Lysophosphatidylinositol Promotes Chemotaxis and Cytokine Synthesis in Mast Cells with Differential Participation of GPR55 and CB2 Receptors
Abstract
:1. Introduction
2. Results
2.1. Lysophosphatidylinositol Induces MC Chemotaxis and Activation of the LIMK/Cofilin Axis
2.2. LPI Induces Changes in Actin Cytoskeleton Dynamics in MCs
2.3. LPI-Induced Chemotaxis Depends on the Activation of GPR55 Receptor
2.4. Specific GPR55 Agonist O-1602 Promotes Chemotaxis and Activation of LIMK in BMMCs
2.5. GPR55 Receptor Mediates the Chemotaxis of BMMCs to Conditioned Media from Distinct Mouse and Human Cancer Cells
2.6. LPI and O1602 Promote Cytokine mRNA Accumulation with the Participation of GPR55 and CB2 Receptors
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Reagents and Antibodies
4.3. Generation of BMMCs, IgE Sensitization and Determination of β-hexosaminidase Release
4.4. Immunofluorescence and Confocal Microscopy
4.5. Chemotaxis Assay
4.6. Western Blot
4.7. Transformed Cell Culture and Collection of Conditioned Media
4.8. RNA Extraction and RT-PCR
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Valent, P.; Akin, C.; Hartmann, K.; Nilsson, G.; Reiter, A.; Hermine, O.; Sotlar, K.; Sperr, W.R.; Escribano, L.; George, T.I.; et al. Mast cells as a unique hematopoietic lineage and cell system: From Paul Ehrlich’s visions to precision medicine concepts. Theranostics 2020, 10, 10743–10768. [Google Scholar] [CrossRef] [PubMed]
- Galli, S.J.; Gaudenzio, N.; Tsai, M. Mast Cells in Inflammation and Disease: Recent Progress and Ongoing Concerns. Annu. Rev. Immunol. 2020, 38, 49–77. [Google Scholar] [CrossRef] [PubMed]
- St John, A.L.; Rathore, A.P.S.; Ginhoux, F. New perspectives on the origins and heterogeneity of mast cells. Nat. Rev. Immunol. 2023, 23, 55–68. [Google Scholar] [CrossRef] [PubMed]
- Mukai, K.; Tsai, M.; Saito, H.; Galli, S.J. Mast cells as sources of cytokines, chemokines, and growth factors. Immunol. Rev. 2018, 282, 121–150. [Google Scholar] [CrossRef] [PubMed]
- Varricchi, G.; Galdiero, M.R.; Loffredo, S.; Marone, G.; Iannone, R.; Marone, G.; Granata, F. Are Mast Cells MASTers in Cancer? Front. Immunol. 2017, 8, 424. [Google Scholar] [CrossRef][Green Version]
- Komi, D.E.A.; Redegeld, F.A. Role of Mast Cells in Shaping the Tumor Microenvironment. Clin. Rev. Allergy Immunol. 2020, 58, 313–325. [Google Scholar] [CrossRef][Green Version]
- Lichterman, J.N.; Reddy, S.M. Mast Cells: A New Frontier for Cancer Immunotherapy. Cells 2021, 10, 1270. [Google Scholar] [CrossRef]
- Yamashita, A.; Oka, S.; Tanikawa, T.; Hayashi, Y.; Nemoto-Sasaki, Y.; Sugiura, T. The actions and metabolism of lysophosphatidylinositol, an endogenous agonist for GPR55. Prostaglandins Other Lipid Mediat. 2013, 107, 103–116. [Google Scholar] [CrossRef]
- Chiurchiù, V.; Leuti, A.; Maccarrone, M. Bioactive Lipids and Chronic Inflammation: Managing the Fire Within. Front. Immunol. 2018, 9, 38. [Google Scholar] [CrossRef][Green Version]
- Falasca, M.; Ferro, R. Role of the lysophosphatidylinositol/GPR55 axis in cancer. Adv. Biol. Regul. 2016, 60, 88–93. [Google Scholar] [CrossRef]
- Alhouayek, M.; Masquelier, J.; Muccioli, G.G. Lysophosphatidylinositols, from Cell Membrane Constituents to GPR55 Ligands. Trends Pharmacol. Sci. 2018, 39, 586–604. [Google Scholar] [CrossRef]
- Kihara, Y.; Maceyka, M.; Spiegel, S.; Chun, J. Lysophospholipid receptor nomenclature review: IUPHAR Review 8. Br. J. Pharmacol. 2014, 171, 3575–3594. [Google Scholar] [CrossRef][Green Version]
- Oka, S.; Nakajima, K.; Yamashita, A.; Kishimoto, S.; Sugiura, T. Identification of GPR55 as a lysophosphatidylinositol receptor. Biochem. Biophys. Res. Commun. 2007, 362, 928–934. [Google Scholar] [CrossRef]
- Chiurchiù, V.; Lanuti, M.; de Bardi, M.; Battistini, L.; Maccarrone, M. The differential characterization of GPR55 receptor in human peripheral blood reveals a distinctive expression in monocytes and NK cells and a proinflammatory role in these innate cells. Int. Immunol. 2015, 27, 153–160. [Google Scholar] [CrossRef][Green Version]
- Hofmann, N.A.; Yang, J.; Trauger, S.A.; Nakayama, H.; Huang, L.; Strunk, D.; Moses, M.A.; Klagsbrun, M.; Bischoff, J.; Graier, W.F. The GPR 55 agonist, L-α-lysophosphatidylinositol, mediates ovarian carcinoma cell-induced angiogenesis. Br. J. Pharmacol. 2015, 172, 4107–4118. [Google Scholar] [CrossRef][Green Version]
- Piñeiro, R.; Maffucci, T.; Falasca, M. The putative cannabinoid receptor GPR55 defines a novel autocrine loop in cancer cell proliferation. Oncogene 2011, 30, 142–152. [Google Scholar] [CrossRef][Green Version]
- Sutphen, R.; Xu, Y.; Wilbanks, G.D.; Fiorica, J.; Grendys, E.C., Jr.; LaPolla, J.P.; Arango, H.; Hoffman, M.S.; Martino, M.; Wakeley, K.; et al. Lysophospholipids are potential biomarkers of ovarian cancer. Cancer Epidemiol. Biomarkers. Prev. 2004, 13, 1185–1191. [Google Scholar] [CrossRef]
- Balenga, N.A.; Aflaki, E.; Kargl, J.; Platzer, W.; Schröder, R.; Blättermann, S.; Kostenis, E.; Brown, A.J.; Heinemann, A.; Waldhoer, M. GPR55 regulates cannabinoid 2 receptor-mediated responses in human neutrophils. Cell Res. 2011, 21, 1452–1469. [Google Scholar] [CrossRef][Green Version]
- Kurano, M.; Kobayashi, T.; Sakai, E.; Tsukamoto, K.; Yatomi, Y. Lysophosphatidylinositol, especially albumin-bound form, induces inflammatory cytokines in macrophages. FASEB J. 2021, 35, e21673. [Google Scholar] [CrossRef]
- Dráber, P.; Sulimenko, V.; Dráberová, E. Cytoskeleton in mast cell signaling. Front. Immunol. 2012, 3, 130. [Google Scholar] [CrossRef][Green Version]
- Lazki-Hagenbach, P.; Klein, O.; Sagi-Eisenberg, R. The actin cytoskeleton and mast cell function. Curr. Opin. Immunol. 2021, 72, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Cantarella, G.; Scollo, M.; Lempereur, L.; Saccani-Jotti, G.; Basile, F.; Bernardini, R. Endocannabinoids inhibit release of nerve growth factor by inflammation-activated mast cells. Biochem. Pharmacol. 2011, 82, 380–388. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Espinosa-Riquer, Z.P.; Ibarra-Sánchez, A.; Vibhushan, S.; Bratti, M.; Charles, N.; Blank, U.; Rodríguez-Manzo, G.; González-Espinosa, C. TLR4 Receptor Induces 2-AG-Dependent Tolerance to Lipopolysaccharide and Trafficking of CB2 Receptor in Mast Cells. J. Immunol. 2019, 202, 2360–2371. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Cruz, S.L.; Sánchez-Miranda, E.; Castillo-Arellano, J.I.; Cervantes-Villagrana, R.D.; Ibarra-Sánchez, A.; González-Espinosa, C. Anandamide inhibits FcεRI-dependent degranulation and cytokine synthesis in mast cells through CB(2) and GPR55 receptor activation. Possible involvement of CB(2)-GPR55 heteromers. Int. Immunopharmacol. 2018, 64, 298–307. [Google Scholar] [CrossRef] [PubMed]
- Jolly, P.S.; Bektas, M.; Olivera, A.; Gonzalez-Espinosa, C.; Proia, R.L.; Rivera, J.; Milstien, S.; Spiegel, S. Transactivation of sphingosine-1-phosphate receptors by FcepsilonRI triggering is required for normal mast cell degranulation and chemotaxis. J. Exp. Med. 2004, 199, 959–970. [Google Scholar] [CrossRef][Green Version]
- Kulinski, J.M.; Muñoz-Cano, R.; Olivera, A. Sphingosine-1-phosphate and other lipid mediators generated by mast cells as critical players in allergy and mast cell function. Eur. J. Pharmacol. 2016, 778, 56–67. [Google Scholar] [CrossRef][Green Version]
- Klein, O.; Krier-Burris, R.A.; Lazki-Hagenbach, P.; Gorzalczany, Y.; Mei, Y.; Ji, P.; Bochner, B.S.; Sagi-Eisenberg, R. Mammalian diaphanous-related formin 1 (mDia1) coordinates mast cell migration and secretion through its actin-nucleating activity. J. Allergy Clin. Immunol. 2019, 144, 1074–1090. [Google Scholar] [CrossRef]
- Zhou, X.L.; Guo, X.; Song, Y.P.; Zhu, C.Y.; Zou, W. The LPI/GPR55 axis enhances human breast cancer cell migration via HBXIP and p-MLC signaling. Acta Pharmacol. Sin. 2018, 39, 459–471. [Google Scholar] [CrossRef][Green Version]
- Segura-Villalobos, D.; Ramírez-Moreno, I.G.; Martínez-Aguilar, M.; Ibarra-Sánchez, A.; Muñoz-Bello, J.O.; Anaya-Rubio, I.; Padilla, A.; Macías-Silva, M.; Lizano, M.; González-Espinosa, C. Mast Cell-Tumor Interactions: Molecular Mechanisms of Recruitment, Intratumoral Communication and Potential Therapeutic Targets for Tumor Growth. Cells 2022, 11, 349. [Google Scholar] [CrossRef]
- Halova, I.; Draberova, L.; Draber, P. Mast cell chemotaxis—Chemoattractants and signaling pathways. Front. Immunol. 2012, 3, 119. [Google Scholar] [CrossRef][Green Version]
- Poole, T.J.; Zetter, B.R. Stimulation of rat peritoneal mast cell migration by tumor-derived peptides. Cancer Res. 1983, 43, 5857–5861. [Google Scholar]
- Zhang, J.; Childress, S.; Libchaber, A.; Shelley, M. Flexible filaments in a flowing soap film as a model for one-dimensional flags in a two-dimensional wind. Nature 2000, 408, 835–839. [Google Scholar] [CrossRef]
- Huang, B.; Lei, Z.; Zhang, G.M.; Li, D.; Song, C.; Li, B.; Liu, Y.; Yuan, Y.; Unkeless, J.; Xiong, H.; et al. SCF-mediated mast cell infiltration and activation exacerbate the inflammation and immunosuppression in tumor microenvironment. Blood 2008, 112, 1269–1279. [Google Scholar] [CrossRef]
- Zhu, X.Q.; Lv, J.Q.; Lin, Y.; Xiang, M.; Gao, B.H.; Shi, Y.F. Expression of chemokines CCL5 and CCL11 by smooth muscle tumor cells of the uterus and its possible role in the recruitment of mast cells. Gynecol. Oncol. 2007, 105, 650–656. [Google Scholar] [CrossRef]
- Kryczek, I.; Lange, A.; Mottram, P.; Alvarez, X.; Cheng, P.; Hogan, M.; Moons, L.; Wei, S.; Zou, L.; Machelon, V.; et al. CXCL12 and vascular endothelial growth factor synergistically induce neoangiogenesis in human ovarian cancers. Cancer Res. 2005, 65, 465–472. [Google Scholar] [CrossRef]
- Põlajeva, J.; Sjösten, A.M.; Lager, N.; Kastemar, M.; Waern, I.; Alafuzoff, I.; Smits, A.; Westermark, B.; Pejler, G.; Uhrbom, L.; et al. Mast cell accumulation in glioblastoma with a potential role for stem cell factor and chemokine CXCL12. PLoS ONE 2011, 6, e25222. [Google Scholar] [CrossRef][Green Version]
- Weller, C.L.; Collington, S.J.; Hartnell, A.; Conroy, D.M.; Kaise, T.; Barker, J.E.; Wilson, M.S.; Taylor, G.W.; Jose, P.J.; Williams, T.J. Chemotactic action of prostaglandin E2 on mouse mast cells acting via the PGE2 receptor 3. Proc. Natl. Acad. Sci. USA 2007, 104, 11712–11717. [Google Scholar] [CrossRef][Green Version]
- Cabanillas-Saez, A.; Schalper, J.A.; Nicovani, S.M.; Rudolph, M.I. Characterization of mast cells according to their content of tryptase and chymase in normal and neoplastic human uterine cervix. Int. J. Gynecol. Cancer 2002, 12, 92–98. [Google Scholar] [CrossRef]
- Oka, S.; Kimura, S.; Toshida, T.; Ota, R.; Yamashita, A.; Sugiura, T. Lysophosphatidylinositol induces rapid phosphorylation of p38 mitogen-activated protein kinase and activating transcription factor 2 in HEK293 cells expressing GPR55 and IM-9 lymphoblastoid cells. J. Biochem. 2010, 147, 671–678. [Google Scholar] [CrossRef]
- Henstridge, C.M.; Balenga, N.A.; Ford, L.A.; Ross, R.A.; Waldhoer, M.; Irving, A.J. The GPR55 ligand L-alpha-lysophosphatidylinositol promotes RhoA-dependent Ca2+ signaling and NFAT activation. FASEB J. 2009, 23, 183–193. [Google Scholar] [CrossRef]
- Fontemaggi, G. Non-coding RNA regulatory networks in post-transcriptional regulation of VEGFA in cancer. IUBMB Life 2023, 75, 30–39. [Google Scholar] [CrossRef] [PubMed]
- Khera, T.K.; Dick, A.D.; Nicholson, L.B. Mechanisms of TNFα regulation in uveitis: Focus on RNA-binding proteins. Prog. Retin. Eye Res. 2010, 29, 610–621. [Google Scholar] [CrossRef] [PubMed]
- Hong, H.; Yoon, B.; Ghil, S. Interactions between lysophosphatidylinositol receptor GPR55 and sphingosine-1-phosphate receptor S1P(5) in live cells. Biochem. Biophys. Res. Commun. 2021, 570, 53–59. [Google Scholar] [CrossRef] [PubMed]
- Bang, G.; Ghil, S. BRET analysis reveals interaction between the lysophosphatidic acid receptor LPA2 and the lysophosphatidylinositol receptor GPR55 in live cells. FEBS Lett. 2021, 595, 1806–1818. [Google Scholar] [CrossRef] [PubMed]
- Balenga, N.A.; Martínez-Pinilla, E.; Kargl, J.; Schröder, R.; Peinhaupt, M.; Platzer, W.; Bálint, Z.; Zamarbide, M.; Dopeso-Reyes, I.G.; Ricobaraza, A.; et al. Heteromerization of GPR55 and cannabinoid CB2 receptors modulates signalling. Br. J. Pharmacol. 2014, 171, 5387–5406. [Google Scholar] [CrossRef][Green Version]
- Moreno, E.; Andradas, C.; Medrano, M.; Caffarel, M.M.; Pérez-Gómez, E.; Blasco-Benito, S.; Gómez-Cañas, M.; Pazos, M.R.; Irving, A.J.; Lluís, C.; et al. Targeting CB2-GPR55 receptor heteromers modulates cancer cell signaling. J. Biol. Chem. 2014, 289, 21960–21972. [Google Scholar] [CrossRef][Green Version]
- Wang, Y.; Matsushita, K.; Jackson, J.; Numata, T.; Zhang, Y.; Zhou, G.; Tsai, M.; Galli, S.J. Transcriptome programming of IL-3-dependent bone marrow-derived cultured mast cells by stem cell factor (SCF). Allergy 2021, 76, 2288–2291. [Google Scholar] [CrossRef]
- Xu, L.; Yi, H.G.; Wu, Z.; Han, W.; Chen, K.; Zang, M.; Wang, D.; Zhao, X.; Wang, H.; Qu, C. Activation of mucosal mast cells promotes inflammation-related colon cancer development through recruiting and modulating inflammatory CD11b(+)Gr1(+) cells. Cancer Lett. 2015, 364, 173–180. [Google Scholar] [CrossRef][Green Version]
- Groll, T.; Silva, M.; Sarker, R.S.J.; Tschurtschenthaler, M.; Schnalzger, T.; Mogler, C.; Denk, D.; Schölch, S.; Schraml, B.U.; Ruland, J.; et al. Comparative Study of the Role of Interepithelial Mucosal Mast Cells in the Context of Intestinal Adenoma-Carcinoma Progression. Cancers 2022, 14, 2248. [Google Scholar] [CrossRef]
- Meurer, S.K.; Neß, M.; Weiskirchen, S.; Kim, P.; Tag, C.G.; Kauffmann, M.; Huber, M.; Weiskirchen, R. Isolation of Mature (Peritoneum-Derived) Mast Cells and Immature (Bone Marrow-Derived) Mast Cell Precursors from Mice. PLoS ONE 2016, 11, e0158104. [Google Scholar] [CrossRef][Green Version]
- Madera-Salcedo, I.K.; Cruz, S.L.; Gonzalez-Espinosa, C. Morphine prevents lipopolysaccharide-induced TNF secretion in mast cells blocking IκB kinase activation and SNAP-23 phosphorylation: Correlation with the formation of a β-arrestin/TRAF6 complex. J. Immunol. 2013, 191, 3400–3409. [Google Scholar] [CrossRef][Green Version]
- Tanaka, S.; Furuta, K. Roles of IgE and Histamine in Mast Cell Maturation. Cells 2021, 10, 2170. [Google Scholar] [CrossRef]
- Saitoh, S.; Arudchandran, R.; Manetz, T.S.; Zhang, W.; Sommers, C.L.; Love, P.E.; Rivera, J.; Samelson, L.E. LAT is essential for Fc(epsilon)RI-mediated mast cell activation. Immunity 2000, 12, 525–535. [Google Scholar] [CrossRef][Green Version]
- Jiménez-Andrade, G.Y.; Ibarra-Sánchez, A.; González, D.; Lamas, M.; González-Espinosa, C. Immunoglobulin E induces VEGF production in mast cells and potentiates their pro-tumorigenic actions through a Fyn kinase-dependent mechanism. J. Hematol. Oncol. 2013, 6, 56. [Google Scholar] [CrossRef][Green Version]
- Hovey, R.C.; Goldhar, A.S.; Baffi, J.; Vonderhaar, B.K. Transcriptional regulation of vascular endothelial growth factor expression in epithelial and stromal cells during mouse mammary gland development. Mol. Endocrinol. 2001, 15, 819–831. [Google Scholar] [CrossRef]
- Dasgupta, P.; Betts, V.; Rastogi, S.; Joshi, B.; Morris, M.; Brennan, B.; Ordonez-Ercan, D.; Chellappan, S. Direct binding of apoptosis signal-regulating kinase 1 to retinoblastoma protein: Novel links between apoptotic signaling and cell cycle machinery. J. Biol. Chem. 2004, 279, 38762–38769. [Google Scholar] [CrossRef][Green Version]
- Clua, P.; Tomokiyo, M.; Tonetti, F.R.; Islam, M.A.; Castillo, V.G.; Marcial, G.; Salva, S.; Alvarez, S.; Takahashi, H.; Kurata, S.; et al. The Role of Alveolar Macrophages in the Improved Protection against Respiratory Syncytial Virus and Pneu-mococcal Superinfection Induced by the Peptidoglycan of Lactobacillus rhamnosus CRL1505. Cells 2020, 9, 1653–1679. [Google Scholar] [CrossRef]
- Bernard, A.; Cohen, R.; Khuth, S.T.; Vedrine, B.; Verlaeten, O.; Akaoka, H.; Giraudon, P.; Belin, M.F. Alteration of the leptin network in late morbid obesity induced in mice by brain infection with canine distemper virus. J. Virol. 1999, 73, 7317–7327. [Google Scholar] [CrossRef][Green Version]
Cytokine | Forward | Reverse | Reference |
---|---|---|---|
VEGF | CTGCTCTCTTGGGTCCACTGG | CACCGCCTTGGCTTGTCACAT | [55] |
TNF | TTCTGTCTACTGAACTTCGGGGTGATCGGTCC | GTATGAGATAGCAAATCGGCTTGTGGG | [56] |
IL-1 alpha | CTCTAGAGCACATGTACAGAC | TGGAATCCAGGGGAAACACTG | [57] |
IL-1 beta | TTGACGGACCCCAAAAGATG | AGAAGGTGCTCATGTCCTCA | [57] |
GAPDH | TGAAGGTCGGTGTGAACGGATTTGGC | CATGTAGGCCATGAGGTCCACCAC | [58] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martínez-Aguilar, L.M.; Ibarra-Sánchez, A.; Guerrero-Morán, D.J.; Macías-Silva, M.; Muñoz-Bello, J.O.; Padilla, A.; Lizano, M.; González-Espinosa, C. Lysophosphatidylinositol Promotes Chemotaxis and Cytokine Synthesis in Mast Cells with Differential Participation of GPR55 and CB2 Receptors. Int. J. Mol. Sci. 2023, 24, 6316. https://doi.org/10.3390/ijms24076316
Martínez-Aguilar LM, Ibarra-Sánchez A, Guerrero-Morán DJ, Macías-Silva M, Muñoz-Bello JO, Padilla A, Lizano M, González-Espinosa C. Lysophosphatidylinositol Promotes Chemotaxis and Cytokine Synthesis in Mast Cells with Differential Participation of GPR55 and CB2 Receptors. International Journal of Molecular Sciences. 2023; 24(7):6316. https://doi.org/10.3390/ijms24076316
Chicago/Turabian StyleMartínez-Aguilar, Lizbeth Magnolia, Alfredo Ibarra-Sánchez, Daniel José Guerrero-Morán, Marina Macías-Silva, Jesús Omar Muñoz-Bello, Alejandro Padilla, Marcela Lizano, and Claudia González-Espinosa. 2023. "Lysophosphatidylinositol Promotes Chemotaxis and Cytokine Synthesis in Mast Cells with Differential Participation of GPR55 and CB2 Receptors" International Journal of Molecular Sciences 24, no. 7: 6316. https://doi.org/10.3390/ijms24076316