Expression of Androgen and Estrogen Receptors in the Human Lacrimal Gland
Abstract
:1. Introduction
2. Results
2.1. Sex Steroid Receptor mRNA Expression in the Human Lacrimal Gland
2.2. Correlation between Sex Steroid Receptor mRNA Expression in the Human Lacrimal Gland
2.3. Impact of Age on Sex Steroid Receptor mRNA Expression in the Human Lacrimal Gland
2.4. Expression of AR and ERα Proteins in the Human Lacrimal Gland
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. RNA Extraction, Reverse Transcription, and Real-Time PCR
- 5′-GCCTTGCTCTCTAGCCTCAA-3′ (f) and
- 5′-GGTCGTCCACGTTAAGTTG-3′ (r) for AR;
- 5′- CCAGGGAAGCTACTGTTTGC -3′ (f) and
- 5′-TGATGTAGCCAGCAGCATGT -3′ (r) for ERα;
- 5′-GCTGAACGCCGTGACCGATGCT-3′ (f) and
- 5′-CCCGTGATGGAGGACTTGC-3′ (r) for ERβ;
- 5′TCAACGACCACTTTGTCAAGC-3′ (f) and
- 5′GGTGGTCCAGGGGTC-3′ (r) for GAPHD.
4.3. Immunohistochemistry (IHC)
4.4. Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Institute of Medicine (US) Committee on Understanding the Biology of Sex and Gender Differences; Gender, D. The National Academies Collection: Reports funded by National Institutes of Health. In Exploring the Biological Contributions to Human Health: Does Sex Matter? Wizemann, T.M., Pardue, M.L., Eds.; National Academies Press (US): Washington, DC, USA, 2001. [Google Scholar]
- Hägg, S.; Jylhävä, J. Sex differences in biological aging with a focus on human studies. eLife 2021, 10, e63425. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Nie, C.; Min, J.; Chen, H.; Liu, X.; Ye, R.; Chen, Z.; Bai, C.; Xie, E.; Yin, Z.; et al. Sex Differences in Genetic Associations With Longevity. JAMA Netw. Open. 2018, 1, e181670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koebele, S.V.; Ycaza Herrera, A.; Taylor, C.M.; Barth, C.; Schwarz, J.M. Editorial: Sex Hormone Fluctuations Across the Female Lifespan: Mechanisms of Action on Brain Structure, Function, and Behavior. Front Behav. Neurosci. 2022, 16, 964740. [Google Scholar] [CrossRef] [PubMed]
- Christensen, F.; Dam, H. A sexual dimorphism of the harderian glands in hamsters. Acta Physiol. Scand. 1953, 27, 332–336. [Google Scholar] [CrossRef]
- Lauria, A.; Porcelli, F. Leucine aminopeptidase (LAP) activity and sexual dimorphism in rat exorbital lacrimal gland. Basic Appl Histochem 1979, 23, 171–177. [Google Scholar]
- Paliwal, A.; De, P.K. Marked sexual dimorphism of lacrimal gland peroxidase in hamster: Repression by androgens and estrogens. Biochem. Biophys. Res. Commun. 2006, 341, 1286–1293. [Google Scholar] [CrossRef]
- Schechter, J.E.; Warren, D.W.; Mircheff, A.K. A lacrimal gland is a lacrimal gland, but rodent’s and rabbit’s are not human. Ocul. Surf. 2010, 8, 111–134. [Google Scholar] [CrossRef]
- Waterhouse, J.P. Focal adenitis IN Salivary and lacrimal glands. Proc. R Soc. Med. 1963, 56, 911–918. [Google Scholar] [CrossRef] [Green Version]
- Cornell-Bell, A.H.; Sullivan, D.A.; Allansmith, M.R. Gender-related differences in the morphology of the lacrimal gland. Investig. Ophthalmol. Vis. Sci. 1985, 26, 1170–1175. [Google Scholar]
- Obata, H.; Yamamoto, S.; Horiuchi, H.; Machinami, R. Histopathologic study of human lacrimal gland. Statistical analysis with special reference to aging. Ophthalmology 1995, 102, 678–686. [Google Scholar] [CrossRef]
- Lorber, M. Gross characteristics of normal human lacrimal glands. Ocul. Surf. 2007, 5, 13–22. [Google Scholar] [CrossRef]
- Bukhari, A.A.; Basheer, N.A.; Joharjy, H.I. Age, gender, and interracial variability of normal lacrimal gland volume using MRI. Ophthalmic. Plast. Reconstr. Surg. 2014, 30, 388–391. [Google Scholar] [CrossRef]
- Lorber, M.; Vidić, B. Measurements of lacrimal glands from cadavers, with descriptions of typical glands and three gross variants. Orbit 2009, 28, 137–146. [Google Scholar] [CrossRef]
- Kaštelan, S.; Tomić, M.; Salopek-Rabatić, J.; Novak, B. Diagnostic procedures and management of dry eye. BioMed Res. Int. 2013, 2013, 309723. [Google Scholar] [CrossRef] [Green Version]
- Stern, M.E.; Gao, J.; Siemasko, K.F.; Beuerman, R.W.; Pflugfelder, S.C. The role of the lacrimal functional unit in the pathophysiology of dry eye. Exp. Eye Res. 2004, 78, 409–416. [Google Scholar] [CrossRef]
- Pflugfelder, S.C.; Stern, M.E. Biological functions of tear film. Exp. Eye Res. 2020, 197, 108115. [Google Scholar] [CrossRef]
- Wei, Y.; Asbell, P.A. The Core Mechanism of Dry Eye Disease Is Inflammation. Eye Contact Lens Sci. Clin. Pract. 2014, 40, 248–256. [Google Scholar] [CrossRef] [Green Version]
- Tsubota, K.; Pflugfelder, S.C.; Liu, Z.; Baudouin, C.; Kim, H.M.; Messmer, E.M.; Kruse, F.; Liang, L.; Carreno-Galeano, J.T.; Rolando, M.; et al. Defining Dry Eye from a Clinical Perspective. Int. J. Mol. Sci. 2020, 21, 9271. [Google Scholar] [CrossRef]
- McMonnies, C.W. Aqueous deficiency is a contributor to evaporation-related dry eye disease. Eye Vis. 2020, 7, 6. [Google Scholar] [CrossRef]
- Lemp, M.A.; Crews, L.A.; Bron, A.J.; Foulks, G.N.; Sullivan, B.D. Distribution of aqueous-deficient and evaporative dry eye in a clinic-based patient cohort: A retrospective study. Cornea 2012, 31, 472–478. [Google Scholar] [CrossRef]
- Nuzzi, R.; Caselgrandi, P. Sex Hormones and Their Effects on Ocular Disorders and Pathophysiology: Current Aspects and Our Experience. Int. J. Mol. Sci. 2022, 23, 3269. [Google Scholar] [CrossRef] [PubMed]
- Albietz, J.M. Prevalence of dry eye subtypes in clinical optometry practice. Optom. Vis. Sci. 2000, 77, 357–363. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, D.A.; Rocha, E.M.; Aragona, P.; Clayton, J.A.; Ding, J.; Golebiowski, B.; Hampel, U.; McDermott, A.M.; Schaumberg, D.A.; Srinivasan, S.; et al. TFOS DEWS II Sex, Gender, and Hormones Report. Ocul. Surf. 2017, 15, 284–333. [Google Scholar] [CrossRef] [PubMed]
- De Paiva, C.S. Effects of Aging in Dry Eye. Int. Ophthalmol. Clin. 2017, 57, 47–64. [Google Scholar] [CrossRef] [Green Version]
- Rocha, E.M.; Wickham, L.A.; da Silveira, L.A.; Krenzer, K.L.; Yu, F.S.; Toda, I.; Sullivan, B.D.; Sullivan, D.A. Identification of androgen receptor protein and 5alpha-reductase mRNA in human ocular tissues. Br. J. Ophthalmol. 2000, 84, 76–84. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, D.A.; Wickham, L.A.; Rocha, E.M.; Krenzer, K.L.; Sullivan, B.D.; Steagall, R.; Cermak, J.M.; Dana, M.R.; Ullman, M.D.; Sato, E.H.; et al. Androgens and dry eye in Sjögren’s syndrome. Ann. N. Y. Acad. Sci. 1999, 876, 312–324. [Google Scholar] [CrossRef]
- Sullivan, D.A.; Wickham, L.A.; Rocha, E.M.; Kelleher, R.S.; da Silveira, L.A.; Toda, I. Influence of gender, sex steroid hormones, and the hypothalamic-pituitary axis on the structure and function of the lacrimal gland. Adv. Exp. Med. Biol. 1998, 438, 11–42. [Google Scholar] [CrossRef]
- Sullivan, D.A.; Edwards, J.A.; Wickham, L.A.; Pena, J.D.; Gao, J.; Ono, M.; Kelleher, R.S. Identification and endocrine control of sex steroid binding sites in the lacrimal gland. Curr. Eye Res. 1996, 15, 279–291. [Google Scholar] [CrossRef]
- Sullivan, D.A.; Sullivan, B.D.; Evans, J.E.; Schirra, F.; Yamagami, H.; Liu, M.; Richards, S.M.; Suzuki, T.; Schaumberg, D.A.; Sullivan, R.M.; et al. Androgen deficiency, Meibomian gland dysfunction, and evaporative dry eye. Ann N Y Acad Sci 2002, 966, 211–222. [Google Scholar] [CrossRef]
- Truong, S.; Cole, N.; Stapleton, F.; Golebiowski, B. Sex hormones and the dry eye. Clin. Exp. Optom. 2014, 97, 324–336. [Google Scholar] [CrossRef]
- Oprea, L.; Tiberghien, A.; Creuzot-Garcher, C.; Baudouin, C. Hormonal regulatory influence in tear film. J. Fr. Ophtalmol. 2004, 27, 933–941. [Google Scholar] [CrossRef]
- Schirra, F.; Suzuki, T.; Dickinson, D.P.; Townsend, D.J.; Gipson, I.K.; Sullivan, D.A. Identification of steroidogenic enzyme mRNAs in the human lacrimal gland, meibomian gland, cornea, and conjunctiva. Cornea 2006, 25, 438–442. [Google Scholar] [CrossRef]
- Konttinen, Y.T.; Porola, P.; Konttinen, L.; Laine, M.; Poduval, P. Immunohistopathology of Sjögren’s syndrome. Autoimmun. Rev. 2006, 6, 16–20. [Google Scholar] [CrossRef]
- Toda, I.; Sullivan, B.D.; Rocha, E.M.; Da Silveira, L.A.; Wickham, L.A.; Sullivan, D.A. Impact of gender on exocrine gland inflammation in mouse models of Sjögren’s syndrome. Exp. Eye Res. 1999, 69, 355–366. [Google Scholar] [CrossRef]
- Schaumberg, D.A.; Buring, J.E.; Sullivan, D.A.; Dana, M.R. Hormone replacement therapy and dry eye syndrome. JAMA 2001, 286, 2114–2119. [Google Scholar] [CrossRef] [Green Version]
- Fairweather, D.; Petri, M.A.; Coronado, M.J.; Cooper, L.T. Autoimmune heart disease: Role of sex hormones and autoantibodies in disease pathogenesis. Expert Rev. Clin. Immunol. 2012, 8, 269–284. [Google Scholar] [CrossRef]
- Mathers, W.D.; Stovall, D.; Lane, J.A.; Zimmerman, M.B.; Johnson, S. Menopause and tear function: The influence of prolactin and sex hormones on human tear production. Cornea 1998, 17, 353–358. [Google Scholar] [CrossRef]
- Chen, S.P.; Massaro-Giordano, G.; Pistilli, M.; Schreiber, C.A.; Bunya, V.Y. Tear osmolarity and dry eye symptoms in women using oral contraception and contact lenses. Cornea 2013, 32, 423–428. [Google Scholar] [CrossRef] [Green Version]
- Sullivan, D.A.; Krenzer, K.L.; Sullivan, B.D.; Tolls, D.B.; Toda, I.; Dana, M.R. Does androgen insufficiency cause lacrimal gland inflammation and aqueous tear deficiency? Investig. Ophthalmol. Vis. Sci. 1999, 40, 1261–1265. [Google Scholar]
- Feng, Y.; Feng, G.; Peng, S.; Li, H. The effects of hormone replacement therapy on dry eye syndromes evaluated by Schirmer test depend on patient age. Cont. Lens. Anterior Eye 2016, 39, 124–127. [Google Scholar] [CrossRef]
- Affinito, P.; Di Spiezio Sardo, A.; Di Carlo, C.; Sammartino, A.; Tommaselli, G.A.; Bifulco, G.; Loffredo, A.; Loffredo, M.; Nappi, C. Effects of hormone replacement therapy on ocular function in postmenopause. Menopause 2003, 10, 482–487. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, D.A.; Kelleher, R.S.; Vaerman, J.P.; Hann, L.E. Androgen regulation of secretory component synthesis by lacrimal gland acinar cells in vitro. J. Immunol. 1990, 145, 4238–4244. [Google Scholar] [CrossRef]
- Davey, R.A.; Grossmann, M. Androgen Receptor Structure, Function and Biology: From Bench to Bedside. Clin. Biochem. Rev. 2016, 37, 3–15. [Google Scholar] [PubMed]
- Eder, I.E.; Culig, Z.; Putz, T.; Nessler-Menardi, C.; Bartsch, G.; Klocker, H. Molecular biology of the androgen receptor: From molecular understanding to the clinic. Eur. Urol. 2001, 40, 241–251. [Google Scholar] [CrossRef] [PubMed]
- Menazza, S.; Murphy, E. The Expanding Complexity of Estrogen Receptor Signaling in the Cardiovascular System. Circ. Res. 2016, 118, 994–1007. [Google Scholar] [CrossRef]
- Delchev, S.; Georgieva, K. Cellular and Molecular Mechanisms of the Effects of Sex Hormones on the Nervous System; Intech: London, UK, 2018. [Google Scholar] [CrossRef] [Green Version]
- Mani, S.K.; Mermelstein, P.G.; Tetel, M.J.; Anesetti, G. Convergence of multiple mechanisms of steroid hormone action. Horm Metab Res 2012, 44, 569–576. [Google Scholar] [CrossRef] [Green Version]
- Hall, J.M.; Couse, J.F.; Korach, K.S. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J. Biol. Chem. 2001, 276, 36869–36872. [Google Scholar] [CrossRef] [Green Version]
- Hammes, S.R.; Levin, E.R. Extranuclear steroid receptors: Nature and actions. Endocr. Rev. 2007, 28, 726–741. [Google Scholar] [CrossRef] [Green Version]
- Marino, M.; Galluzzo, P.; Ascenzi, P. Estrogen signaling multiple pathways to impact gene transcription. Curr. Genom. 2006, 7, 497–508. [Google Scholar] [CrossRef] [Green Version]
- O’Malley, B.W. A life-long search for the molecular pathways of steroid hormone action. Mol. Endocrinol. 2005, 19, 1402–1411. [Google Scholar] [CrossRef] [Green Version]
- Le Dily, F.; Beato, M. Signaling by Steroid Hormones in the 3D Nuclear Space. Int. J. Mol. Sci. 2018, 19, 306. [Google Scholar] [CrossRef]
- Paterni, I.; Granchi, C.; Katzenellenbogen, J.A.; Minutolo, F. Estrogen receptors alpha (ERα) and beta (ERβ): Subtype-selective ligands and clinical potential. Steroids 2014, 90, 13–29. [Google Scholar] [CrossRef] [Green Version]
- Böttner, M.; Thelen, P.; Jarry, H. Estrogen receptor beta: Tissue distribution and the still largely enigmatic physiological function. J. Steroid. Biochem. Mol. Biol. 2014, 139, 245–251. [Google Scholar] [CrossRef]
- Wilson, C.M.; McPhaul, M.J. A and B forms of the androgen receptor are expressed in a variety of human tissues. Mol. Cell Endocrinol. 1996, 120, 51–57. [Google Scholar] [CrossRef]
- Rana, K.; Davey, R.A.; Zajac, J.D. Human androgen deficiency: Insights gained from androgen receptor knockout mouse models. Asian J. Androl. 2014, 16, 169–177. [Google Scholar] [CrossRef]
- Seleit, I.; Bakry, O.A.; El Repey, H.S.; Ali, R. Intrinsic versus Extrinsic Aging: A Histopathological, Morphometric and Immunohistochemical Study of Estrogen Receptor β and Androgen Receptor. Skin Pharmacol. Physiol. 2016, 29, 178–189. [Google Scholar] [CrossRef]
- Eyster, K.M. The Estrogen Receptors: An Overview from Different Perspectives. Methods Mol. Biol. 2016, 1366, 1–10. [Google Scholar] [CrossRef]
- Imamov, O.; Shim, G.J.; Warner, M.; Gustafsson, J.A. Estrogen receptor beta in health and disease. Biol. Reprod. 2005, 73, 866–871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spelsberg, H.; Klueppel, M.; Reinhard, T.; Glaeser, M.; Niederacher, D.; Beckmann, M.W.; Sundmacher, R. Detection of oestrogen receptors (ER) alpha and beta in conjunctiva, lacrimal gland, and tarsal plates. Eye 2004, 18, 729–733. [Google Scholar] [CrossRef] [PubMed]
- Wickham, L.A.; Gao, J.; Toda, I.; Rocha, E.M.; Ono, M.; Sullivan, D.A. Identification of androgen, estrogen and progesterone receptor mRNAs in the eye. Acta Ophthalmol. Scand. 2000, 78, 146–153. [Google Scholar] [CrossRef] [PubMed]
- Rocha, F.J.; Wickham, L.A.; Pena, J.D.; Gao, J.; Ono, M.; Lambert, R.W.; Kelleher, R.S.; Sullivan, D.A. Influence of gender and the endocrine environment on the distribution of androgen receptors in the lacrimal gland. J. Steroid. Biochem. Mol. Biol. 1993, 46, 737–749. [Google Scholar] [CrossRef]
- Kotwicki, T.; Tomaszewski, M.; Andrusiewicz, M.; Śliwa, A.; Rusin, B.; Kotwicka, M. Estrogen Receptor Type 1 and Type 2 Presence in Paravertebral Skeletal Muscles: Expression Level and Relation to Phenotype in Children with Idiopathic Scoliosis. Genes 2022, 13, 739. [Google Scholar] [CrossRef]
- Hutson, D.D.; Gurrala, R.; Ogola, B.O.; Zimmerman, M.A.; Mostany, R.; Satou, R.; Lindsey, S.H. Estrogen receptor profiles across tissues from male and female Rattus norvegicus. Biol. Sex Differ. 2019, 10, 4. [Google Scholar] [CrossRef] [Green Version]
- Aranda, A.; Pascual, A. Nuclear hormone receptors and gene expression. Physiol. Rev. 2001, 81, 1269–1304. [Google Scholar] [CrossRef] [Green Version]
- Matthews, J.; Gustafsson, J.A. Estrogen signaling: A subtle balance between ER alpha and ER beta. Mol. Interv. 2003, 3, 281–292. [Google Scholar] [CrossRef]
- Hewitt, S.C.; Korach, K.S. Oestrogen receptor knockout mice: Roles for oestrogen receptors alpha and beta in reproductive tissues. Reproduction 2003, 125, 143–149. [Google Scholar] [CrossRef]
- Blencowe, M.; Chen, X.; Zhao, Y.; Itoh, Y.; McQuillen, C.N.; Han, Y.; Shou, B.L.; McClusky, R.; Reue, K.; Arnold, A.P.; et al. Relative contributions of sex hormones, sex chromosomes, and gonads to sex differences in tissue gene regulation. Genome Res. 2022, 32, 807–824. [Google Scholar] [CrossRef]
- Richards, S.M.; Jensen, R.V.; Liu, M.; Sullivan, B.D.; Lombardi, M.J.; Rowley, P.; Schirra, F.; Treister, N.S.; Suzuki, T.; Steagall, R.J.; et al. Influence of sex on gene expression in the mouse lacrimal gland. Exp. Eye Res. 2006, 82, 13–23. [Google Scholar] [CrossRef]
- Sullivan, D.A.; Jensen, R.V.; Suzuki, T.; Richards, S.M. Do sex steroids exert sex-specific and/or opposite effects on gene expression in lacrimal and meibomian glands? Mol. Vis. 2009, 15, 1553–1572. [Google Scholar]
- Tellefsen, S.; Morthen, M.K.; Richards, S.M.; Lieberman, S.M.; Rahimi Darabad, R.; Kam, W.R.; Sullivan, D.A. Sex Effects on Gene Expression in Lacrimal Glands of Mouse Models of Sjögren Syndrome. Investig. Ophthalmol. Vis. Sci. 2018, 59, 5599–5614. [Google Scholar] [CrossRef] [Green Version]
- Šemanjski, K.; Majdič, G.; Kozina, V.; Ježek, D. Sexual dimorphism of the extraorbital lacrimal glands in SF-1 knockout mice. Acta Histochem. 2021, 123, 151669. [Google Scholar] [CrossRef] [PubMed]
- Handelsman, D.J. Androgen Physiology, Pharmacology, Use and Misuse. In Endotext; Feingold, K.R., Anawalt, B., Boyce, A., Chrousos, G., de Herder, W.W., Dhatariya, K., Dungan, K., Hershman, J.M., Hofland, J., Kalra, S., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Horstman, A.M.; Dillon, E.L.; Urban, R.J.; Sheffield-Moore, M. The Role of Androgens and Estrogens on Healthy Aging and Longevity. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 2012, 67, 1140–1152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibson, E.J.; Stapleton, F.; Wolffsohn, J.S.; Golebiowski, B. Local synthesis of sex hormones: Are there consequences for the ocular surface and dry eye? Br. J. Ophthalmol. 2017, 101, 1596–1603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, P.D.; Johar, K.S.; Nagpal, K.; Vasavada, A.R. Sex hormone receptors in the human eye. Surv Ophthalmol 2005, 50, 274–284. [Google Scholar] [CrossRef]
- Rangel, N.; Rondon-Lagos, M.; Annaratone, L.; Aristizábal-Pachon, A.F.; Cassoni, P.; Sapino, A.; Castellano, I. AR/ER Ratio Correlates with Expression of Proliferation Markers and with Distinct Subset of Breast Tumors. Cells 2020, 9, 1064. [Google Scholar] [CrossRef]
- Reddy, A.; Growney, J.D.; Wilson, N.S.; Emery, C.M.; Johnson, J.A.; Ward, R.; Monaco, K.A.; Korn, J.; Monahan, J.E.; Stump, M.D.; et al. Gene Expression Ratios Lead to Accurate and Translatable Predictors of DR5 Agonism across Multiple Tumor Lineages. PLoS ONE 2015, 10, e0138486; Erratum in PLoS ONE 2016, 11, e0146635. [Google Scholar] [CrossRef] [Green Version]
- Miller, H.E.; Bishop, A.J.R. Correlation AnalyzeR: Functional predictions from gene co-expression correlations. BMC Bioinform. 2021, 22, 206. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hat, K.; Planinić, A.; Ježek, D.; Kaštelan, S. Expression of Androgen and Estrogen Receptors in the Human Lacrimal Gland. Int. J. Mol. Sci. 2023, 24, 5609. https://doi.org/10.3390/ijms24065609
Hat K, Planinić A, Ježek D, Kaštelan S. Expression of Androgen and Estrogen Receptors in the Human Lacrimal Gland. International Journal of Molecular Sciences. 2023; 24(6):5609. https://doi.org/10.3390/ijms24065609
Chicago/Turabian StyleHat, Koraljka, Ana Planinić, Davor Ježek, and Snježana Kaštelan. 2023. "Expression of Androgen and Estrogen Receptors in the Human Lacrimal Gland" International Journal of Molecular Sciences 24, no. 6: 5609. https://doi.org/10.3390/ijms24065609