Next Article in Journal
Comparative Study of the Effect of Doping ZnTiO3 with Rare Earths (La and Ce) on the Adsorption and Photodegradation of Cyanide in Aqueous Systems
Previous Article in Journal
The Role of Cytoskeleton Protein 4.1 in Immunotherapy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 4
10.3390/ijms24043778
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Two Single Nucleotide Polymorphisms in the Von Hippel-Lindau Tumor Suppressor Gene in Patients with Clear Cell Renal Cell Carcinoma

by
Magdalena Chrabańska
1,*,
Nikola Szweda-Gandor
2 and
Bogna Drozdzowska
1
1
Department and Chair of Pathomorphology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia, 40-055 Katowice, Poland
2
Department and Clinic of Internal Medicine, Diabetology and Nephrology, Medical University of Silesia, 41-800 Zabrze, Poland
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(4), 3778; https://doi.org/10.3390/ijms24043778
Submission received: 21 January 2023 / Revised: 6 February 2023 / Accepted: 8 February 2023 / Published: 14 February 2023
(This article belongs to the Section Molecular Oncology)
Browse Figure
Review Reports Versions Notes

Abstract

:
The most common subtype of renal cell carcinoma (RCC) is clear cell type (ccRCC), which accounts for approximately 75% of cases. von Hippel-Lindau (VHL) gene has been shown to be affected in more than half of ccRCC cases. Two single nucleotide polymorphisms (SNPs) located in VHL gene, rs779805 and rs1642742, are reported to be involved in the occurrence of ccRCC. The aim of this study was to assess their associations with clinicopathologic and immunohistochemical parameters, as well as risk and survival of ccRCC. The study population consisted of 129 patients. No significant differences in genotype or allele frequencies of VHL gene polymorphisms were observed between ccRCC cases and control population, and we have found that our results do not indicate a significant relationship of these SNPs with respect to ccRCC susceptibility. Additionally, we did not observe a significant association of these two SNPs with ccRCC survival. However, our results conclude that rs1642742 and rs779805 in the VHL gene are associated with increased tumor size, which is the most important prognostic indicator of renal cancer. Moreover, our analysis showed that patients with genotype AA of rs1642742 have a trend towards higher likelihood of developing ccRCC within their lifetime, while allele G of rs779805 can have a preventive effect against the development of renal cancer in stage 1. Therefore, these SNPs in VHL may be useful as genetic tumor markers for the molecular diagnostics for ccRCC patients.

Graphical Abstract

1. Introduction

Renal cell carcinoma (RCC) is the predominant form of malignancy of the kidney and accounts for about 85% of all renal cancers [1,2,3]. The most common histological subtype of RCC is clear cell renal cell carcinoma (ccRCC) [2,4]. Despite recent advances in the diagnosis and treatment of RCC, it remains a tumor of unpredictable presentation and clinical outcome. The clinical outcomes of RCC differ widely, indicating the need for appropriate and accurate prognostic parameters. At present, prediction of RCC prognosis largely depends on the conventional prognostic factors such as histological features, nuclear grade, and TNM staging system [1,2,5,6]. In addition to clinicopathological prognostic features, several immunohistochemical markers, such as CD44, MMP-2, and MMP-9, have been investigated as potential prognosticators for ccRCC [7,8,9]. CD44 is a multifunctional class I transmembrane protein which binds to the extracellular matrix (primarily to hyaluronic acid). It is involved in the cancer cell aggregation, migration, activation and metastasis. CD44 has recently been introduced as a cancer stem cell marker in various types of cancers, including renal cell carcinoma. Overexpression of CD44 has been linked to tumor progression, recurrence, metastasis and resistance to the chemotherapeutic agents [7,8], whereas matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that are collectively capable of degrading most components of the basement membrane and extracellular matrix, facilitating cell migration. In particular, the ability to degrade type IV collagen, the major component of the basement membrane, is unique to MMP-2 and MMP-9. A significant correlation between increased MMPs and poor prognosis, including shortened patient survival, has been documented in many neoplasms, including renal cancer [9]. However, these parameters are not enough to significantly enhance patient management strategies. Therefore, in light of novel therapy choices, other novel prognostic parameters including genetic variations are needed to accurately predict the survival of ccRCC patients. Recently, some studies showed that genetic polymorphisms of candidate genes are associated with susceptibility and/or prognosis in patients with RCC [6,10,11,12,13]. Considering the important role of von Hippel–Lindau (VHL)/hypoxia-inducible factor 1 subunit alpha (HIF1α) pathway in stimulating angiogenesis, inducing tumor cell proliferation, invasion, and metastasis in ccRCC, it is possible that polymorphic variations in the Von Hippel-Lindau gene (VHL) may have an influence on the susceptibility or prediction of ccRCC [6]. The VHL tumor suppressor gene is located on the short arm of chromosome 3 mapped to 3p25-3p26 and comprises 639 nucleotides in 3 exons encoding 213 amino acids [14,15,16]. The VHL gene product (pVHL) has been investigated as a multi-adaptor protein, interacting with many different binding partners. Its best described function is to target other proteins for ubiquitination and proteasomal degradation as a component of an E3 ubiquitin protein ligase. Among its targets are the HIF subunits 1α and 2α (HIF1α and HIF2α), which upregulate many genes important in metastatic processes [17,18,19,20,21,22]. Under standard oxygen conditions, the VHL protein forms a complex with elongin B, elongin C, and cullin 2 which targets hydroxylated HIF1α for ubiquitin-mediated degradation. Under hypoxic conditions, the VHL complex cannot bind HIF1α for degradation. Therefore, HIF1α accumulates, which results in transcription of additional genes that facilitate oxygen delivery, cellular adaptation to oxygen dedecline, and angiogenesis [23,24,25]. In addition to destabilizing effect of pVHL on HIF1/2α, it is also involved in the recruitment of many effector proteins to regulate a variety of cellular processes including microtubule stability, activation of p53, neuronal apoptosis, cellular senescence and aneuploidy, ubiquitination of RNA polymerase II and regulation of NFkB activity [26]. More than half of ccRCC cases are associated with either VHL gene mutations or transcriptional repression with promoter and first exon regions hypermethylation [13,14]. In existing literature, two single nucleotide polymorphisms (SNPs), rs779805 and rs1642742 involving both A and G, located in the promoter and 3′ untranslated regions of the VHL gene are reported to be involved in the occurrence of ccRCC [6,14,26,27,28].
The aim of this study was to clarify the influence of these SNPs in VHL on ccRCC risk and survival. Moreover, we assessed their associations with clinicopathologic parameters and immunohistochemical expression of CD44, MMP-2, and MMP-9 in ccRCC cases.

2. Results

2.1. General Characteristics of Patients

A total of 129 patients with ccRCC were included in the study. The mean age of the patients was 63 years (SD = 10.7), ranging from 34 to 85 years. Tumor size ranged from 1 to 18 cm at the largest diameter. The mean duration of follow-up was 71.7 months (SD = 11.4), with a median of 72.7 months. The clinicopathological characteristics of patients are provided in Table 1.

2.2. Immunohistochemical Staining

A total of 129 ccRCC cases were analyzed immunohistochemically for CD44, MMP-2, and MMP-9 expression in the neoplastic cells. In the case of CD44 expression, 58 (44.9%) samples were negative, while upregulation of CD44 molecule was found in 71 (55.1%) cases. Of all samples stained, 121 (93.8%) and 118 (91.7%) did not show any staining for MMP-2 and MMP-9, respectively. Distributions of CD44, MMP-2, and MMP-9 expression based on overall immunohistochemical score are presented in Table 2.

2.3. Genotype and Allele Frequencies of VHL Polymorphisms in the ccRCC and Control European Population

Allele frequencies and genotype distributions of VHL polymorphisms in patients and control populations are shown in Table 3. All information about control population came from the Ensembl database https://www.ensembl.org/index.html (accessed on 5 January 2023). The control population consisted of the European (northern and western) population. All observed genotype frequencies in both controls and patients conform to the Hardy–Weinberg equilibrium. Comparing the study and control groups, our analysis showed a shift in the genotype frequency values for rs1642742. It may be related to either the different size of the subgroups or may be associated with clinical context. In the future, we will try to expand the research to explain these discrepancies in genotype frequency values. Such an investigation may result in a very interesting prognostic study for RCC patients and their families.

2.4. Effects of VHL Polymorphisms on Clinicopathological Characteristics of ccRCC Patients

Borderline statistically significant p-values were observed when assessing the association between the evaluated SNPs (rs1642742 and rs779805 in the VHL tumor suppressor gene) and increased tumor size. The associations of VHL polymorphisms with tumor diameter are shown in Table 4.
Table 5 shows the associations of VHL polymorphisms with pathologic tumor (T) stage of ccRCC. Our analysis showed that patients with genotype AA of rs1642742 have a trend towards higher likelihood of developing ccRCC within their lifetime, while allele G of rs779805 can have a preventive effect against the development of renal cancer in stage 1.
There were no significant associations between the evaluated SNPs and patient gender, patient age, tumor grade, presence of tumor necrosis, presence of sarcomatoid and rhabdoid differentiation, presence of fibrous renal capsule invasion, presence of perinephric fat invasion, presence of renal sinus fat invasion, or presence of vascular invasion of renal sinus vessels.

2.5. Associations of the VHL Polymorphisms with CD44, MMP-2 and MMP-9 Expression in ccRCC Tumors

We found no significant associations between the evaluated SNPs and CD44, MMP-2 and MMP-9 expression in ccRCC tumors. The associations of VHL polymorphisms with CD44, MMP-2 and MMP-9 expression levels are shown in Table 6.

2.6. Effects of VHL Polymorphisms on ccRCC Overall Survival

Statistical analysis was used to assess the associations between genotypes of the two SNPs in VHL and survival of patients with ccRCC. As shown in Table 7, we did not observe a significant association of each allele and genotype of these two SNPs with survival of ccRCC.

3. Discussion

Renal cell carcinoma has the highest mortality rate of the genitourinary cancers and the incidence of this neoplasm has risen continuously. If detected early, the cancer is curable by surgical excision of the tumor, although a minority are at risk of recurrence. RCC is a heterogeneous group of neoplasms and comprises several histological subtypes with different genetics, biology and behavior. The most common histological type is ccRCC, which represents 75–80% of all RCC [29]. The etiology of most cases of ccRCC is still not fully understood. Cigarette smoking, obesity, hypertension and/or related medications have been implicated as risk factors, although the increase in risk is relatively inconspicuous [30]. More than 96% of ccRCC are sporadic tumors [31]. Chromosome 3p deletion and inactivation of the VHL suppressor gene is the most common genetic alteration. Inactivation of VHL is specific to ccRCC and is not found in other histological subtypes of RCC. Some would argue that alteration of VHL is the initiating event in most sporadic cases of this neoplasm, because VHL inactivation is so common in sporadic ccRCC and, in cases where ccRCC shows only one chromosomal loss, it is consistently 3p [29]. Approximately 66% of sporadic ccRCC have biallelic inactivation of VHL, and about 10–15% have promoter hypermethylation associated with transcriptional inactivation. Loss of heterozygosity (LOH) of 3p including the VHL gene locus is present in 87% of ccRCC, while homozygous deletion and rearrangement account for further cases of biallelic inactivation [32,33]. The protein encoded by the VHL gene is a component of the elongin complex and is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a main role in the regulation of gene expression by oxygen. VHL inactivation in ccRCC leads to the activation of the hypoxia pathway via HIF1α and HIF2α, which sequentially activates expression of genes involved in the hypoxia response and angiogenesis [33,34].
Two SNPs, rs779805 and rs1642742 involving both A and G and located in the VHL gene, are informative and implicated in the occurrence of ccRCC [6,14,35,36,37]. Therefore, in the present study, we investigated the associations of these polymorphisms with risk, clinicopathological characteristics, CD44, MMP-2, and MMP-9 immunoreactivity and survival of ccRCC. We could not find any significant difference in the VHL genotype and allele frequency between ccRCC patients and a control population, which may suggest that these VHL polymorphisms are not associated with the onset of RCC, however further studies with a larger sample size are needed to clarify this phenomenon. These results are consistent with those obtained by Qin et al. [6], who studied polymorphic variations in HIF1A and VHL (including rs779805) in 518 cases of ccRCC and by Bensouilah et al. [38] who investigated the role of fourteen SNPs in the different genes including rs779805 and rs1642742 in VHL in 54 patients with ccRCC. On the other hand, Wang et al. [14] found that rs1642742 is a more sensitive risk factor for sporadic RCC than rs779805, however they investigated these two SNPs in only 19 cases of RCC, and such a small sample size may not be enough to make broad generalizations. It should also be noted that studies cited above [6,14,38] were conducted on East Asian and North African populations, which could account for the differences compared to our study conducted on a Central European population. Moreover, Wang et al. [39] reported that the G allelic frequencies in both rs779805 and rs1642742 of VHL gene in healthy subjects from Taiwan are much lower than in the European population. Thus, the differences between different populations may also apply to the ccRCC cases.
In some research [14,39] a positive correlation between RCC and G variant has been indicated, suggesting that GG homozygote is a lethal genetic mutation causing early cell death before clinical cancer can develop, and results in the lack of GG homozygote in the RCC patients in Asian population. This means that, if the G allele carriage at rs779805 and rs1642742 or AG heterozygote frequency increases, susceptibility to RCC increases. However, further studies with a larger sample size are needed to verify this hypothesis.
Some authors have tried to assess the clinicopathological characteristics in relation to polymorphic variations in VHL gene in patients with RCC. On multivariate analysis, Wang et al. [14] found that age and gender were factors in the genotype distributions of both rs779805 and rs1642742, however adjustment for tumor stage did not significantly affect the genotype distributions. Qin et al. [6] studied VHL polymorphic variations in rs779805 in VHL and in 3 SNPs in HIF1A (rs11549465, rs11549467, and rs2057482) and observed no significant associations between the evaluated genotypes in VHL gene and primary tumor stage, distant metastasis, tumor size or tumor grade. However, in combined analysis, patients with ≥2 variant alleles of these four polymorphisms were significantly less likely to present with lymph node metastasis, and significantly more likely to present with a localized clinical stage. On the contrary, borderline p-values (p = 0.048 and p = 0.05) were observed in our study when assessing the association between the evaluated SNPs and increased tumor size.
Several studies have reported that VHL alternations may have effects on the prognosis of RCC with inconclusive results. However, it has been suggested that the most useful role for VHL mutational status may be in combination with other potential biomarkers, such as VEGF polymorphisms [40,41,42,43,44]. Qin et al. [6] also investigated the associations between the genotypes of rs779805 in VHL and survival of patients with renal cancer, but they observed no significant associations between the evaluated SNP and patients’ survival. However, they found that variant alleles (≥1 vs. 0) of the four polymorphisms in VHL and HIF1A genes were an independent risk factor for RCC survival.
Our study has some limitations. First, it was conducted on relatively small group of patients and may not have enough statistical power to show significant associations. A subsequent limitation concerned the limited amount of prior research on this topic. Available research was performed on different ethnic groups and, in some cases, on a very small group of subjects, which may result in some discrepancies. Overall, we consider this research to be relatively preliminary and plan further studies with larger number of patients.

4. Materials and Methods

The standard methodology of this study was reported according to “Strengthening the Reporting of Observational Studies in Epidemiology” (STROBE) guidelines [45]. The protocol of this study was approved by the Institutional Review Board of Medical University of Silesia, Katowice, Poland (PCN/CBN/0052/KB/243/22). Patient data were kept fully anonymous in all steps.

4.1. Patient Characteristics and Tumor Samples

The population study consisted of 129 patients from Upper Silesia in Poland with histologically confirmed ccRCC. Cases with other histological RCC subtypes were not included in this study. All tumor specimens had been obtained during partial or radical nephrectomy for sporadic RCC between January 2015 and January 2020. In all cases the submitted surgical specimens were handled according to the current guidelines of the Polish Society of Pathologists and complied with the recommendations of the ISUP and the WHO for specimen handling, sampling and reporting [46,47]. The tissue specimens were formalin-fixed and paraffin-embedded using a routine pathological tissue processing technique. All sections were then assessed for: tumor size, WHO/ISUP grade, presence and percentage of necrosis, sarcomatoid and rhabdoid differentiation, small vessel lymphovascular invasion, fibrous renal capsule invasion, perinephric fat invasion, renal sinus fat and vascular invasion of renal sinus vessels, and AJCC TNM pathologic stage of the primary tumor (pT). Follow-up data included: date of nephrectomy, survival status, date of death, and/or date of last follow-up. The hematoxylin- and eosin-stained slides from all cases were reviewed by two pathologists who assigned both a WHO/ISUP grade and eighth edition of the American Joint Committee on Cancer (AJCC) TNM pathological staging category [48].

4.2. Immunohistochemical Staining and Its Evaluation

For each case, a representative slide of the tumor and the corresponding paraffin block were selected. The immunohistochemical staining was performed in an automated immunostainer according to the manufacturer’s instructions (Table 8), and the same methodology which was used and described in detail in our previous study on non-clear cell RCCs [49].
The staining results were independently examined by two pathologists, who were completely blinded for medical and pathological data of patients. Semi-quantitative analysis was performed to evaluate the CD44, MMP-2, and MMP-9 expression. The modified Allred et al. method was used to evaluate both the intensity and the proportion of immunohistochemical staining [49,50]. The intensity scores ranged from negative to strong as follows: 0 = negative, 1 = weak, 2 = moderate, and 3 = strong. The proportion scores ranged from 0 to 5 and were categorized according to the positive tumor cells as follows: 0 = no staining, 1 = up to 1/100 positive cells, 2 = 1/100 to 1/10 positive cells, 3 = 1/10 to 1/3 positive cells, 4 = 1/3 to 2/3 positive cells, 5 = >2/3 positive cells. To calculate the total immunohistochemical score, the proportion and intensity scores were multiplied for each specimen (range from 0 to 15) [51]. Then, overall immunohistochemical scores were classified into three groups as follows: 0–5 as Group 1 (low expression), 6–10 as Group 2 (moderate expression) and 11–15 as Group 3 (high expression).

4.3. SNP Selection

Based on previous reports and bioinformatics database http://www.ncbi.nlm.nih.gov/snp/ (accessed on 5 January 2023) two SNP loci rs1642742 and rs779805 in the gene VHL were selected. In order to perform the necessary genetic tests, MagCore Genomic DNA FFPE One-Step kit of the MagCore isolation system (FFPE One-Step kit of the MagCore RBC Bioscience Corp New Taipei City Taiwan) was used; this material was later used for genetic studies (allelic discrimination of two polymorphisms of gene VHL). Following primers according to probe manufacturer TaqMan Thermo Fisher Scientific were used: VLH rs1642742 Context Sequence [VIC/FAM]GGACAGCTTGTATGTAAGGAGGTTT[A/G]TATAAGTAATTCAGTGGGAATTGCA and VLH rs779805 Context Sequence [VIC/FAM]GGCCTAGCCTCGCCTCCGTTACAAC[A/G]GCCTACGGTGCTGGAGGATCCTTCT.

4.4. DNA Extraction and Genotyping

DNA was extracted from all samples using MagCore Genomic DNA FFPE One-Step Kit for DNA isolation, and the genotype was identified via ROCHE LifeCycler 96 (ROCHE LifeCycler 96 Basel, Switzerland). Real-time fluorescent quantitative polymerase chain reaction (PCR) was done using TaqMan genotyping method (TaqMan Thermo Fisher Scientific Waltham, Massachusetts, United States) allelic discrimination to identify specific assays. One blank control (MQ) was placed for marking each time in each 96-well detection unit as the quality control. Two genotypes and their frequency for each tumor case were determined.

4.5. Statistical Analysis

The statistical software STATISTICA 13.1 (StatSoft Inc., Tulsa, OK, USA) and Microsoft Excel 2013 (Microsoft Corporation, Redmond, WA, USA) was used to perform all analysis. Quantitative data are presented as numbers, case percentage, mean and standard deviation (SD). The study population complies with the Hardy-Weinberg law, which assumes that in a theoretically described population, genes do not mutate from one allele to another, nor do new alleles arise, because by definition this changes their frequencies. The genotype distribution was compared between groups using the χ2 test with Yates correction. A p-value less than 0.05 was considered to be statistically significant.

5. Conclusions

To the best of our knowledge, this is the first research investigating the influence of rs1642742 and rs779805 in the VHL tumor suppressor gene on ccRCC risk and survival among Central European population. The results of our study can be used to indicate genetic diversity for the VHL gene in the local population.
In summary, no significant differences in genotype or allele frequencies of VHL gene polymorphisms were observed between ccRCC cases and control population in our study, and we have proposed this study to be negative with respect to ccRCC susceptibility. Additionally, we did not observe a significant association of each allele and genotype of these two SNPs with survival of patients with ccRCC. However, our results conclude that rs1642742 and rs779805 in the VHL tumor suppressor gene are associated with increased tumor size, which is the most important prognostic indicator of renal cancer. Moreover, our analysis showed that patients with genotype AA of rs1642742 have a trend towards higher likelihood of developing ccRCC within their lifetime, while allele G of rs779805 can have a preventive effect against the development of renal cancer in stage 1. Therefore, these SNPs in VHL may be useful as genetic tumor markers for the molecular diagnostics and for facilitating the development of new treatments for ccRCC patients. However, further comprehensive and detailed studies with larger sample sizes are warranted to determine the clinical relevance of the association of these two VHL SNPs with ccRCC.

Author Contributions

Conceptualization, M.C. and N.S.-G.; methodology, M.C. and N.S.-G.; software, N.S.-G.; validation, M.C. and N.S.-G.; formal analysis, M.C. and N.S.-G.; investigation, M.C. and N.S.-G.; resources, M.C. and N.S.-G.; data curation, M.C. and N.S.-G.; writing—original draft preparation, M.C.; writing—review and editing, N.S.-G. and B.D.; visualization, M.C. and N.S.-G.; supervision, B.D.; project administration, M.C. and B.D.; funding acquisition, M.C. and B.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Medical University of Silesia, grant number KNW-1-168/N/9/0. The APC was funded by Medical University of Silesia.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board of Medical University of Silesia (protocol code PCN/CBN/0052/KB/243/22).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not Applicable.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Costa, W.H.; Rocha, R.M.; Cunha, I.W.; Guimaraes, G.C.; Zequi, S.C. Immunohistochemical expression of CD44s in renal cell carcinoma lacks independent prognostic significance. Int. Braz. J. Urol. 2012, 38, 456–465. [Google Scholar] [CrossRef] [PubMed]
  2. Gayyed, M.; Soliman, M.; El-Hussieny, M. Clinical utility of MCM2 and CD44 expression in clear cell renal cell carcinoma. Pol. J. Pathol. 2020, 71, 339–346. [Google Scholar] [CrossRef]
  3. Li, X.; Ma, X.; Chen, L.; Gu, L.; Zhang, Y.; Zhang, F.; Ouyang, Y.; Gao, Y.; Huang, Q.; Zhang, X.; et al. Prognostic value of CD44 expression in renal cell carcinoma: A systematic review and meta-analysis. Sci. Rep. 2015, 5, 13157. [Google Scholar] [CrossRef] [PubMed]
  4. Ma, C.; Komohara, Y.; Ohnishi, K.; Shimoji, T.; Kuwahara, N.; Sakumura, Y.; Matsuishi, K.; Fujiwara, Y.; Motoshima, T.; Takahashi, W. Infiltration of tumor-associated macrophages is involved in CD44 expression in clear cell renal cell carcinoma. Cancer Sci. 2016, 107, 700–707. [Google Scholar] [CrossRef] [PubMed]
  5. Kim, S.P.; Alt, A.L.; Weight, C.J.; Costello, B.A.; Cheville, J.C.; Lohse, C.; Allmer, C.; Leibovich, B.C. Independent validation of the 2010 American Joint Committee on Cancer TNM classification for renal cell carcinoma: Results from a large, single institution cohort. J. Urol. 2011, 185, 2035–2039. [Google Scholar] [CrossRef] [PubMed]
  6. Qin, C.; Cao, Q.; Ju, X.; Wang, M.; Meng, X.; Zhu, J.; Yan, F.; Li, P.; Ding, Q.; Chen, J.; et al. The polymorphisms in the VHL and HIF1A genes are associated with the prognosis but not the development of renal cell carcinoma. Ann. Oncol. 2012, 2, 981–989. [Google Scholar] [CrossRef] [PubMed]
  7. Jeong, B.J.; Liang, Z.L.; Huang, S.M.; Lim, J.S.; Kim, J.M.; Lee, H.J. CD44 is associated with tumor recurrence and is an independent poor prognostic factor for patients with localized clear cell renal cell carcinoma after nephrectomy. Exp. Ther. Med. 2012, 3, 811–817. [Google Scholar] [CrossRef] [PubMed]
  8. Zanjani, L.S.; Madjd, Z.; Abolhasani, M.; Rasti, A.; Fodstad, O.; Andersson, Y.; Asgari, M. Increased expression of CD44 is associated with more aggressive behavior in clear cell renal cell carcinoma. Biomark Med. 2018, 12, 45–61. [Google Scholar] [CrossRef] [PubMed]
  9. Kallakury, B.V.; Karikehalli, S.; Haholu, A.; Sheehan, C.E.; Azumi, N.; Ross, J.S. Increased expression of matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinases 1 and 2 correlate with poor prognostic variables in renal cell carcinoma. Clin. Cancer Res. 2001, 7, 3113–3119. [Google Scholar]
  10. Kawai, Y.; Sakano, S.; Korenaga, Y.; Eguchi, S.; Naito, K. Associations of single nucleotide polymorphisms in the vascular endothelial growth factor gene with the characteristics and prognosis of renal cell carcinomas. Eur. Urol. 2007, 52, 1147–1155. [Google Scholar] [CrossRef] [PubMed]
  11. Hirata, H.; Hinoda, Y.; Nakajima, K.; Kikuno, N.; Suehiro, Y.; Tabatabai, Z.L.; Ishii, N.; Dahiya, R. The bcl2 -938CC genotype has poor prognosis and lower survival in renal cancer. J. Urol. 2009, 182, 721–727. [Google Scholar] [CrossRef] [PubMed]
  12. Hirata, H.; Hinoda, Y.; Kikuno, N.; Kawamoto, K.; Suehiro, Y.; Tanaka, Y.; Dahiya, R. MDM2 SNP309 polymorphism as risk factor for susceptibility and poor prognosis in renal cell carcinoma. Clin. Cancer Res. 2007, 13, 4123–4129. [Google Scholar] [CrossRef] [PubMed]
  13. Kleinrath, T.; Gassner, C.; Lackner, P.; Thurnher, M.; Ramoner, R. Interleukin-4 promoter polymorphisms: A genetic prognostic factor for survival in metastatic renal cell carcinoma. J. Clin. Oncol. 2007, 25, 845–851. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, W.C.; Tsou, M.H.; Chen, H.J.; Hsu, W.F.; Lai, Y.C. Two single nucleotide polymorphisms in the von Hippel-Lindau tumor suppressor gene in Taiwanese with renal cell carcinoma. BMC Res. Notes 2014, 7, 638. [Google Scholar] [CrossRef]
  15. Gnarra, J.R.; Tory, K.; Weng, Y.; Schmidt, L.; Wei, M.H.; Li, H.; Latif, F.; Liu, S.; Chen, F.; Duh, F.M.; et al. Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat. Genet. 1994, 7, 85–90. [Google Scholar] [CrossRef]
  16. Latif, F.; Tory, K.; Gnarra, J.; Yao, M.; Duh, F.M.; Orcutt, M.L.; Stackhouse, T.; Kuzmin, I.; Modi, W.; Geil, L.; et al. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 1993, 260, 1317–1320. [Google Scholar] [CrossRef]
  17. Razafinjatovo, C.; Bihr, S.; Mischo, A.; Vogl, U.; Schmidinger, M.; Moch, H.; Schraml, P. Characterization of VHL missense mutations in sporadic clear cell renal cell carcinoma: Hotspots, affected binding domains, functional impact on pVHL and therapeutic relevance. BMC Cancer 2016, 16, 638. [Google Scholar] [CrossRef]
  18. Leonardi, E.; Murgia, A.; Tosatto, S.C. Adding structural information to the von Hippel-Lindau (VHL) tumor suppressor interaction network. FEBS Lett. 2009, 583, 3704–3710. [Google Scholar] [CrossRef]
  19. Kamura, T.; Koepp, D.M.; Conrad, M.N.; Skowyra, D.; Moreland, R.J.; Iliopoulos, O.; Lane, W.S.; Kaelin, W.G., Jr.; Elledge, S.J.; Conaway, R.C. Rbx1, a Component of the VHL Tumor Suppressor Complex and SCF Ubiquitin Ligase. Science 1999, 284, 657–661. [Google Scholar] [CrossRef]
  20. Iwai, K.; Yamanaka, K.; Kamura, T.; Minato, N.; Conaway, R.C.; Conaway, J.W.; Klausner, R.D.; Pause, A. Identification of the von Hippel-lindau tumor-suppressor protein as part of an active E3 ubiquitin ligase complex. Proc. Natl. Acad. Sci. USA 1999, 96, 12436–12441. [Google Scholar] [CrossRef]
  21. Shen, C.; Kaelin, W.G., Jr. The VHL/HIF axis in clear cell renal carcinoma. Semin. Cancer Biol. 2013, 23, 18–25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Struckmann, K.; Mertz, K.; Steu, S.; Storz, M.; Staller, P.; Krek, W.; Schraml, P.; Moch, H. pVHL co-ordinately regulates CXCR4/CXCL12 and MMP2/MMP9 expression in human clear-cell renal cell carcinoma. J. Pathol. 2008, 214, 464–471. [Google Scholar] [CrossRef] [PubMed]
  23. Moore, L.E.; Nickerson, M.L.; Brennan, P.; Toro, J.R.; Jaeger, E.; Rinsky, J.; Han, S.S.; Zaridze, D.; Matveev, V.; Janout, V.; et al. Von Hippel-Lindau (VHL) inactivation in sporadic clear cell renal cancer: Associations with germline VHL polymorphisms and etiologic risk factors. PLoS Genet. 2011, 7, e1002312. [Google Scholar] [CrossRef] [PubMed]
  24. Maxwell, P.H.; Wiesener, M.S.; Chang, G.W.; Clifford, S.C.; Vaux, E.C.; Cockman, M.E.; Wykoff, C.C.; Pugh, C.W.; Maher, E.R.; Ratcliffe, P.J. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 1991, 399, 271–275. [Google Scholar] [CrossRef]
  25. Kaelin, W.G., Jr. Molecular basis of the VHL heteditary cancer syndropme. Nat. Rev. Cancer 2002, 2, 673–682. [Google Scholar] [CrossRef]
  26. Frew, I.J.; Moch, H. A clearer view of the molecular complexity of clear cell renal cell carcinoma. Annu. Rev. Pathol. 2015, 10, 263–289. [Google Scholar] [CrossRef]
  27. Herman, J.G.; Latif, F.; Weng, Y.; Lerman, M.I.; Zbar, B.; Liu, S.; Samid, D.; Duan, D.S.; Gnarra, J.R.; Linehan, W.M.; et al. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Natl. Acad. Sci. USA 1994, 91, 9700–9704. [Google Scholar] [CrossRef] [PubMed]
  28. Pause, A.; Lee, S.; Lonergan, K.M.; Klausner, R.D. The von Hippel-Lindau tumor suppressor gene is required for cell cycle exit upon serum withdrawal. Proc. Natl. Acad. Sci. USA 1998, 95, 993–998. [Google Scholar] [CrossRef] [PubMed]
  29. Cairns, P. Renal cell carcinoma. Cancer Biomark. 2011, 9, 461–473. [Google Scholar] [CrossRef] [PubMed]
  30. Dhôte, R.; Pellicer-Coeuret, M.; Thiounn, N.; Debré, B.; Vidal-Trecan, G. Risk factors for adult renal cell carcinoma: A systematic review and implications for prevention. BJU Int. 2000, 86, 20–27. [Google Scholar] [CrossRef] [PubMed]
  31. Pavlovich, C.P.; Schmidt, L.S. Searching for the hereditary causes of renal-cell carcinoma. Nat. Rev. Cancer 2004, 4, 381–393. [Google Scholar] [CrossRef]
  32. Dalgliesh, G.L.; Furge, K.; Greenman, C.; Chen, L.; Bignell, G.; Butler, A.; Davies, H.; Edkins, S.; Hardy, C.; Latimer, C.; et al. Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature 2010, 463, 360–363. [Google Scholar] [CrossRef]
  33. Dulaimi, E.; Ibanez de Caceres, I.; Uzzo, R.G.; Al-Saleem, T.; Greenberg, R.E.; Polascik, T.J.; Babb, J.S.; Grizzle, W.E.; Cairns, P. Promoter Hypermethylation Profile of Kidney Cancer. Clin. Cancer Res. 2004, 10, 3972–3979. [Google Scholar] [CrossRef] [PubMed]
  34. Kaelin, W.G., Jr. The von Hippel-Lindau tumor suppressor protein and clear cell renal carcinoma. Clin. Cancer Res. 2007, 13, 680s–684s. [Google Scholar] [CrossRef] [PubMed]
  35. Hamano, K.; Esumi, M.; Igarashi, H.; Chino, K.; Mochida, J.; Ishida, H.; Okada, K. Biallelic inactivation of the von Hippel-Lindau tumor suppressor gene in sporadic renal cell carcinoma. J. Urol. 2002, 167, 713–717. [Google Scholar] [CrossRef]
  36. Liu, N.; Gong, K.; Na, X.; Wu, G.; Na, Y.Q. Analysis of two single nucleotide polymorphisms and loss of heterozygosity detection in the VHL gene in Chinese patients with sporadic renal cell carcinoma. Chin. Med. J. 2005, 118, 1291–1294. [Google Scholar]
  37. Wang, W.C.; Chen, H.J.; Tseng, Y.H.; Lai, Y.C. Identification of somatic mutations in the von Hippel-Lindau (VHL) gene in a Taiwanese patient with renal cell carcinoma. J. Formos. Med. Assoc. 2009, 108, 886–893. [Google Scholar] [CrossRef] [PubMed]
  38. Bensouilah, F.Z.; Chellat-Rezgoune, D.; Garcia-Gonzalez, M.A.; Carrera, N.; Abadi, N.; Dahdouh, A.; Satta, D. Association of single nucleotide polymorphisms with renal cell carcinoma in Algerian population. Afr. J. Urol. 2020, 26, 48. [Google Scholar] [CrossRef]
  39. Wang, W.C.; Chen, H.J.; Shu, W.P.; Tsai, Y.C.; Lai, Y.C. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population. J. Formos. Med. Assoc. 2011, 110, 646–651. [Google Scholar] [CrossRef]
  40. Brauch, H.; Weirich, G.; Brieger, J.; Glavac, D.; Rödl, H.; Eichinger, M.; Feurer, M.; Weidt, E.; Puranakanitstha, C.; Neuhaus, C.; et al. VHL alterations in human clear cell renal cell carcinoma: Association with advanced tumor stage and a novel hot spot mutation. Cancer Res. 2000, 60, 1942–1948. [Google Scholar]
  41. Schraml, P.; Struckmann, K.; Hatz, F.; Sonnet, S.; Kully, C.; Gasser, T.; Sauter, G.; Mihatsch, M.J.; Moch, H. VHL mutations and their correlation with tumour cell proliferation, microvessel density, and patient prognosis in clear cell renal cell carcinoma. J. Pathol. 2002, 196, 186–193. [Google Scholar] [CrossRef] [PubMed]
  42. Yao, M.; Yoshida, M.; Kishida, T.; Nakaigawa, N.; Baba, M.; Kobayashi, K.; Miura, T.; Moriyama, M.; Nagashima, Y.; Nakatani, Y.; et al. VHL tumor suppressor gene alterations associated with good prognosis in sporadic clear-cell renal carcinoma. J. Natl. Cancer Inst. 2002, 94, 1569–1575. [Google Scholar] [CrossRef] [PubMed]
  43. Cowey, C.L.; Rathmell, W.K. VHL gene mutations in renal cell carcinoma: Role as a biomarker of disease outcome and drug efficacy. Curr. Oncol. Rep. 2009, 11, 94–101. [Google Scholar] [CrossRef] [PubMed]
  44. Gossage, L.; Eisen, T. Alterations in VHL as potential biomarkers in renal-cell carcinoma. Nat. Rev. Clin. Oncol. 2010, 7, 277–288. [Google Scholar] [CrossRef]
  45. Cuschieri, S. The STROBE guidelines. Saudi J. Anaesth. 2019, 13, S31–S34. [Google Scholar] [CrossRef]
  46. Delahunt, B.; Cheville, J.C.; Martignoni, G.; Humphrey, P.A.; Magi-Galluzzi, C.; McKenney, J.; Egevad, L.; Algaba, F.; Moch, H.; Grignon, D.J.; et al. The international society of urological pathology (ISUP) grading system for renal cell carcinoma and other prognostic parameters. Am. J. Surg. Pathol. 2013, 37, 1490–1504. [Google Scholar] [CrossRef]
  47. Moch, H.; Amin, M.B.; Berney, D.M.; Compérat, E.M.; Gill, A.J.; Hartmann, A.; Menon, S.; Raspollini, M.R.; Rubin, M.A.; Srigley, J.R.; et al. The 2022 World Health Organization Classification of Tumours of the Urinary System and Male Genital Organs-Part A: Renal, Penile, and Testicular Tumours. Eur. Urol. 2022, 82, 458–468. [Google Scholar] [CrossRef]
  48. Amin, M.B.; Edge, S.; Greene, F.; Byrd, D.R.; Brookland, R.K.; Washington, M.K.; Gershenwald, J.E.; Compton, C.C.; Hess, K.R.; Daniel, C. AJCC Cancer Staging Manual, 8th ed.; Springer: New York, NY, USA, 2016. [Google Scholar]
  49. Chrabańska, M.; Rynkiewicz, M.; Kiczmer, P.; Drozdzowska, B. Immunohistochemical Expression of CD44, MMP-2, MMP-9, and Ki-67 as the Prognostic Markers in Non-Clear Cell Renal Cell Carcinomas—A Prospective Cohort Study. J. Clin. Med. 2022, 11, 5196. [Google Scholar] [CrossRef]
  50. Allred, D.C.; Harvey, J.M.; Berardo, M.; Clark, G.M. Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Mod. Pathol. 1998, 11, 155–168. [Google Scholar]
  51. Eun, H.S.; Cho, S.Y.; Lee, B.S.; Kim, S.; Song, I.S.; Chun, K.; Oh, C.H.; Yeo, M.K.; Kim, S.H.; Kim, K.H. Cytochrome P450 4A11 expression in tumor cells: A favorable prognostic factor for hepatocellular carcinoma patients. J. Gastroenterol. Hepatol. 2019, 34, 224–233. [Google Scholar] [CrossRef] [Green Version]
Table
Table 1. Clinicopathological characteristics of patients.
Table 1. Clinicopathological characteristics of patients.
Clinicopathological Features
Number of cases [n (%)]129 (100%)
Age, years [mean ± SD]63 ± 10.7
Gender [n (%)]
Female53 (41.1%)
Male76 (58.9%)
Type of operation [n (%)]
Radical nephrectomy78 (60.5%)
Partial nephrectomy (NSS)51 (39.5%)
Tumor location [n (%)]
Right kidney71 (55.1%)
Left kidney58 (44.9%)
Tumor size, cm (mean ± SD)5.7 ± 3.4
Tumor stage [n (%)]
pT175 (58.1%)
pT29 (6.9%)
pT344 (34.1%)
pT41 (0.9%)
WHO/ISUP grading [n (%)]
G158 (44.9%)
G247 (36.4%)
G313 (10.2%)
G411 (8.5%)
Tumor necrosis area % (mean ± SD)5.7 ± 1.8
Sarcomatoid area % (mean ± SD)10.2 ± 2.86
Angioinvasion present [n (%)]27 (20.9%)
Renal fibrous capsule invasion present [n (%)]73 (56.6%)
Perinephric fat invasion present [n (%)]21 (16.3%)
Renal sinus fat invasion present [n (%)]23 (17.8%)
Renal sinus vascular invasion present [n (%)]18 (14.0%)
Dead [n (%)]48 (37.2%)
Table
Table 2. CD44, MMP-2 and MMP-9 immunoreactivity of clear cell renal cell carcinoma cases.
Table 2. CD44, MMP-2 and MMP-9 immunoreactivity of clear cell renal cell carcinoma cases.
Overall Immunohistochemical ScoreCD44MMP-2MMP-9
Group 1 (low expression) [n (%)]93 (72.1%)127 (98.4%)127 (98.4%)
Group 2 (moderate expression) [n (%)]24 (18.6%)2 (1.6%) 1 (0.8%)
Group 3 (high expression) [n (%)]12 (9.3%)0 (0%)1 (0.8%)
Table
Table 3. Genotype and allele frequencies of VHL polymorphisms among the ccRCC cases and control population.
Table 3. Genotype and allele frequencies of VHL polymorphisms among the ccRCC cases and control population.
Genotypes of rs1642742Cases PopulationDatabase Control Populationp
AA46.6% (n = 60)43.4% (n = 43)NS
AG17.8% (n = 23)48.5% (n = 48)NS
GG35.6% (n = 46)8.1% (n = 8)NS
Alleles of rs1642742Cases populationDatabase control population
A55% (n = 143)68% (n = 134)NS
G45% (n = 115)32% (n = 64)NS
Genotypes of rs779805Cases populationDatabase control population
AA47.2% (n = 61)43.4% (n = 43)NS
AG45.7% (n = 59)48.5% (n = 48)NS
GG7.1% (n = 9)8.1% (n = 8)NS
Alleles of rs779805Cases populationDatabase control population
A71% (n = 181)68% (n = 134)NS
G29% (n = 77)32% (n = 64)NS
NS—not statistically significant.
Table
Table 4. Associations of the VHL polymorphisms with largest diameter of tumor.
Table 4. Associations of the VHL polymorphisms with largest diameter of tumor.
Genotypes of rs1642742Tumor Size Alleles of rs1642742Tumor Size
≤4 cm4–7 cm7–10 cm>10 cmp≤4 cm4–7 cm7–10 cm>10 cmp
AA24.04%13.18%6.20%3.10%NSA28.91%14.50%8.53%3.49%NS
AG7.75%4.65%4.65%0.77%NSG12.40%16.28%7.75%8.14%NS
GG8.53%13.95%5.43%7.75%NS
pNSNSNSp = 0.05 NSNSNSNS
Genotypes of rs779805Tumor size Alleles of rs779805Tumor size
≤4 cm4–7 cm7–10 cm>10 cm ≤4 cm4–7 cm7–10 cm>10 cm
AA24.04%13.95%6.20%3.10%NSA31.04%21.31%10.85%6.97%NS
AG13.95%14.73%9.30%7.75%NSG9.30%10.46%5.42%4.65%NS
GG2.34%3.10%0.77%0.77%NS
pNSNSp = 0.048p = 0.05 NSNSNSNS
NS—not statistically significant.
Table
Table 5. Associations of the VHL polymorphisms with pathologic tumor (T) stage of renal carcinoma.
Table 5. Associations of the VHL polymorphisms with pathologic tumor (T) stage of renal carcinoma.
Genotypes of rs1642742Tumor Stage Alleles of rs1642742Tumor Stage
1234p1234p
AA28.68%3.10%14.73%0%p = 0.047A34.88%3.48%17.05%0%NS
AG12.42%0.77%4.65%0%NSG23.25%3.48%17.05%0.81%NS
GG17.05%3.10%14.73%0.77%NS
pNSNSNSNSNS NSNSNSNS
Genotypes of rs7798051234 Alleles of rs7798051234
AA29.46%3.10%14.73%0%NSA41.86%4.49%23.83%0.38%NS
AG24.82%2.32%17.05%0.77%NSG16.28%1.93%10.85%0.38%NS
GG3.88%1.55%2.32%0%NS
pNSNSNSNS p = 0.05NSNSNS
NS—not statistically significant.
Table
Table 6. Associations of the VHL polymorphisms with CD44, MMP-2 and MMP-9 expression levels.
Table 6. Associations of the VHL polymorphisms with CD44, MMP-2 and MMP-9 expression levels.
Overall Immunohistochemical Score—CD44 Overall Immunohistochemical Score—CD44
Genotypes of rs1642742Group 1Group 2Group 3Alleles of rs1642742Group 1Group 2Group 3
AA34.88%6.20%5.42%A43.02%6.97%5.42%
AG16.28%1.55%0%G29.84%10.85%3.87%
GG21.70%10%3.87%
pNSNSNS NSNSNS
Genotypes of rs779805Group 1Group 2Group 3Alleles of rs779805Group 1Group 2Group 3
AA35.65%6.20%5.42%A51.94%11.24%6.97%
AG32.55%10%3.10%G20.93%6.58%2.32%
GG4.65%1.55%0.77%
pNSNSNS NSNSNS
Overall immunohistochemical score—MMP-2 Overall immunohistochemical score—MMP-2
Genotypes of rs164242Group 1Group 2Group 3Alleles of rs1642742Group 1Group 2Group 3
AA46.51%0%0%A56.58%0%0%
AG17.83%0%0%G43.02%1.55%0%
GG34.10%1.55%0%
pNSNSNS NSNSNS
Genotypes of rs779805Group 1Group 2Group 3Alleles of rs779805Group 1Group 2Group 3
AA47.28%0%0%A69.40%0.77%0%
AG44.18%1.55%0%G29.06%0.77%0%
GG6.97%0%0%
pNSNSNS NSNSNS
Overall immunohistochemical score—MMP-9 Overall immunohistochemical score—MMP-9
Genotypes of rs1642742Group 1Group 2Group 3Alleles of rs1642742Group 1Group 2Group 3
AA46.51%0%0%A55.81%0.38%0.38%
AG17.05%0.77%0.77%G43.41%0.38%0.38%
GG34.88%0%0%
pNSNSNS NSNSNS
Genotypes of rs779805Group 1Group 2Group 3Alleles of rs779805Group 1Group 2Group 3
AA47.28%0%0%A69.40%0.38%0.38%
AG44.18%0.77%0.77%G29.06%0.38%0.38%
GG6.97%0%0%
pNSNSNS NSNSNS
NS—not statistically significant.
Table
Table 7. Polymorphisms of VHL and patients’ survival.
Table 7. Polymorphisms of VHL and patients’ survival.
Deaths [n (%)] Deaths [n (%)]
Genotypes of rs1642742Yes
[n (%)]		No
[n (%)]		pAlleles of rs1642742Yes
[n (%)]		No
[n (%)]		p
AA19 (14.73%)41 (31.78%)NSA22 (17.05%)49 (37.98%)NS
AG6 (4.65%)17 (13.18%)NSG26 (20.16%)32 (24.81%)NS
GG23 (17.83%)23 (17.83%)NS
Genotypes of rs779805 pAlleles of rs779805 p
AA19 (14.73%)42 (32.55%)NSA30 (23.25%)61 (47.30%)NS
AG22 (17.05%)37 (28.67%)NSG18 (13.95%)20 (15.50%)NS
GG7 (5.44%)2 (1.56%)NS
NS—not statistically significant.
Table
Table 8. Details of the primary antibodies used for immunohistochemistry.
Table 8. Details of the primary antibodies used for immunohistochemistry.
AntibodyCloneSourceDilution
CD44MonoclonalMRQ-13, Cell Marque, Rocklin, CA, USA1:300
MMP-2MonoclonalCA-4001, Zeta Corporation, Arcadia, CA, USA1:50
MMP-9MonoclonalEP127, Bio SB, Goleta, CA, USA1:100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chrabańska, M.; Szweda-Gandor, N.; Drozdzowska, B. Two Single Nucleotide Polymorphisms in the Von Hippel-Lindau Tumor Suppressor Gene in Patients with Clear Cell Renal Cell Carcinoma. Int. J. Mol. Sci. 2023, 24, 3778. https://doi.org/10.3390/ijms24043778

AMA Style

Chrabańska M, Szweda-Gandor N, Drozdzowska B. Two Single Nucleotide Polymorphisms in the Von Hippel-Lindau Tumor Suppressor Gene in Patients with Clear Cell Renal Cell Carcinoma. International Journal of Molecular Sciences. 2023; 24(4):3778. https://doi.org/10.3390/ijms24043778

Chicago/Turabian Style

Chrabańska, Magdalena, Nikola Szweda-Gandor, and Bogna Drozdzowska. 2023. "Two Single Nucleotide Polymorphisms in the Von Hippel-Lindau Tumor Suppressor Gene in Patients with Clear Cell Renal Cell Carcinoma" International Journal of Molecular Sciences 24, no. 4: 3778. https://doi.org/10.3390/ijms24043778

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop