shu, S.; Wang, Y.; Hasan, M.d.M.; El-Yazied, A.A.; Alabdallah, N.M.; Hajjar, D.; Altaf, M.A.; Sun, J.; Guo, S. Melatonin Pretreatment Confers Heat Tolerance and Repression of Heat-Induced Senescence in Tomato through the Modulation of ABA- and GA-Mediated Pathways. Front. Plant Sci. 2021, 12, 650955. [Google Scholar] [CrossRef] [PubMed]
  17. Tan, X.; Zhao, Y.; Shan, W.; Kuang, J.; Lu, W.; Su, X.; Tao, N.; Lakshmanan, P.; Chen, J. Melatonin Delays Leaf Senescence of Postharvest Chinese Flowering Cabbage through ROS Homeostasis. Food Res. Int. 2020, 138, 109790. [Google Scholar] [CrossRef] [PubMed]
  18. Jibran, R.; Hunter, D.A.; Dijkwel, P.P. Hormonal Regulation of Leaf Senescence through Integration of Developmental and Stress Signals. Plant Mol. Biol. 2013, 82, 547–561. [Google Scholar] [CrossRef]
  19. Asad, M.; Zakari, S.; Zhao, Q.; Zhou, L.; Ye, Y.; Cheng, F. Abiotic Stresses Intervene with ABA Signaling to Induce Destructive Metabolic Pathways Leading to Death: Premature Leaf Senescence in Plants. Int. J. Mol. Sci. 2019, 20, 256. [Google Scholar] [CrossRef] [Green Version]
  20. Kim, J.I.; Murphy, A.S.; Baek, D.; Lee, S.-W.; Yun, D.-J.; Bressan, R.A.; Narasimhan, M.L. YUCCA6 Over-Expression Demonstrates Auxin Function in Delaying Leaf Senescence in Arabidopsis thaliana. J. Exp. Bot. 2011, 62, 3981–3992. [Google Scholar] [CrossRef]
  21. Singh, S.; Letham, D.S.; Palni, L.M.S. Cytokinin Biochemistry in Relation to Leaf Senescence. VII. Endogenous Cytokinin Levels and Exogenous Applications of Cytokinins in Relation to Sequential Leaf Senescence of Tobacco. Physiol. Plant. 1992, 86, 388–397. [Google Scholar] [CrossRef]
  22. Fletcher, R.A.; Osborne, D.J. Regulation of Protein and Nucleic Acid Synthesis by Gibberellin during Leaf Senescence. Nature 1965, 207, 1176–1177. [Google Scholar] [CrossRef]
  23. Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY Transcription Factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [PubMed]
  24. Kim, H.J.; Nam, H.G.; Lim, P.O. Regulatory Network of NAC Transcription Factors in Leaf Senescence. Curr. Opin. Plant Biol. 2016, 33, 48–56. [Google Scholar] [CrossRef]
  25. Bhattacharya, A. Soil Water Deficit and Physiological Issues in Plants; Springer: Singapore, 2021; ISBN 978-981-336-275-8. [Google Scholar]
  26. Pic, E.; de la Serve, B.T.; Tardieu, F.; Turc, O. Leaf Senescence Induced by Mild Water Deficit Follows the Same Sequence of Macroscopic, Biochemical, and Molecular Events as Monocarpic Senescence in Pea. Plant Physiol. 2002, 128, 236–246. [Google Scholar] [CrossRef]
  27. Bandurska, H. Drought Stress Responses: Coping Strategy and Resistance. Plants 2022, 11, 922. [Google Scholar] [CrossRef]
  28. Dong, H.; Li, W.; Eneji, A.E.; Zhang, D. Nitrogen Rate and Plant Density Effects on Yield and Late-Season Leaf Senescence of Cotton Raised on a Saline Field. Field Crops Res. 2012, 126, 137–144. [Google Scholar] [CrossRef]
  29. Chen, Y.; Dong, H. Mechanisms and Regulation of Senescence and Maturity Performance in Cotton. Field Crops Res. 2016, 189, 1–9. [Google Scholar] [CrossRef]
  30. Cook, B.I.; Smerdon, J.E.; Seager, R.; Coats, S. Global Warming and 21st Century Drying. Clim. Dyn. 2014, 43, 2607–2627. [Google Scholar] [CrossRef] [Green Version]
  31. Lesk, C.; Rowhani, P.; Ramankutty, N. Influence of Extreme Weather Disasters on Global Crop Production. Nature 2016, 529, 84–87. [Google Scholar] [CrossRef] [Green Version]
  32. Rivero, R.M.; Kojima, M.; Gepstein, A.; Sakakibara, H.; Mittler, R.; Gepstein, S.; Blumwald, E. Delayed Leaf Senescence Induces Extreme Drought Tolerance in a Flowering Plant. Proc. Natl. Acad. Sci. USA 2007, 104, 19631–19636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.W.; Schloot, W. Melatonin in Edible Plants Identified by Radioimmunoassay and by High Performance Liquid Chromatography-Mass Spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [PubMed]
  34. Marta, B.; Szafrańska, K.; Posmyk, M.M. Exogenous Melatonin Improves Antioxidant Defense in Cucumber Seeds (Cucumis sativus L.) Germinated under Chilling Stress. Front. Plant Sci. 2016, 7, 575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Pelagio-Flores, R.; Muñoz-Parra, E.; Ortiz-Castro, R.; López-Bucio, J. Melatonin Regulates Arabidopsis Root System Architecture Likely Acting Independently of Auxin Signaling: Role of Melatonin in Root Architecture and Auxin Responses. J. Pineal Res. 2012, 53, 279–288. [Google Scholar] [CrossRef] [PubMed]
  36. Hernández-Ruiz, J.; Cano, A.; Arnao, M.B. Melatonin Acts as a Growth-Stimulating Compound in Some Monocot Species: Melatonin as Growth Promoter in Plants. J. Pineal Res. 2005, 39, 137–142. [Google Scholar] [CrossRef]
  37. Ahmad, S.; Su, W.; Kamran, M.; Ahmad, I.; Meng, X.; Wu, X.; Javed, T.; Han, Q. Foliar Application of Melatonin Delay Leaf Senescence in Maize by Improving the Antioxidant Defense System and Enhancing Photosynthetic Capacity under Semi-Arid Regions. Protoplasma 2020, 257, 1079–1092. [Google Scholar] [CrossRef]
  38. Martínez-Lorente, S.E.; Pardo-Hernández, M.; Martí-Guillén, J.M.; López-Delacalle, M.; Rivero, R.M. Interaction between Melatonin and NO: Action Mechanisms, Main Targets, and Putative Roles of the Emerging Molecule NOmela. Int. J. Mol. Sci. 2022, 23, 6646. [Google Scholar] [CrossRef]
  39. Wang, P.; Sun, X.; Li, C.; Wei, Z.; Liang, D.; Ma, F. Long-Term Exogenous Application of Melatonin Delays Drought-Induced Leaf Senescence in Apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef]
  40. Zhang, J.; Li, H.; Xu, B.; Li, J.; Huang, B. Exogenous Melatonin Suppresses Dark-Induced Leaf Senescence by Activating the Superoxide Dismutase-Catalase Antioxidant Pathway and Down-Regulating Chlorophyll Degradation in Excised Leaves of Perennial Ryegrass (Lolium perenne L.). Front. Plant Sci. 2016, 7, 1500. [Google Scholar] [CrossRef] [Green Version]
  41. Liu, K.; Jing, T.; Wang, Y.; Ai, X.; Bi, H. Melatonin Delays Leaf Senescence and Improves Cucumber Yield by Modulating Chlorophyll Degradation and Photoinhibition of PSII and PSI. Environ. Exp. Bot. 2022, 200, 104915. [Google Scholar] [CrossRef]
  42. Arnao, M.B.; Hernández-Ruiz, J. Melatonin and Its Relationship to Plant Hormones. Ann. Bot. 2018, 121, 195–207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Chen, Z.; Jia, W.; Li, S.; Xu, J.; Xu, Z. Enhancement of Nicotiana tabacum Resistance against Dehydration-Induced Leaf Senescence via Metabolite/Phytohormone-Gene Regulatory Networks Modulated by Melatonin. Front. Plant Sci. 2021, 12, 686062. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, J.; Shi, Y.; Zhang, X.; Du, H.; Xu, B.; Huang, B. Melatonin Suppression of Heat-Induced Leaf Senescence Involves Changes in Abscisic Acid and Cytokinin Biosynthesis and Signaling Pathways in Perennial Ryegrass (Lolium perenne L.). Environ. Exp. Bot. 2017, 138, 36–45. [Google Scholar] [CrossRef]
  45. Zhao, Y.-Q.; Zhang, Z.-W.; Chen, Y.-E.; Ding, C.-B.; Yuan, S.; Reiter, R.J.; Yuan, M. Melatonin: A Potential Agent in Delaying Leaf Senescence. Crit. Rev. Plant Sci. 2021, 40, 1–22. [Google Scholar] [CrossRef]
  46. Hörtensteiner, S. Stay-Green Regulates Chlorophyll and Chlorophyll-Binding Protein Degradation during Senescence. Trends Plant Sci. 2009, 14, 155–162. [Google Scholar] [CrossRef]
  47. Kamran, M.; Ahmad, S.; Ahmad, I.; Hussain, I.; Meng, X.; Zhang, X.; Javed, T.; Ullah, M.; Ding, R.; Xu, P.; et al. Paclobutrazol Application Favors Yield Improvement of Maize under Semiarid Regions by Delaying Leaf Senescence and Regulating Photosynthetic Capacity and Antioxidant System during Grain-Filling Stage. Agronomy 2020, 10, 187. [Google Scholar] [CrossRef] [Green Version]
  48. Lee, S.; Seo, P.J.; Lee, H.-J.; Park, C.-M. A NAC Transcription Factor NTL4 Promotes Reactive Oxygen Species Production during Drought-Induced Leaf Senescence in Arabidopsis: NTL4 in Drought-Induced Leaf Senescence. Plant J. 2012, 70, 831–844. [Google Scholar] [CrossRef]
  49. Gupta, A.; Rico-Medina, A.; Caño-Delgado, A.I. The Physiology of Plant Responses to Drought. Science 2020, 368, 266–269. [Google Scholar] [CrossRef]
  50. Kanwar, M.K.; Yu, J.; Zhou, J. Phytomelatonin: Recent Advances and Future Prospects. J. Pineal Res. 2018, 65, e12526. [Google Scholar] [CrossRef] [Green Version]
  51. Shimamura, S.; Yoshioka, T.; Yamamoto, R.; Hiraga, S.; Nakamura, T.; Shimada, S.; Komatsu, S. Role of Abscisic Acid in Flood-Induced Secondary Aerenchyma Formation in Soybean (Glycine max) Hypocotyls. Plant Prod. Sci. 2014, 17, 131–137. [Google Scholar] [CrossRef]
  52. Dong, H.; Niu, Y.; Li, W.; Zhang, D. Effects of Cotton Rootstock on Endogenous Cytokinins and Abscisic Acid in Xylem Sap and Leaves in Relation to Leaf Senescence. J. Exp. Bot. 2008, 59, 1295–1304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Pan, Y.; Xu, X.; Li, L.; Sun, Q.; Wang, Q.; Huang, H.; Tong, Z.; Zhang, J. Melatonin-Mediated Development and Abiotic Stress Tolerance in Plants. Front. Plant Sci. 2023, 14, 1100827. [Google Scholar] [CrossRef] [PubMed]
  54. Smart, C.M. Gene Expression during Leaf Senescence. New Phytol. 1994, 126, 419–448. [Google Scholar] [CrossRef] [PubMed]
  55. Shah, S.T.; Pang, C.; Fan, S.; Song, M.; Arain, S.; Yu, S. Isolation and Expression Profiling of GhNAC Transcription Factor Genes in Cotton (Gossypium hirsutum L.) during Leaf Senescence and in Response to Stresses. Gene 2013, 531, 220–234. [Google Scholar] [CrossRef]
  56. Bengoa Luoni, S.; Astigueta, F.H.; Nicosia, S.; Moschen, S.; Fernandez, P.; Heinz, R. Transcription Factors Associated with Leaf Senescence in Crops. Plants 2019, 8, 411. [Google Scholar] [CrossRef] [Green Version]
  57. Matile, P.; Hörtensteiner, S.; Thomas, H. Chlorophyll Degradation. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 67–95. [Google Scholar] [CrossRef] [Green Version]
  58. Ma, X.; Zhang, J.; Burgess, P.; Rossi, S.; Huang, B. Interactive Effects of Melatonin and Cytokinin on Alleviating Drought-Induced Leaf Senescence in Creeping Bentgrass (Agrostis stolonifera). Environ. Exp. Bot. 2018, 145, 1–11. [Google Scholar] [CrossRef]
  59. Ackerson, R.C.; Hebert, R.R. Osmoregulation in Cotton in Response to Water Stress: I. Alterations in Photosynthesis, Leaf Conductance, Translocation, and Ultrastructure. Plant Physiol. 1981, 67, 484–488. [Google Scholar] [CrossRef] [Green Version]
  60. Jajic, I.; Sarna, T.; Strzalka, K. Senescence, Stress, and Reactive Oxygen Species. Plants 2015, 4, 393–411. [Google Scholar] [CrossRef] [Green Version]
  61. Imran, M.; Aaqil Khan, M.; Shahzad, R.; Bilal, S.; Khan, M.; Yun, B.-W.; Khan, A.L.; Lee, I.-J. Melatonin Ameliorates Thermotolerance in Soybean Seedling through Balancing Redox Homeostasis and Modulating Antioxidant Defense, Phytohormones and Polyamines Biosynthesis. Molecules 2021, 26, 5116. [Google Scholar] [CrossRef]
  62. Jiang, D.; Lu, B.; Liu, L.; Duan, W.; Meng, Y.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Dong, H.; et al. Exogenous Melatonin Improves the Salt Tolerance of Cotton by Removing Active Oxygen and Protecting Photosynthetic Organs. BMC Plant Biol. 2021, 21, 331. [Google Scholar] [CrossRef] [PubMed]
  63. Laxa, M.; Liebthal, M.; Telman, W.; Chibani, K.; Dietz, K.-J. The Role of the Plant Antioxidant System in Drought Tolerance. Antioxidants 2019, 8, 94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Farouk, S.; Al-Amri, S.M. Ameliorative Roles of Melatonin and/or Zeolite on Chromium-Induced Leaf Senescence in Marjoram Plants by Activating Antioxidant Defense, Osmolyte Accumulation, and Ultrastructural Modification. Ind. Crops Prod. 2019, 142, 111823. [Google Scholar] [CrossRef]
  65. Balazadeh, S.; Parlitz, S.; Mueller-Roeber, B.; Meyer, R.C. Natural Developmental Variations in Leaf and Plant Senescence in Arabidopsis thaliana. Plant Biol. 2008, 10, 136–147. [Google Scholar] [CrossRef] [PubMed]
  66. Krieger-Liszkay, A.; Krupinska, K.; Shimakawa, G. The Impact of Photosynthesis on Initiation of Leaf Senescence. Physiol. Plant. 2019, 166, 148–164. [Google Scholar] [CrossRef]
  67. Wang, R.; Gao, M.; Ji, S.; Wang, S.; Meng, Y.; Zhou, Z. Carbon Allocation, Osmotic Adjustment, Antioxidant Capacity and Growth in Cotton under Long-Term Soil Drought during Flowering and Boll-Forming Period. Plant Physiol. Biochem. 2016, 107, 137–146. [Google Scholar] [CrossRef]
  68. Altaf, M.A.; Shahid, R.; Ren, M.-X.; Altaf, M.M.; Khan, L.U.; Shahid, S.; Jahan, M.S. Melatonin Alleviates Salt Damage in Tomato Seedling: A Root Architecture System, Photosynthetic Capacity, Ion Homeostasis, and Antioxidant Enzymes Analysis. Sci. Hortic. 2021, 285, 110145. [Google Scholar] [CrossRef]
  69. Meng, J.-F.; Xu, T.-F.; Wang, Z.-Z.; Fang, Y.-L.; Xi, Z.-M.; Zhang, Z.-W. The Ameliorative Effects of Exogenous Melatonin on Grape Cuttings under Water-Deficient Stress: Antioxidant Metabolites, Leaf Anatomy, and Chloroplast Morphology. J. Pineal Res. 2014, 57, 200–212. [Google Scholar] [CrossRef]
  70. Kong, X.; Luo, Z.; Dong, H.; Eneji, A.E.; Li, W.; Lu, H. Gene Expression Profiles Deciphering Leaf Senescence Variation between Early- and Late-Senescence Cotton Lines. PLoS ONE 2013, 8, e69847. [Google Scholar] [CrossRef] [Green Version]
  71. Hu, W.; Zhang, J.; Yan, K.; Zhou, Z.; Zhao, W.; Zhang, X.; Pu, Y.; Yu, R. Beneficial Effects of Abscisic Acid and Melatonin in Overcoming Drought Stress in Cotton (Gossypium hirsutum L.). Physiol. Plant. 2021, 173, 2041–2054. [Google Scholar] [CrossRef]
  72. Khan, M.N.; Zhang, J.; Luo, T.; Liu, J.; Rizwan, M.; Fahad, S.; Xu, Z.; Hu, L. Seed Priming with Melatonin Coping Drought Stress in Rapeseed by Regulating Reactive Oxygen Species Detoxification: Antioxidant Defense System, Osmotic Adjustment, Stomatal Traits and Chloroplast Ultrastructure Perseveration. Ind. Crops Prod. 2019, 140, 111597. [Google Scholar] [CrossRef]
  73. Arnao, M.B.; Hernández-Ruiz, J. Melatonin: A New Plant Hormone and/or a Plant Master Regulator? Trends Plant Sci. 2019, 24, 38–48. [Google Scholar] [CrossRef] [PubMed]
  74. Oukarroum, A.; Bussotti, F.; Goltsev, V.; Kalaji, H.M. Correlation between Reactive Oxygen Species Production and Photochemistry of Photosystems I and II in Lemna gibba L. Plants under Salt Stress. Environ. Exp. Bot. 2015, 109, 80–88. [Google Scholar] [CrossRef]
  75. Sperdouli, I.; Moustaka, J.; Ouzounidou, G.; Moustakas, M. Leaf Age-Dependent Photosystem II Photochemistry and Oxidative Stress Responses to Drought Stress in Arabidopsis thaliana Are Modulated by Flavonoid Accumulation. Molecules 2021, 26, 4157. [Google Scholar] [CrossRef]
  76. Talla, S.K.; Panigrahy, M.; Kappara, S.; Nirosha, P.; Neelamraju, S.; Ramanan, R. Cytokinin Delays Dark-Induced Senescence in Rice by Maintaining the Chlorophyll Cycle and Photosynthetic Complexes. J. Exp. Bot. 2016, 67, 1839–1851. [Google Scholar] [CrossRef] [Green Version]
  77. Janečková, H.; Husičková, A.; Lazár, D.; Ferretti, U.; Pospíšil, P.; Špundová, M. Exogenous Application of Cytokinin during Dark Senescence Eliminates the Acceleration of Photosystem II Impairment Caused by Chlorophyll b Deficiency in Barley. Plant Physiol. Biochem. 2019, 136, 43–51. [Google Scholar] [CrossRef]
  78. Wingler, A.; Marès, M.; Pourtau, N. Spatial Patterns and Metabolic Regulation of Photosynthetic Parameters during Leaf Senescence. New Phytol. 2004, 161, 781–789. [Google Scholar] [CrossRef]
  79. Fleta-Soriano, E.; Díaz, L.; Bonet, E.; Munné-Bosch, S. Melatonin May Exert a Protective Role against Drought Stress in Maize. J. Agron. Crop Sci. 2017, 203, 286–294. [Google Scholar] [CrossRef]
  80. Kusaba, M.; Ito, H.; Morita, R.; Iida, S.; Sato, Y.; Fujimoto, M.; Kawasaki, S.; Tanaka, R.; Hirochika, H.; Nishimura, M.; et al. Rice Non-Yellow Coloring1 Is Involved in Light-Harvesting Complex II and Grana Degradation during Leaf Senescence. Plant Cell 2007, 19, 1362–1375. [Google Scholar] [CrossRef] [Green Version]
  81. Wang, K.; Cai, S.; Xing, Q.; Qi, Z.; Fotopoulos, V.; Yu, J.; Zhou, J. Melatonin Delays Dark-induced Leaf Senescence by Inducing MiR171b Expression in Tomato. J. Pineal Res. 2022, 72, e12792. [Google Scholar] [CrossRef]
  82. Bassi, R.; Dall’Osto, L. Dissipation of Light Energy Absorbed in Excess: The Molecular Mechanisms. Annu. Rev. Plant Biol. 2021, 72, 47–76. [Google Scholar] [CrossRef] [PubMed]
  83. Werner, C.; Ryel, R.J.; Correia, O.; Beyschlag, W. Effects of Photoinhibition on Whole-plant Carbon Gain Assessed with a Photosynthesis Model. Plant Cell Environ. 2001, 24, 27–40. [Google Scholar] [CrossRef]
  84. De Souza, A.P.; Burgess, S.J.; Doran, L.; Hansen, J.; Manukyan, L.; Maryn, N.; Gotarkar, D.; Leonelli, L.; Niyogi, K.K.; Long, S.P. Soybean Photosynthesis and Crop Yield Are Improved by Accelerating Recovery from Photoprotection. Science 2022, 377, 851–854. [Google Scholar] [CrossRef] [PubMed]
  85. Cui, G.; Zhao, X.; Liu, S.; Sun, F.; Zhang, C.; Xi, Y. Beneficial Effects of Melatonin in Overcoming Drought Stress in Wheat Seedlings. Plant Physiol. Biochem. 2017, 118, 138–149. [Google Scholar] [CrossRef]
  86. Altaf, M.A.; Shahid, R.; Ren, M.-X.; Naz, S.; Altaf, M.M.; Khan, L.U.; Tiwari, R.K.; Lal, M.K.; Shahid, M.A.; Kumar, R.; et al. Melatonin Improves Drought Stress Tolerance of Tomato by Modulating Plant Growth, Root Architecture, Photosynthesis, and Antioxidant Defense System. Antioxidants 2022, 11, 309. [Google Scholar] [CrossRef] [PubMed]
  87. Li, Z.; Li, L.; Zhou, K.; Zhang, Y.; Han, X.; Din, Y.; Ge, X.; Qin, W.; Wang, P.; Li, F.; et al. GhWRKY6 Acts as a Negative Regulator in Both Transgenic Arabidopsis and Cotton during Drought and Salt Stress. Front. Genet. 2019, 10, 392. [Google Scholar] [CrossRef]
  88. Murch, S.J.; KrishnaRaj, S.; Saxena, P.K. Tryptophan Is a Precursor for Melatonin and Serotonin Biosynthesis in in Vitro Regenerated St. John’s Wort (Hypericum perforatum L. Cv. Anthos) Plants. Plant Cell Rep. 2000, 19, 698–704. [Google Scholar] [CrossRef]
  89. Khattak, W.A.; He, J.; Abdalmegeed, D.; Hu, W.; Wang, Y.; Zhou, Z. Foliar Melatonin Stimulates Cotton Boll Distribution Characteristics by Modifying Leaf Sugar Metabolism and Antioxidant Activities during Drought Conditions. Physiol. Plant. 2022, 174, e13526. [Google Scholar] [CrossRef]
  90. Mao, L.; Zhang, L.; Zhao, X.; Liu, S.; van der Werf, W.; Zhang, S.; Spiertz, H.; Li, Z. Crop Growth, Light Utilization and Yield of Relay Intercropped Cotton as Affected by Plant Density and a Plant Growth Regulator. Field Crops Res. 2014, 155, 67–76. [Google Scholar] [CrossRef]
  91. Zhu, L.; Liu, L.; Sun, H.; Zhang, Y.; Liu, X.; Wang, N.; Chen, J.; Zhang, K.; Bai, Z.; Wang, G.; et al. The Responses of Lateral Roots and Root Hairs to Nitrogen Stress in Cotton Based on Daily Root Measurements. J. Agron. Crop Sci. 2022, 208, 89–105. [Google Scholar] [CrossRef]
  92. Ye, Z.P.; Yu, Q. A Coupled Model of Stomatal Conductance and Photosynthesis for Winter Wheat. Photosynthetica 2008, 46, 637–640. [Google Scholar] [CrossRef]
  93. Barrs, H.; Weatherley, P. A Re-Examination of the Relative Turgidity Technique for Estimating Water Deficits in Leaves. Aust. J. Biol. Sci. 1962, 15, 413. [Google Scholar] [CrossRef] [Green Version]
  94. Daud, M.K.; Quiling, H.; Lei, M.; Ali, B.; Zhu, S.J. Ultrastructural, Metabolic and Proteomic Changes in Leaves of Upland Cotton in Response to Cadmium Stress. Chemosphere 2015, 120, 309–320. [Google Scholar] [CrossRef] [PubMed]
  95. Duan, W.; Lu, B.; Liu, L.; Meng, Y.; Ma, X.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Dong, H.; et al. Effects of Exogenous Melatonin on Root Physiology, Transcriptome and Metabolome of Cotton Seedlings under Salt Stress. Int. J. Mol. Sci. 2022, 23, 9456. [Google Scholar] [CrossRef]
Ijms 24 07269 g001 550
Figure 1. Photos and bar graphs showing the effects of melatonin on the phenotype (A), plant height (B), stem diameter (C), leaf area (D), and SPAD value (E) of cotton seedlings during drought-induced leaf senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 1. Photos and bar graphs showing the effects of melatonin on the phenotype (A), plant height (B), stem diameter (C), leaf area (D), and SPAD value (E) of cotton seedlings during drought-induced leaf senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g001
Ijms 24 07269 g002 550
Figure 2. Bar graphs showing the effects of melatonin on the fresh shoot weight (A), fresh root weight (B), dry shoot weight (C), dry root weight (D), root length (E), root surface area (F), average root diameter (G), and root volume (H) of cotton seedlings during drought-induced leaf senescence. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 2. Bar graphs showing the effects of melatonin on the fresh shoot weight (A), fresh root weight (B), dry shoot weight (C), dry root weight (D), root length (E), root surface area (F), average root diameter (G), and root volume (H) of cotton seedlings during drought-induced leaf senescence. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g002
Ijms 24 07269 g003 550
Figure 3. Bar graphs showing the effects of melatonin on the net photosynthetic rate (Pn; A), transpiration rate (Tr; B), intercellular CO2 concentration (Ci; C), and stomatal conductance (Gs; D) of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 3. Bar graphs showing the effects of melatonin on the net photosynthetic rate (Pn; A), transpiration rate (Tr; B), intercellular CO2 concentration (Ci; C), and stomatal conductance (Gs; D) of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g003
Ijms 24 07269 g004 550
Figure 4. Bar graphs showing the effects of melatonin on the maximum photochemical efficiency (Fv/Fm; A), PSII actual photochemical quantum yield (ΦPSII; B), electron transfer efficiency (ETR; C), and nonphotochemical quenching (NPQ; D) of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 4. Bar graphs showing the effects of melatonin on the maximum photochemical efficiency (Fv/Fm; A), PSII actual photochemical quantum yield (ΦPSII; B), electron transfer efficiency (ETR; C), and nonphotochemical quenching (NPQ; D) of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g004
Ijms 24 07269 g005 550
Figure 5. Line graphs showing the effects of melatonin on the relative water content (RWC; A) and malonaldehyde (MDA; B) contents of cotton leaves during drought-induced senescence. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 5. Line graphs showing the effects of melatonin on the relative water content (RWC; A) and malonaldehyde (MDA; B) contents of cotton leaves during drought-induced senescence. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g005
Ijms 24 07269 g006 550
Figure 6. Bar graphs showing the effects of melatonin on the superoxide dismutase (SOD; A), peroxidase (POD; B), catalase (CAT; C), and ascorbate peroxidase (APX; D) activity of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 6. Bar graphs showing the effects of melatonin on the superoxide dismutase (SOD; A), peroxidase (POD; B), catalase (CAT; C), and ascorbate peroxidase (APX; D) activity of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 6; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g006
Ijms 24 07269 g007 550
Figure 7. Leaf photos and bar graphs showing the effect of melatonin on the contents of ROS in the leaves of cotton seedlings during drought-induced senescence. (A) Micrograph showing DAB staining of hydrogen peroxide (H2O2) in cotton plants; (B) micrograph showing NBT staining of superoxide anion (O2−) in cotton plants; (C) H2O2 contents; (D) O2− contents. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 7. Leaf photos and bar graphs showing the effect of melatonin on the contents of ROS in the leaves of cotton seedlings during drought-induced senescence. (A) Micrograph showing DAB staining of hydrogen peroxide (H2O2) in cotton plants; (B) micrograph showing NBT staining of superoxide anion (O2−) in cotton plants; (C) H2O2 contents; (D) O2− contents. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g007
Ijms 24 07269 g008 550
Figure 8. Bar graphs showing the effects of melatonin on the auxin (IAA; A), abscisic acid (ABA; B), gibberellin acid (GA3; C), isopentenyladenine (iPA; D), and endogenous melatonin (MT; E) contents of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 8. Bar graphs showing the effects of melatonin on the auxin (IAA; A), abscisic acid (ABA; B), gibberellin acid (GA3; C), isopentenyladenine (iPA; D), and endogenous melatonin (MT; E) contents of cotton seedlings during drought-induced senescence. Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g008
Ijms 24 07269 g009 550
Figure 9. Transmission electron micrographs (TEM) of mesophyll cells of the cotton leaf. (A–C) structure of mesophyll cells of plants under CK, DS, and MT + DS treatments, respectively; (D–F) the relatively high magnified view of chloroplasts of plants under CK, DS, and MT + DS treatments, respectively. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment. Chl; chloroplast; Gl: Grana lamellae.
Figure 9. Transmission electron micrographs (TEM) of mesophyll cells of the cotton leaf. (A–C) structure of mesophyll cells of plants under CK, DS, and MT + DS treatments, respectively; (D–F) the relatively high magnified view of chloroplasts of plants under CK, DS, and MT + DS treatments, respectively. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment. Chl; chloroplast; Gl: Grana lamellae.
Ijms 24 07269 g009
Ijms 24 07269 g010 550
Figure 10. Bar graphs showing the effects of melatonin on the transcript levels of chlorophyll degradation genes, senescence-related genes, and hormone synthesis genes during leaf senescence. (A,B) Transcript levels of chlorophyll degrading genes large subunit of Rubisco, ribulose-1, 5-bisphosphate carboxylase/oxygenase (GhRBCL) and non-yellow coloring 1 (GhNYC1); (C–E) transcript levels of leaf senescence-related genes GhWRKY27/71 and GhNAC12; (F–J) transcript levels of hormone synthesis genes flavin-binding monooxygenase family protein (GhYUC5), nine-cis-epoxycarotenoid dioxygenase 2 (GhNCED2), gibberellin 3-oxidase 2 (GhGA3ox2), tRNAisopentenyltransferase 2 (GhIPT2), and serotonin N-acetyltransferase (GhSNAT). Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Figure 10. Bar graphs showing the effects of melatonin on the transcript levels of chlorophyll degradation genes, senescence-related genes, and hormone synthesis genes during leaf senescence. (A,B) Transcript levels of chlorophyll degrading genes large subunit of Rubisco, ribulose-1, 5-bisphosphate carboxylase/oxygenase (GhRBCL) and non-yellow coloring 1 (GhNYC1); (C–E) transcript levels of leaf senescence-related genes GhWRKY27/71 and GhNAC12; (F–J) transcript levels of hormone synthesis genes flavin-binding monooxygenase family protein (GhYUC5), nine-cis-epoxycarotenoid dioxygenase 2 (GhNCED2), gibberellin 3-oxidase 2 (GhGA3ox2), tRNAisopentenyltransferase 2 (GhIPT2), and serotonin N-acetyltransferase (GhSNAT). Results are presented as means ± standard error, n = 3; significant differences are denoted by lowercase letters (p < 0.05), according to Duncan’s new multiple range test. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Ijms 24 07269 g010
Ijms 24 07269 g011 550
Figure 11. Mechanistic model of melatonin alleviating cotton leaf senescence under drought stress.
Figure 11. Mechanistic model of melatonin alleviating cotton leaf senescence under drought stress.
Ijms 24 07269 g011
Table
Table 1. Effect of melatonin on the fitting parameters of the light response curve of cotton seedlings during drought-induced senescence.
Table 1. Effect of melatonin on the fitting parameters of the light response curve of cotton seedlings during drought-induced senescence.
TreatmentPmax
(μmol/m2 s−1)		LSP
(μmol/m2 s−1)		LCP
(μmol/m2 s−1)		Rd
(μmol/m2 s−1)		AQE
(μmol/mol)		R2 of Model
Fitting
CK20.68 ± 3.94 a1761.44 ± 227.26 a50.64 ± 7.6 a3.18 ± 0.5 a0.0688 ± 0.0015 a0.9995
DS12.84 ± 1.85 b1447.5 ± 179.85 a16.63 ± 3.06 c0.82 ± 0.05 c0.0526 ± 0.0123 a0.9984
MT + DS17.43 ± 0.27 ab1637.41 ± 68.71 a33.21 ± 4.39 b2.08 ± 0.24 b0.0675 ± 0.0013 a0.9995
Data are presented as means ± standard error (n = 3); significant differences are denoted by lowercase letters. Abbreviations and symbols: Pmax: the maximum net photosynthetic rate; LSP: light saturation point; LCP: light compensation point; Rd: respiratory rate; AQE: the apparent quantum efficiency of net carbon assimilation. CK denotes well-watered + 0 μM MT treatment; DS denotes drought stress + 0 μM MT treatment; MT + DS denotes drought stress + 100 μM MT treatment.
Table
Table 2. The primer pairs used in this experiment.
Table 2. The primer pairs used in this experiment.
Gene NameForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)
GhRBCLTTCCGAGTAACTCCTCAACCCCTTACAGATGCACCGCCCG
GhNYC1TGCTTGTGGTGGGCTGCTAGTCAGCGAAAGTACGCACAA
GhWRKY27CCTACGGAACAGCCACAACAACTTCCAGCAGGTTTTCAGAGC
GhWRKY71ACTTGGGTGGATACGACTCTCTCCTGCTCACCAATTCCATGT
GhNAC12CAAAAGAGTCCCAATGGCAACTGCTTTACGGTCTTCTATCGG
GhYUC5ACTCCTGCTTTTGTTCTTCTTCTTGTGAAACCGTCTCGTT
GhNCED2TACGATGTTATCCAAAAGCCGAAAATAGAGTCGGGAGGTG
GhGA3ox2AACTTAAAGCTGCAAGGTCTCACTCCTAATCTACTTCGTGGG
GhIPT1CAATCGCACGCCTAATCCCTGCATTGGTGAATGATGACCCT
GhSNATCACAAATCGTTGAACCACCAATTAGCCTCTTTTGCTCATT
ACTIN14ATCCTCCGTCTTGACCTTGTGTCCGTCAGGCAACTCAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, K.; Sun, H.; Liu, M.; Zhu, L.; Zhang, K.; Zhang, Y.; Li, A.; Zhang, H.; Zhu, J.; Liu, X.; et al. Morphological and Physiological Mechanisms of Melatonin on Delaying Drought-Induced Leaf Senescence in Cotton. Int. J. Mol. Sci. 2023, 24, 7269. https://doi.org/10.3390/ijms24087269

AMA Style

Yang K, Sun H, Liu M, Zhu L, Zhang K, Zhang Y, Li A, Zhang H, Zhu J, Liu X, et al. Morphological and Physiological Mechanisms of Melatonin on Delaying Drought-Induced Leaf Senescence in Cotton. International Journal of Molecular Sciences. 2023; 24(8):7269. https://doi.org/10.3390/ijms24087269

Chicago/Turabian Style

Yang, Kai, Hongchun Sun, Mengxing Liu, Lingxiao Zhu, Ke Zhang, Yongjiang Zhang, Anchang Li, Haina Zhang, Jijie Zhu, Xiaoqing Liu, and et al. 2023. "Morphological and Physiological Mechanisms of Melatonin on Delaying Drought-Induced Leaf Senescence in Cotton" International Journal of Molecular Sciences 24, no. 8: 7269. https://doi.org/10.3390/ijms24087269

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop