Next Article in Journal / Special Issue
Genome-Wide Characterization and Gene Expression Analyses of Malate Dehydrogenase (MDH) Genes in Low-Phosphorus Stress Tolerance of Chinese Fir (Cunninghamia lanceolata)
Previous Article in Journal
Modeling of Respiratory Diseases Evolving with Fibrosis from Organoids Derived from Human Pluripotent Stem Cells
Previous Article in Special Issue
Transcriptomic and Proteomic Analyses of Celery Cytoplasmic Male Sterile Line and Its Maintainer Line
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 5
10.3390/ijms24054416
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Application of Nicotinamide to Culture Medium Improves the Efficiency of Genome Editing in Hexaploid Wheat

by
Wanxin Wang
1,†,
Peipei Huang
1,†,
Wenshuang Dai
1,2,
Huali Tang
1,
Yuliang Qiu
1,
Yanan Chang
1,
Zhiyang Han
1,
Xi Li
1,
Lipu Du
1,
Xingguo Ye
1,
Cheng Zou
2,* and
Ke Wang
1,*
1
Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China
2
National Key Facility of Crop Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(5), 4416; https://doi.org/10.3390/ijms24054416
Submission received: 20 January 2023 / Revised: 20 February 2023 / Accepted: 22 February 2023 / Published: 23 February 2023
(This article belongs to the Special Issue Recent Advances in Plant Molecular Science in China 2022)
Browse Figures
Review Reports Versions Notes

Abstract

:
Histone acetylation is the earliest and most well-characterized of post-translation modifications. It is mediated by histone acetyltransferases (HAT) and histone deacetylases (HDAC). Histone acetylation could change the chromatin structure and status and further regulate gene transcription. In this study, nicotinamide, a histone deacetylase inhibitor (HDACi), was used to enhance the efficiency of gene editing in wheat. Transgenic immature and mature wheat embryos harboring a non-mutated GUS gene, the Cas9 and a GUS-targeting sgRNA were treated with nicotinamide in two concentrations (2.5 and 5 mM) for 2, 7, and 14 days in comparison with a no-treatment control. The nicotinamide treatment resulted in GUS mutations in up to 36% of regenerated plants, whereas no mutants were obtained from the non-treated embryos. The highest efficiency was achieved when treated with 2.5 mM nicotinamide for 14 days. To further validate the impact of nicotinamide treatment on the effectiveness of genome editing, the endogenous TaWaxy gene, which is responsible for amylose synthesis, was tested. Utilizing the aforementioned nicotinamide concentration to treat embryos containing the molecular components for editing the TaWaxy gene, the editing efficiency could be increased to 30.3% and 13.3%, respectively, for immature and mature embryos in comparison to the 0% efficiency observed in the control group. In addition, nicotinamide treatment during transformation progress could also improve the efficiency of genome editing approximately threefold in a base editing experiment. Nicotinamide, as a novel approach, may be employed to improve the editing efficacy of low-efficiency genome editing tools such as base editing and prime editing (PE) systems in wheat.

1. Introduction

The development and application of genome editing technology has provided important technical support for plant functional gene research and crop genetic improvement. Compared with other developed genome editing technologies, CRISPR/Cas systems have the advantages of simple operation and high efficiency. Since the first application of CRISPR/Cas9 genome editing technology in eukaryotes in 2013 [1,2], it has become a revolutionary tool in the life sciences. The CRISPR/Cas9 system has been widely used for genome engineering in diverse eukaryotic species. Now, it is becoming a powerful biology tool for human gene therapy and plant breeding. CRISPR/Cas9 is mainly applied in crop genome editing for studies of gene function and genetic improvement.
Editing efficiency is an important issue for the CRISPR/Cas9 technique. There are several factors which normally influence efficiency. First, different gene editing tools and Cas9 variants have different editing efficiency levels. The editing efficiencies of SpCas9, CjCas9, SaCas9, StCas9, NmCas9, Cpfl, SpCas9NG, XCas9, SPG, and SPR were different [3,4,5,6] and up until now, the CRISPR/Cas9 system was the most efficient and widely used solution for genome editing. Second, editing efficiency is also influenced by the the integration locations and expression levels of the Cas9 and targeted sgRNA in the genome of transgenic plants ae well as the structures of the sequences of the sgRNA in the genome [4]. Third, the editing efficiency of the CRISPR systems differs in different species. For instance, the editing efficiency of Cpf1 reached 75% in rice [7] but only 3.1% in wheat [8]. It is generally believed that genome editing is more difficult in polyploid than diploid plants because there is only one copy of a functional gene in diploid plants and multiple copies in polyploid ones. Target traits are only displayed when their multiple controlled genes are edited simultaneously in a single polyploid plant. For example, although the editing efficiencies of wheat TaMTL and TaWaxy genes were up to 57.5% and 80.5%, respectively, the simultaneous editing efficiencies at their three loci were only 12.9% and 32.2%, respectively [8]. Finally, environmental conditions and artificial treatments could affect the editing efficiency of CRISPR. It was reported that high-temperature treatment increased the editing efficiency of Cpf1 in Arabidopsis, rice, maize, and wheat [9,10].
Previous reports reported that chromatin structure could influence the genome editing efficiency in different eukaryotic cells [11,12]. In general, eukaryotic genomic DNA is wrapped around histones, which first form nucleosome structures and further compact into higher-order chromatin structures [13,14]. Chromatin structures actually involve an alternation between open and closed states. The regions which have low concentrations of histones, or naked DNA, are called open chromatin; DNA replication and gene transcription occur in these regions [15]. Thereby, the activity of the Cas9 protein is significantly different between the closed area winding the nucleosome and the open area, and Cas9 cannot bind to the DNA on the nucleosome [14,16,17]. The binding site of Cas9 in mammals was found that the binding of Cas9 to target genes mainly occurred in the open chromatin region [11]. In fact, the efficiency of CRISPR/Cas9-induced insertion and deletions (indels) in human cells was higher at the sites in open chromatin regions than in closed chromatin regions [18]. Based on the published genomic data and other available information on rice, the editing efficiency of CRISPR/Cas9 in open regions was higher than that in closed regions [19].
To our knowledge, chromatin remodeling can make the core histone octamer slide on the DNA strand and change the distance between nucleosomes or the conformation of nucleosomes by replacing histone variants or removing the nucleosomes [20]. Thus, gene replication, recombination, transcription, and expression can be regulated through exposure of the promoter and enhancer or DNA replication of target genes [20]. There are two main types of enzymes that regulate the process of chromatin remodeling: ATP-dependent chromatin remodelers and histone modifiers. It has been demonstrated that the interaction between histone acetylation modifications and transcription factors is beneficial, promoting chromatin opening, and that it could potentially improve the editing efficiency of the CRISPR system [21]. Histone acetylation, as the earliest and most well-characterized of post-translation modifications, plays a major role in chromatin remodeling. Histone acetylation, which is mediated by histone acetyltransferases (HAT) and histone deacetylases (HDAC), can change chromatin structures and regulate gene transcription, DNA replication, and repair [22].
Histone deacetylase inhibitors (HDACis) were used to treat the HEK293T cell line by adding acetyl groups into histones to promote the opening of chromatin, and the editing efficiency of CRISPR/Cas9 system was improved [23]. Sodium butyrate and nicotinamide are two commonly applied histone deacetylase inhibitors (HDACis). Sodium butyrate is a short-chain fatty acid that inhibits the Arabidopsis RPD3/HDA1 in HDAC gene family [24]. Nicotinamide, as a derivative of vitamin B3 and a product of the SIR2 HDAC family deacetylation reaction, inhibits the function of HDACs in mammals and yeast [25,26]. The exposure of maize cells to HDACis led to open chromatin structures in the region of target genes and further improved the efficiency of oligonucleotide-directed mutagenesis (ODM) [27]. In our previous study, wheat seedlings were treated with nicotinamide, and transcriptome analyses found that nicotinamide treatment would change the expression of chromatin state-related genes [28]. In this study, we investigated the effects of nicotinamide in different concentrations on several wheat transgenic tissues, including immature embryos, mature embryos, and calluses, to enhance genome editing efficiency through alterations in chromatin status. Our results provide a new strategy to improve wheat genome editing efficiency.

2. Results

2.1. Effect of Nicotinamide Treatment of Transgenic Wheat Immature Embryos on the Mutation Efficiency of GUS Gene

The T1 transgenic plants harboring the Cas9 and a GUS-targeting sgRNA generated earlier by the pMWB110-SpCas9-TaU3-GUS vector, denoted GUC plants in which the GUS gene was not edited [8], were planted in a greenhouse for this experiment. In order to confirm if the T1 plants still carry the bar gene linked to Cas9, PCR was performed (Figure S1a), which resulted in detection of the bar gene in 48 plants out of the 62 plants tested. Then, the lack of the mutations in the GUS gene in the bar-positive plants was tested with PCR-RE (Figure S1b). No mutation in the GUS gene was detected in any of the transgenic plants tested.
In total, 240 immature embryos, collected from the positive T1 plants, were cultured with 2.5 and 5.0 mM nicotinamide for 2, 7, and 14 days designated as 2-2.5-G, 2-5-G, 7-2.5-G, 7 -5-G, 14-2.5-G, and 14-5-G, respectively, and without nicotinamide designated as 2-G, 7-G, and 14-G. When the cultured T2 plants were transplanted into pots, they were all analyzed for the presence of the bar gene, and 173 plants were confirmed to contain the bar gene as well as Cas9/sgRNA expression cassette. Then, the mutations of GUS gene in the positive plants were tested by PCR-RE (Figure S2). There were no edited plants in 2-G, 2-2.5-G, and 2-5-G groups (Figure S2a), while 3 and 4 mutations were detected in groups 7-2.5-G and 7-5-G with mutation efficiencies of 16.7% and 21.1%, respectively (Figure S2b). Furthermore, 9 and 4 mutations were found in groups 14-2.5-G and 14-5-G with editing efficiencies of 36.0% and 17.4%, respectively (Table 1). Moreover, one homozygous mutant plant was detected in group 14-2.5-G. The mutation efficiency of GUS after 2.5 mM nicotinamide treatment for 14 d was the highest (36.0%).
To further confirm the new mutants after nicotinamide treatment, the GUS gene in the plants was sequenced and analyzed. The GUS staining showed that the homozygous mutant did not exhibit blue coloring, while the other heterozygous mutants still expressed the GUS gene (Figure 1a). The types of mutations in GUS gene in the new mutants were mainly 1 bp, 3 bp, 5bp, and 12 bp deletions after sequencing (Figure 1b).

2.2. Effect of Nicotinamide Treatment to Transgenic Wheat Immature Embryos on the Mutation Efficiency of TaWaxy Genes

In order to further confirm the effects of nicotinamide treatment, the transgenic T0 plants, which had no mutations within endogenous TaWaxy genes and harbored Cas9 and a TaWaxy-targeting sgRNA cassette (denoted WUC plants), were analyzed for the presence of bar genes by PCR and mutations of TaWaxy genes by PCR-RE (Figure S3a,b). The results indicated that there was still no mutation in the TaWaxy gene in the plants testing positive. Then, the immature embryos of T0 WUC plants were cultured on 2.5 and 5.0 mM nicotinamide and control medium for 14 days. There were 58, 71, and 64 embryos for 14-W1, 14-2.5-W1, and 14-5-W1 groups, respectively. After the cultured plants were transplanted into pots, 44, 53, and 48 positive plants were confirmed in 14-W1, 14-2.5-W1, 14-5-W1, respectively, after PCR testing for the bar gene. Three pairs of specific primers were used to detect mutations of TaWaxy genes on chromosomes 4A, 7A, and 7D by PCR-RE (Figure S4). There was still no mutation detected in 14-W1, while 7 and 5 mutations were detected in 14-2.5-W1 and 14-5-W1, respectively, with mutation efficiencies of 13.2% and 10.4% (Table 2). In group 14-2.5-W1, 2, 3, and 5 mutations were detected at the loci on 4A, 7A, and 7D, respectively, and the simultaneously mutation frequencies for one, two, and three loci were 7.5%, 5.7%, and 0%, respectively (Table 2). In group 14-5-W1, 1, 2, and 4 mutations were detected at the three loci with editing efficiencies of 2.1%, 4.1%, and 8.4%, respectively, and the simultaneous mutation frequencies for one, two, and three loci were 6.3%, 4.2%, and 0%, respectively (Table 2). Additionally, it was found that the editing efficiency in 14-2.5-W1 was slightly higher than that in 14-5-W1.
Considering that nicotinamide treatment can significantly improve editing efficiency in transgenic and unedited wheat plants and obtain the edited plants at up to two loci simultaneously, we treated the edited plants at one locus to obtain edited plants at three loci. Hence, a total of 42 immature embryos of the transgenic and edited wheat plants which had either one mutation among the three loci on chromosomes 4A, 7A, and 7D were treated on 2.5 and 5.0 mM nicotinamide and control for 14 d. There were only 12, 13, and 8 positive cultured plants, respectively, confirmed in groups 14-W2, 14-2.5-W2, and 14-5-W2 after bar gene detection. Based on the detection results by PCR-RE (Figure S5), new mutation efficiencies of 8.3%, 30.8%, and 25.0% were achieved in 14-W2, 14-2.5-W2, and 14-5-W2, respectively (Table 3). In 14-W2, only one plant had two mutations, at the loci on 4A and 7A, in which the mutation on 4A was newly edited. In 14-2.5-W2, three plants with two locus mutations and one plant with three loci mutations were identified, respectively, with a new mutation efficiency of 30.8%. In 14-5-W2, two loci mutations were found in two plants. It could be summarized that the 2.5 mM nicotinamide was the best concentration to treat immature wheat embryos with the goal of creating new editing loci.
To further confirm the new mutants after nicotinamide treatment on the immature embryos, the TaWaxy gene in the candidate mutant plants was sequenced and analyzed. The types of mutations in TaWaxy gene mutants were mainly 1 bp, 4 bp, 7 bp, 13 bp, 533 bp deletion mutations and a 1 bp insertion mutation. (Figure 2).

2.3. Effects of Nicotinamide Treatment of Transgenic Mature Wheat Embryos on the Mutation Efficiency of TaWaxy Genes

In order to explore the effects of nicotinamide treatment of transgenic mature wheat embryos on the mutation efficiency of TaWaxy genes, we harvested the seeds of T1 transgenic plants with expression editing cassettes and without mutations. Their mature embryos were cultured on control medium and treatment medium containing 2.5 and 5.0 mM nicotinamide for 14 d, and then the in-vitro-treated plantlets were moved into pots after sufficient growth. After bar gene detection, 21, 15, and 8 positive plants were identified in 14-W3, 14-2.5-W3, and 14-5-W3, respectively. Furthermore, based on PCR-RE detection (Figure S6), no mutations were detected in 14-W3, but two edited plants were found in 14-2.5-W3 and one edited plant was found in 14-5-W3, with mutation efficiencies of 13.3% and 12.5%, respectively (Table 4). When the mutations were detected by sequencing, the results showed that the mutation types in TaWaxy gene in the mutants were mainly 1 bp and 4 bp deletions and a 1 bp insertion (Figure 3).

2.4. Determination of Available Concentration of Nicotinamide Treatment during Wheat Genetic Transformation Steps

To confirm if nicotinamide treatment was able to influence wheat genetic transformation, different dosages of nicotinamide (0, 2.5, and 5 mM) were added into the WLS-Res medium in the genetic transformation of NGT2 vector using the immature embryos of Fielder by Agrobacterium. The results clearly showed that the addition of nicotinamide to medium inhibited the growth of callus (Figure 4). With increased nicotinamide concentration, callus growth was significantly negatively influenced, and callus differentiation capacity was also greatly decreased. Obviously, the concentration of nicotinamide was negatively correlated with the efficiency of wheat transformation (Table 5). The efficiency reached up to 93.0% for NGT2 without nicotinamide, while the efficiency levels were only 54.6% and 18.4% for NGT2-2.5 and NGT2-5, respectively. The application of 5 mM nicotinamide led to an extremely low transformation efficiency; therefore, this concentration should not be applied during wheat genetic transformation.

2.5. Application of Nicotinamide in Wheat Transformation for Improving Mutation Efficiency by Base Editing

An expression vector, ABENG-Wx, was used for base editing in wheat genetic transformation to investigate the effects of nicotinamide application, with available concentrations, on the mutation efficiency of base editing. Since there were only two copies of TaWaxy genes in Fielder on chromosomes 7A and 7D, another copy of TaWaxy-7B did not need to be detected in the transgenic plants. As shown in Table 6, only one mutant was found in 30 transgenic plants in the control experiment (without nicotinamide treatment) and the efficiency of the target gene (by base editing) was only 3.3%. A total of six mutants were detected in the treatment experiment with 2.5 mM nicotinamide, and the editing efficiency was increased nearly threefold (9.7%). Moreover, TaWaxy-7A and TaWaxy-7D were found to be simultaneously edited in two mutants. The results of sequencing shown that all of mutations occurred at the 4th or 7th base of the sgRNA, only one transgenic plants have the mutation at both positions simultaneously (Figure 5).

3. Discussion

3.1. The Factors Affect the HDACi Treatment

In fact, many factors influence the effect of HDACi treatment, listed as follows: (1) The types of HDACi. Sodium butyrate and nicotinamide were two kinds of HDACi. Bond et al. found that the expression of the VIN3 gene in Arabidopsis was increased when the plants were exposed to sodium butyrate and nicotinamide, indicating that HDACi could relax chromatin [29]. It was also found that the pretreatment of maize cells with either sodium butyrate and nicotinamide had a positive effect on the efficiency of oligonucleotide-directed mutagenesis [27]. In the two chemicals, treatment with nicotinamide had a less severe effect on plant growth than sodium butyrate in Arabidopsis [29]. Additionally, sodium butyrate has been proven to exert a negative effect on wheat tissues [28]. Therefore, it is better to treat wheat tissues using nicotinamide. (2) The concentration of nicotinamide. It was found that the effect of nicotinamide treatment at 5 mM is 2.5 fold higher than that at 2.5 mM in Arabidopsis [29]. Moreover, when nicotinamide (1–5 mM) was used in maize cells, the editing efficiency enhanced with the increased concentration [27], while our results showed that the effect of 2.5 mM nicotinamide treatment on editing efficiency is optimal (Table 1 and Table 2). (3) The time of nicotinamide treatment. The times normally influence the effect of nicotinamide treatment (Table 1 and Table 5). In this study, we obtained the best editing results using nicotinamide to treat wheat tissues for 7 d (Table 1). (4) The tissues used for nicotinamide treatment. It was reported that the nicotinamide treatment showed a good effect on seedlings and cells [27,29]. In this study, the editing efficiency was proved to be improved by treating wheat callus, mature, and immature embryo with nicotinamide. (5) Species. Different plant species may also lead to different effects of nicotinamide treatment. (6) Other factors. In this study, the treatment effect of nicotinamide for the GUS gene is higher than that for the TaWaxy gene. This might be caused by different sgRNA or even different insertion sites of transgenes which might lead to different expression of the Cas9 gene.

3.2. Application Prospects of Nicotinamide in Wheat for Efficient Genome Editing

Although the editing efficiency of CRISPR is high in some diploid plants, it is still somewhat difficult to obtain mutants in which all the target allelic genes are simultaneously edited in polyploid plants. For example, in wheat, the editing efficiency reached 51.7% for the three TaNud alleles as a whole but only 8.5% for TaNud-7D alone [30]. When we edit some genes in wheat, there is no mutation, and generally we need to do transformation experiments again. In this study, we found that nicotinamide treatment can increase the editing efficiency to 36% from 0% (Table 1) in the next generation of non-edited transgenic plants. Therefore, nicotinamide treatment can be used to treat the non-mutation transgenic plants for obtaining the mutants, which saves time and cost. Normally, if there is only single chromosome mutation happening in different plants, crosses need to be made with each other for obtaining triple mutations. In this study, the efficiency of triple mutations was increased to 7.7% from 0% after nicotinamide treatment on single-chromosome mutations under optimal conditions (Table 3). Therefore, the application of nicotinamide treatment is an available choice for improving editing efficiency in wheat.
Adenine base editors (ABEs) and cytosine base editors (CBEs) are two major developments in base editing tools. Recently, several evolved ABE8e systems have been reported to increase A-to-G editing efficiency in plants [31,32,33,34]. ABE8e were fused with SpCas9 nickase variants (SpCas9-NG) that recognized the PAM NGN to form ABE8e-NG and led to an average editing efficiency of 59.3% for the tested NGN target sites in rice [35]. In the present study, the editing efficiency of ABE8e-NG was only 3.33% in wheat, but it could be increased nearly threefold after nicotinamide treatment. Therefore, the effect of nicotinamide treatment on the editing efficiency by base editing is very positive. The prime editing (PE) system is another recent genome editing tool and the latest research hotspot. However, as of now, its efficiency is still very low [36,37]. The application of nicotinamide treatment might provide an effective strategy to improve the editing efficiency by PE system. Therefore, we assumed that nicotinamide treatment would have a great application potential for the editing of inefficient target sites in wheat using base editing and PE systems.

4. Materials and Methods

4.1. Plant Materials

The plant materials used in this study included T1 homozygous transgenic wheat line H29 in the genetic background of CB037 which carried an active GUS gene (called first time transformation), T1 transgenic plants of non-mutated GUS containing Cas9 and the sgRNA for GUS in the genetic background of H29 (called second transformation), and T0 transgenic plants transformed with pMWB110-SpCas9-TaU3-Waxy vector in the genetic background of Ningchun4 for nicotinamide treatment using their immature embryos, in which the target genes were not edited or partially edited. The aforementioned materials were obtained from our previous study [8]. Additionally, a spring wheat cultivar, Fielder, maintained in our group was also used to study the influence of nicotinamide treatment on callus growth and transformation efficiency. All the plants were grown in pots in a growth chamber maintained at 24 °C under 16/8 h light/dark conditions with 300 μmol m−2 s−1 light intensity and 45% humidity.
The immature embryos of the T0 transgenic plants were treated with nicotinamide, and their mature embryos from the harvested seeds of no-edited plants were treated with nicotinamide again. Then, the effects of nicotinamide treatment on subsequent editing efficiency were investigated.

4.2. Design of Wheat Mature and Immature Embryos with Nicotinamide Treatment

About 14 days post-anthesis (DPA), the immature wheat grains were sampled, sterilized with 70% ethanol for 1 min and 15% sodium hypochlorite for 10 min and then washed three times with sterile water. The immature wheat embryos were isolated and cultured on 1/2 MS medium (2.215 g L−1 MS powder, 20 g L−1 sucrose, 0.5 g L−1 MES, and 3 g L−1 phytagel, pH 5.8) with two concentrations of nicotinamide (2.5 and 5.0 mM, N0636, Sigma, Louis, MO, USA) at 2, 7, and 14 d in order as well as a non-treated control in which the germinated embryos in the treatments with nicotinamide for 2 and 7 d were promptly moved onto the control medium for a total culture period of 14 d. Then, the plantlets were transplanted into pots with soil for further growth.
The mature wheat grains were surface sterilized with 70% ethanol for 1 min and with 15% sodium hypochlorite for 20 min, washed with sterile water three times, and then immersed in sterile water before being placed in a shaker overnight. The slightly germinated seeds were sterilized with 15% sodium hypochlorite for 20 min and washed with sterilized water three times. The mature embryos were separated from the seeds and cultured on 1/2 MS medium with nicotinamide at the same levels and time intervals above.

4.3. Detection of Mutations

Genomic DNA was extracted from the leaves of candidate wheat mutant plants using a Nuclean Plant Genomic DNA Kit (CW0531M, CWBIO, Jiangsu, China). The specific primers were used to amplify the targeted genes of bar, GUS, and TaWaxy, in order (Supplementary Table S1). In order to confirm that the candidate plants contained the genome editing cassette, the bar gene was detected first. Then, the PCR-restriction enzyme (PCR-RE) method was applied to detect the mutants, in which the specific PCR products were digested at 37 °C for 2 h in the 20 μL reaction buffer consisted of the corresponding restriction enzymes (1 U each) and 10 μL PCR products. The restriction enzymes of SnaBI and BglII were used to detect the GUS and TaWaxy gene mutants, respectively. The resultant products were separated in a 1% agarose gel and visualized using a GelDoc XR System (BioRad, Hercules, CA, USA). Three types of band patterns were found in the PCR-RE assay; heterozygous monoallelic mutants gave three bands, biallelic mutants gave only the largest band, and nonmutants and wild-type (WT) plants gave two completely digested bands. The PCR products were directly sequenced at Sangon Biotech (Shanghai, China) for analysis of the mutations induced by base editing.

4.4. Base Editing Vector Construction

The pWMB110-SpCas9 containing the bar gene as a selection marker for generating transgenic plants and the maize (Zea mays) ubi promoter for driving the expression of Cas9 gene had previously been constructed by our laboratory [8]. The sequences of ABE8e and SpCas9-NG [35] were optimized based on the wheat genome sequencing data and then inserted the pMWB110-SpCas9 vector to replace the SpCas9. In order to increase the transformation efficiency, a regeneration-related gene, TaWOX5, was introduced into the base editing vector to generate the pMWB110-ABE-NG-TaWOX5 plasmid [38]. The sgRNA1 (AAGACCAAGGAGAAGATCTA) and sgRNA2 (CTGGATGAAGGCCGGGATCCTGC) were designed on https://crispr.bioinfo.nrc.ca/WheatCrispr/, (accessed on 21 February 2023) based on the sequences of TaWaxy genes for base editing, and then the sgRNA controlled by TaU3 promoter was constructed onto plasmid pMWB110-ABE-NG-TaWOX5 to generate ABENG-Wx and NGT2 vectors according to the method described by Liu et al. [8], respectively. The base editing vector was transformed into Agrobacterium strain C58C1 for wheat transformation.

4.5. Wheat Transformation

Immature wheat embryos were isolated and underwent Agrobacterium-mediated transformation to obtain transgenic plants following the protocol described by Wang et al. [38]. In brief, immature wheat embryos were incubated with Agrobacterium strain C58C1-harboring a transformation vector for 5 min in WLS-inf medium (1/10 Linsmaier and Skoog (LS) salts, 1/10 Murashige and Skoog (MS) vitamins, glucose 10 g L−1, 2-(N-morpholino) ethanesulfonic acid (MES) 0.5 g L−1, and acetosyringone (AS) 100 μM, pH 5.8) at room temperature and co-cultivated for 2 d on WLS-AS medium (WLS-inf medium plus AgNO3 0.85 mg L−1, CuSO4·5H2O 1.25 mg L−1 and agarose 8 g L−1) with scutellum facing upwards at 25 °C in darkness. After co-cultivation, embryonic axes were removed with a scalpel, and the scutella were transferred onto plates containing WLS-Res medium (LS salts, MS vitamins, 2,4-d 0.5 mg L−1, picloram 2.2 mg L−1, AgNO3 0.85 mg L−1, ascorbic acid 100 mg L−1, carbenicillin 250 mg L−1, cefotaxime 100 mg L−1, MES 1.95 g L−1, and agarose 5 g L−1) for delay culture for 7 d with different nicotinamide concentrations. Afterward, the tissues were moved onto WLS-P5 medium (WLS-Res medium plus phosphinothricin (PPT, Sigma, no. 45520) 5 mg L−1 without cefotaxime) for callus induction. Two weeks later, the calli were shifted onto WLS-P10 medium (WLS-Res medium plus PPT 10 mg L−1 without cefotaxime) for 3 weeks in darkness. The embryogenic calli were then differentiated on LSZ-P5 medium (1/2MS medium containing PPT 5 mg L−1) at 25 °C with 100 μmol/m2/s light. The regenerated shoots were transferred into cups filled with LSF-P5 medium (LSZ-P5 medium plus IBA 1 mg L−1) for elongation and root formation. The plantlets with well-developed root systems were transplanted into pots and cultivated in a growth chamber.

Supplementary Materials

The supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24054416/s1.

Author Contributions

K.W. and C.Z. designed the project. K.W. and X.Y. conducted the experiments. W.W., P.H., W.D., H.T., Y.Q., Y.C., Z.H., X.L. and L.D. participated in some experiments. W.W., P.H. and W.D. analyzed the data and wrote the manuscript. K.W. and X.Y. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (31871710 and 31971946), the Agricultural Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (S2022ZD03), and the Chinese Academy of Agricultural Sciences in China (2060302-2-19).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article and supplementary material.

Acknowledgments

The authors are grateful to all lab members for encouragement. We are grateful to Wenxue Li at the Institute of Crop Science, Chinese Academy of Sciences, China, for the help on the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [Green Version]
  2. Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. RNA-guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Walton, R.T.; Christie, K.A.; Whittaker, M.N.; Kleinstiver, B.P. Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science 2020, 368, 290–296. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, K.; Gong, Q.; Ye, X. Recent developments and applications of genetic transformation and genome editing technologies in wheat. Theor. Appl. Genet. 2020, 133, 1603–1622. [Google Scholar] [CrossRef] [PubMed]
  5. Hu, J.H.; Miller, S.M.; Geurts, M.H.; Tang, W.; Chen, L.; Sun, N.; Zeina, C.M.; Gao, X.; Rees, H.A.; Lin, Z.; et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature 2018, 556, 57–63. [Google Scholar] [CrossRef]
  6. Nishimasu, H.; Shi, X.; Ishiguro, S.; Gao, L.; Hirano, S.; Okazaki, S.; Noda, T.; Abudayyeh, O.O.; Gootenberg, J.S.; Mori, H.; et al. Engineered CRISPR-Cas9 nuclease with expanded targeting space. Science 2018, 361, 1259–1262. [Google Scholar] [CrossRef] [PubMed]
  7. Wang, M.; Mao, Y.; Lu, Y.; Tao, X.; Zhu, J.K. Multiplex Gene Editing in Rice Using the CRISPR-Cpf1 System. Mol. Plant 2017, 10, 1011–1013. [Google Scholar] [CrossRef] [Green Version]
  8. Liu, H.; Wang, K.; Jia, Z.; Gong, Q.; Lin, Z.; Du, L.; Pei, X.; Ye, X. Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system. J. Exp. Bot. 2020, 71, 1337–1349. [Google Scholar] [CrossRef]
  9. Wang, W.; Tian, B.; Pan, Q.; Chen, Y.; He, F.; Bai, G.; Akhunova, A.; Trick, H.N.; Akhunov, E. Expanding the range of editable targets in the wheat genome using the variants of the Cas12a and Cas9 nucleases. Plant Biotechnol. J. 2021, 19, 2428–2441. [Google Scholar] [CrossRef]
  10. Malzahn, A.A.; Tang, X.; Lee, K.; Ren, Q.; Sretenovic, S.; Zhang, Y.; Chen, H.; Kang, M.; Bao, Y.; Zheng, X.; et al. Application of CRISPR-Cas12a temperature sensitivity for improved genome editing in rice, maize, and Arabidopsis. BMC Biol. 2019, 17, 9. [Google Scholar] [CrossRef] [Green Version]
  11. Wu, X.; Scott, D.A.; Kriz, A.J.; Chiu, A.C.; Hsu, P.D.; Dadon, D.B.; Cheng, A.W.; Trevino, A.E.; Konermann, S.; Chen, S.; et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat. Biotechnol. 2014, 32, 670–676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Zhang, Z.; Hua, L.; Gupta, A.; Tricoli, D.; Edwards, K.J.; Yang, B.; Li, W. Development of an Agrobacterium-delivered CRISPR/Cas9 system for wheat genome editing. Plant Biotechnol. J. 2019, 17, 1623–1635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Campos, E.I.; Reinberg, D. Histones: Annotating chromatin. Annu. Rev. Genet. 2009, 43, 559–599. [Google Scholar] [CrossRef]
  14. Yarrington, R.M.; Verma, S.; Schwartz, S.; Trautman, J.K.; Carroll, D. Nucleosomes inhibit target cleavage by CRISPR-Cas9 in vivo. Proc. Natl. Acad. Sci. USA 2018, 115, 9351–9358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Thurman, R.E.; Rynes, E.; Humbert, R.; Vierstra, J.; Maurano, M.T.; Haugen, E.; Sheffield, N.C.; Stergachis, A.B.; Wang, H.; Vernot, B.; et al. The accessible chromatin landscape of the human genome. Nature 2012, 489, 75–82. [Google Scholar] [CrossRef] [Green Version]
  16. Hinz, J.M.; Laughery, M.F.; Wyrick, J.J. Nucleosomes Inhibit Cas9 Endonuclease Activity in Vitro. Biochemistry 2015, 54, 7063–7066. [Google Scholar] [CrossRef]
  17. Horlbeck, M.A.; Witkowsky, L.B.; Guglielmi, B.; Replogle, J.M.; Gilbert, L.A.; Villalta, J.E.; Torigoe, S.E.; Tjian, R.; Weissman, J.S. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife 2016, 5, e12677. [Google Scholar] [CrossRef]
  18. Chari, R.; Mali, P.; Moosburner, M.; Church, G.M. Unraveling CRISPR-Cas9 genome engineering parameters via a library-on-library approach. Nat. Methods 2015, 12, 823–826. [Google Scholar] [CrossRef] [Green Version]
  19. Liu, G.; Yin, K.; Zhang, Q.; Gao, C.; Qiu, J.L. Modulating chromatin accessibility by transactivation and targeting proximal dsgRNAs enhances Cas9 editing efficiency in vivo. Genome Biol. 2019, 20, 145. [Google Scholar] [CrossRef] [Green Version]
  20. Hargreaves, D.C.; Crabtree, G.R. ATP-dependent chromatin remodeling: Genetics, genomics and mechanisms. Cell Res. 2011, 21, 396–420. [Google Scholar] [CrossRef]
  21. Cheung, W.L.; Briggs, S.D.; Allis, C.D. Acetylation and chromosomal functions. Curr. Opin. Cell Biol. 2000, 12, 326–333. [Google Scholar] [CrossRef] [PubMed]
  22. Bertos, N.R.; Wang, A.H.; Yang, X.J. Class II histone deacetylases: Structure, function, and regulation. Biochem. Cell Biol. 2001, 79, 243–252. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, B.; Chen, S.; Rose, A.; Chen, D.; Cao, F.; Zwinderman, M.; Kiemel, D.; Aissi, M.; Dekker, F.J.; Haisma, H.J. Inhibition of histone deacetylase 1 (HDAC1) and HDAC2 enhances CRISPR/Cas9 genome editing. Nucleic Acids Res. 2020, 48, 517–532. [Google Scholar] [CrossRef] [Green Version]
  24. Davie, J.R. Inhibition of histone deacetylase activity by butyrate. J. Nutr. 2003, 133, 2485S–2493S. [Google Scholar] [CrossRef] [Green Version]
  25. Landry, J.; Slama, J.T.; Sternglanz, R. Role of NAD+ in the deacetylase activity of the SIR2-like proteins. Biochem. Biophys. Res. Commun. 2000, 278, 685–690. [Google Scholar] [CrossRef] [PubMed]
  26. Bitterman, K.J.; Anderson, R.M.; Cohen, H.Y.; Latorre-Esteves, M.; Sinclair, D.A. Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast sir2 and human SIRT1. J. Biol. Chem. 2002, 277, 45099–45107. [Google Scholar] [CrossRef] [Green Version]
  27. Tiricz, H.; Nagy, B.; Ferenc, G.; Torok, K.; Nagy, I.; Dudits, D.; Ayaydin, F. Relaxed chromatin induced by histone deacetylase inhibitors improves the oligonucleotide-directed gene editing in plant cells. J. Plant Res. 2018, 131, 179–189. [Google Scholar] [CrossRef] [Green Version]
  28. Dai, W.; Liu, H.; Du, Q.; Zou, C.; Wang, K. Extension of the in vivo haploid induction system from diploid maize to hexaploid wheat. Biotechnol. Bull. 2021, 37, 2–14. [Google Scholar]
  29. Bond, D.M.; Dennis, E.S.; Pogson, B.J.; Finnegan, E.J. Histone acetylation, VERNALIZATION INSENSITIVE 3, FLOWERING LOCUS C, and the vernalization response. Mol. Plant 2009, 2, 724–737. [Google Scholar] [CrossRef]
  30. Zang, Y.; Gong, Q.; Xu, Y.; Liu, H.; Bai, H.; Li, N.; Du, L.; Ye, X.; Lan, C.; Wang, K. Production of Conjoined Transgenic and Edited Barley and Wheat Plants for Nud Genes Using the CRISPR/SpCas9 System. Front. Genet. 2022, 13, 873850. [Google Scholar] [CrossRef]
  31. Wei, C.; Wang, C.; Jia, M.; Guo, H.X.; Luo, P.Y.; Wang, M.G.; Zhu, J.K.; Zhang, H. Efficient generation of homozygous substitutions in rice in one generation utilizing an rABE8e base editor. J. Integr. Plant Biol. 2021, 63, 1595–1599. [Google Scholar] [CrossRef] [PubMed]
  32. Li, J.; Xu, R.; Qin, R.; Liu, X.; Kong, F.; Wei, P. Genome editing mediated by SpCas9 variants with broad non-canonical PAM compatibility in plants. Mol. Plant 2021, 14, 352–360. [Google Scholar] [CrossRef]
  33. Yan, D.; Ren, B.; Liu, L.; Yan, F.; Li, S.; Wang, G.; Sun, W.; Zhou, X.; Zhou, H. High-efficiency and multiplex adenine base editing in plants using new TadA variants. Mol. Plant 2021, 14, 722–731. [Google Scholar] [CrossRef] [PubMed]
  34. Ren, Q.; Sretenovic, S.; Liu, S.; Tang, X.; Huang, L.; He, Y.; Liu, L.; Guo, Y.; Zhong, Z.; Liu, G.; et al. PAM-less plant genome editing using a CRISPR-SpRY toolbox. Nat. Plants 2021, 7, 25–33. [Google Scholar] [CrossRef] [PubMed]
  35. Tan, J.; Zeng, D.; Zhao, Y.; Wang, Y.; Liu, T.; Li, S.; Xue, Y.; Luo, Y.; Xie, X.; Chen, L.; et al. PhieABEs: A PAM-less/free high-efficiency adenine base editor toolbox with wide target scope in plants. Plant Biotechnol. J. 2022, 20, 934–943. [Google Scholar] [CrossRef] [PubMed]
  36. Li, J.; Chen, L.; Liang, J.; Xu, R.; Jiang, Y.; Li, Y.; Ding, J.; Li, M.; Qin, R.; Wei, P. Development of a highly efficient prime editor 2 system in plants. Genome Biol. 2022, 23, 161. [Google Scholar] [CrossRef]
  37. Song, M.; Lim, J.M.; Min, S.; Oh, J.S.; Kim, D.Y.; Woo, J.S.; Nishimasu, H.; Cho, S.R.; Yoon, S.; Kim, H.H. Generation of a more efficient prime editor 2 by addition of the Rad51 DNA-binding domain. Nat. Commun. 2021, 12, 5617. [Google Scholar] [CrossRef]
  38. Wang, K.; Shi, L.; Liang, X.; Zhao, P.; Wang, W.; Liu, J.; Chang, Y.; Hiei, Y.; Yanagihara, C.; Du, L.; et al. The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat. Plants 2022, 8, 110–117. [Google Scholar] [CrossRef]
Ijms 24 04416 g001 550
Figure 1. GUS staining and sequence analysis in the new mutant wheat plants. (a) The expression of GUS protein in mutants. I1-I3: the mutants from groups 7-2.5-G. I4: non-transgenic variety CB037. II1-II4: the mutants from the groups 7-5-G. III1-III4: the mutants from the groups 14-2.5-G. IV1-IV3: the mutants from the groups 14-5-G. IV4: the transgenic line H29 with GUS gene. III1: plant with biallelic mutations (the other mutants are heterozygous mutations). (b) Deletion mutations in the GUS gene in the mutants. The PAM region is underlined; blue letters indicate sgRNA sequences, and dashed lines represent nucleotide deletions.
Figure 1. GUS staining and sequence analysis in the new mutant wheat plants. (a) The expression of GUS protein in mutants. I1-I3: the mutants from groups 7-2.5-G. I4: non-transgenic variety CB037. II1-II4: the mutants from the groups 7-5-G. III1-III4: the mutants from the groups 14-2.5-G. IV1-IV3: the mutants from the groups 14-5-G. IV4: the transgenic line H29 with GUS gene. III1: plant with biallelic mutations (the other mutants are heterozygous mutations). (b) Deletion mutations in the GUS gene in the mutants. The PAM region is underlined; blue letters indicate sgRNA sequences, and dashed lines represent nucleotide deletions.
Ijms 24 04416 g001
Ijms 24 04416 g002 550
Figure 2. InDel mutations of the TaWaxy gene in the mutants generated from the immature embryos under nicotinamide treatment in vitro. The PAM region is underlined; blue letters indicate sgRNA sequences, red letters indicate insertions, and dashed lines represent nucleotide deletions.
Figure 2. InDel mutations of the TaWaxy gene in the mutants generated from the immature embryos under nicotinamide treatment in vitro. The PAM region is underlined; blue letters indicate sgRNA sequences, red letters indicate insertions, and dashed lines represent nucleotide deletions.
Ijms 24 04416 g002
Ijms 24 04416 g003 550
Figure 3. InDel mutations of the TaWaxy gene in the candidate mutants generated from the mature embryos after nicotinamide treatment. The PAM region is underlined; blue letters indicate sgRNA sequences; red letters indicate insertions; dashed lines represent nucleotide deletions.
Figure 3. InDel mutations of the TaWaxy gene in the candidate mutants generated from the mature embryos after nicotinamide treatment. The PAM region is underlined; blue letters indicate sgRNA sequences; red letters indicate insertions; dashed lines represent nucleotide deletions.
Ijms 24 04416 g003
Ijms 24 04416 g004 550
Figure 4. Callus growths and shoot regeneration status on the selection culture medium containing different concentrations of nicotinamide during wheat genetic transformation. (a) Callus growth status on WLS-P5 medium. (b) Shoot regeneration status on LSF-P5 medium.
Figure 4. Callus growths and shoot regeneration status on the selection culture medium containing different concentrations of nicotinamide during wheat genetic transformation. (a) Callus growth status on WLS-P5 medium. (b) Shoot regeneration status on LSF-P5 medium.
Ijms 24 04416 g004
Ijms 24 04416 g005 550
Figure 5. The sequencing results of base editing for the TaWaxy gene mutants. Sample 1: the mutants from the control group. Samples 2–7: the mutants from the nicotinamide treatment group.
Figure 5. The sequencing results of base editing for the TaWaxy gene mutants. Sample 1: the mutants from the control group. Samples 2–7: the mutants from the nicotinamide treatment group.
Ijms 24 04416 g005
Table
Table 1. The editing efficiency of GUS gene after nicotinamide treatment of immature embryos of the double transgenic parent plants which carry an active GUS gene (homozygous, first transformation) and genome editing vectors (hemizygous, second transformation) in different concentrations.
Table 1. The editing efficiency of GUS gene after nicotinamide treatment of immature embryos of the double transgenic parent plants which carry an active GUS gene (homozygous, first transformation) and genome editing vectors (hemizygous, second transformation) in different concentrations.
GroupsNicotinamide Concentration (mM)Treatment Time (d)Plants Testedbar-PositiveNo. of MutantsEditing Efficiency (%)
2-G02171300
2-2.5-G2.52282100
2-5-G52272200
7-G07251500
7-2.5-G2.5720183 (He)16.7
7-5-G5726194 (He)21.1
14-G014261700
14-2.5-G2.51436258 (He) + 1 (Bi)36.0
14-5-G51435234He17.4
Note: Bi: biallelic mutation type; He: heterozygous mutation type.
Table
Table 2. The editing efficiency of TaWaxy gene after nicotinamide treatment of the immature embryos of the transgenic plants which carry genome editing vectors (hemizygous) and without mutation in different concentrations.
Table 2. The editing efficiency of TaWaxy gene after nicotinamide treatment of the immature embryos of the transgenic plants which carry genome editing vectors (hemizygous) and without mutation in different concentrations.
GroupsPlants TestedBar-Positive PlantsMutation Types at Different Locus on ChromosomeNo. of MutantsEditing Efficiency (%)No. of the mutant Edited at One or Two Loci
4A7A7D12
14-W158440000000
14-2.5-W171532He (3.7%)3He (5.7%)5He (9.4%)7He13.24 (7.5%)3 (5.7%)
14-5-W164481He (2.1%)2He (4.1%)4He (8.4%)5He10.43 (6.3%)2 (4.2%)
Note: He: heterozygous mutation type.
Table
Table 3. The editing efficiency of TaWaxy genes with new mutations after nicotinamide treatment on immature embryos of transgenic plants which carry genome editing vectors (hemizygous) and with single chromosome mutations.
Table 3. The editing efficiency of TaWaxy genes with new mutations after nicotinamide treatment on immature embryos of transgenic plants which carry genome editing vectors (hemizygous) and with single chromosome mutations.
GroupsPlants TestedBar-Positive PlantsMutation Types at Different Locus on Chromosome No. of New MutantsEditing Efficiency (%)No. of the Mutant Edited at Two or Three Loci
4A7A7D23
14-W215121He (8.3%)0018.31 (8.3%)0
14-2.5-W217131He (7.7%)3He (23.1%)1He (7.7%)430.83 (23.1%)1 (7.7%)
14-5-W21081He (12.5%)1He (12.5%)0 0225.02 (25%)0
Note: He: heterozygous mutation type.
Table
Table 4. The editing efficiency of TaWaxy gene after nicotinamide treatment of the mature embryos of the transgenic plants which carry genome editing vectors (hemizygous) and without mutation with different concentrations.
Table 4. The editing efficiency of TaWaxy gene after nicotinamide treatment of the mature embryos of the transgenic plants which carry genome editing vectors (hemizygous) and without mutation with different concentrations.
GroupsPlants TestedBar Positive PlantsMutation Types at Different Locus on ChromosomeNo. of MutantsEditing Efficiency (%)No. of the Mutant Edited at One or Two Loci
4A7A7D12
14-W324210000000
14-2.5-W3181501He (6.7%)1He (6.7%)213.32 (13.3%)0
14-5-W39801He (12.5%)0112.51 (12.5%)0
Table
Table 5. Effects of nicotinamide on the efficiency of Agrobacterium-mediated genetic transformation of wheat.
Table 5. Effects of nicotinamide on the efficiency of Agrobacterium-mediated genetic transformation of wheat.
VectorNicotinamide Treatment (mM)No. of Explants TransformedNo. of Positive PlantsTransformation Efficiency (%)
NGT20575392.98
NGT22.5553054.55
NGT2538718.40
Note: The genotype was Fielder and the nicotinamide was added in WLS-Res medium.
Table
Table 6. The base editing efficiency of TaWaxy genes using nicotinamide treatment.
Table 6. The base editing efficiency of TaWaxy genes using nicotinamide treatment.
VectorNicotinamide Concentration (mM)Target LociNo. of Plants IdentifiedNo. of Plants EditedMutation Efficiency (%)
ABENG-Wx0TaWaxy-A3013.33
TaWaxy-D00
TaWaxy-AD00
Total 13.33
ABENG-Wx2.5TaWaxy-A6258.06
TaWaxy-D23.23
TaWaxy-AD23.23
Total 69.68
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, W.; Huang, P.; Dai, W.; Tang, H.; Qiu, Y.; Chang, Y.; Han, Z.; Li, X.; Du, L.; Ye, X.; et al. Application of Nicotinamide to Culture Medium Improves the Efficiency of Genome Editing in Hexaploid Wheat. Int. J. Mol. Sci. 2023, 24, 4416. https://doi.org/10.3390/ijms24054416

AMA Style

Wang W, Huang P, Dai W, Tang H, Qiu Y, Chang Y, Han Z, Li X, Du L, Ye X, et al. Application of Nicotinamide to Culture Medium Improves the Efficiency of Genome Editing in Hexaploid Wheat. International Journal of Molecular Sciences. 2023; 24(5):4416. https://doi.org/10.3390/ijms24054416

Chicago/Turabian Style

Wang, Wanxin, Peipei Huang, Wenshuang Dai, Huali Tang, Yuliang Qiu, Yanan Chang, Zhiyang Han, Xi Li, Lipu Du, Xingguo Ye, and et al. 2023. "Application of Nicotinamide to Culture Medium Improves the Efficiency of Genome Editing in Hexaploid Wheat" International Journal of Molecular Sciences 24, no. 5: 4416. https://doi.org/10.3390/ijms24054416

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop