circINSR Inhibits Adipogenic Differentiation of Adipose-Derived Stromal Vascular Fractions through the miR-152/MEOX2 Axis in Sheep
Abstract
:1. Introduction
2. Results
2.1. Identification and Characterization of circINSR in Ovine SVFs
2.2. circINSR Inhibits the Adipogenic Differentiation of Ovine SVFs
2.3. circINSR Functions as a Sponge for miR-152
2.4. miR-152 Promotes the Adipogenic Differentiation of Ovine SVFs
2.5. MEOX2 Is Directly Targeted by miR-152 and Indirectly Regulated by circINSR
2.6. MEOX2 Negatively Regulates the Adipogenic Differentiation of Ovine SVFs
2.7. circINSR Represses the Adipogenic Differentiation of Ovine SVFs through the circINSR/mir-152/MEOX2 Axis
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Isolation and Culture of Ovine SVFs
4.3. Adipogenic Differentiation and Oil Red O Staining
4.4. RNA, Genomic DNA (gDNA) Extraction, and Real-Time Quantitative PCR (qRT-PCR)
4.5. Vector Construction and Cell Transfection
4.6. Lentivirus Infection
4.7. Western Blot
4.8. RNase R Treatment
4.9. Actinomycin D Assay
4.10. Dual-Luciferase Reporter Assay
4.11. RIP
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kalds, P.; Luo, Q.; Sun, K.; Zhou, S.; Chen, Y.; Wang, X. Trends towards revealing the genetic architecture of sheep tail patterning: Promising genes and investigatory pathways. Anim. Genet. 2021, 52, 799–812. [Google Scholar] [CrossRef]
- Zhao, F.; Deng, T.; Shi, L.; Wang, W.; Zhang, Q.; Du, L.; Wang, L. Genomic scan for selection signature reveals fat deposition in Chinese indigenous sheep with extreme tail types. Animals 2020, 10, 773. [Google Scholar] [CrossRef]
- Moradi, M.H.; Nejati-Javaremi, A.; Moradi-Shahrbabak, M.; Dodds, K.G.; McEwan, J.C. Genomic scan of selective sweeps in thin and fat tail sheep breeds for identifying of candidate regions associated with fat deposition. BMC Genet. 2012, 13, 10. [Google Scholar]
- Pan, Y.; Jing, J.; Qiao, L.; Liu, J.; An, L.; Li, B.; Ren, D.; Liu, W. MiRNA-seq reveals that miR-124-3p inhibits adipogenic differentiation of the stromal vascular fraction in sheep via targeting C/EBPα. Domest. Anim. Endocrinol. 2018, 65, 17–23. [Google Scholar]
- He, C.; Zhang, Q.; Sun, H.; Cai, R.; Pang, W. Role of miRNA and lncRNA in animal fat deposition-a review. Sheng Wu Gong Cheng Xue Bao Chin. J. Biotechnol. 2020, 36, 1504–1514. [Google Scholar]
- Yu, C.Y.; Kuo, H.C. The emerging roles and functions of circular RNAs and their generation. J. Biomed. Sci. 2019, 26, 29. [Google Scholar]
- Qu, S.; Zhong, Y.; Shang, R.; Zhang, X.; Song, W.; Kjems, J.; Li, H. The emerging landscape of circular RNA in life processes. RNA Biol. 2017, 14, 992–999. [Google Scholar]
- Li, X.; Yang, L.; Chen, L.L. The biogenesis, functions, and challenges of circular RNAs. Mol. Cell 2018, 71, 428–442. [Google Scholar] [CrossRef]
- Cao, J.; Zhang, X.; Xu, P.; Wang, H.; Wang, S.; Zhang, L.; Li, Z.; Xie, L.; Sun, G.; Xia, Y.; et al. Circular RNA circLMO7 acts as a microRNA-30a-3p sponge to promote gastric cancer progression via the WNT2/β-catenin pathway. J. Exp. Clin. Cancer Res. 2021, 40, 6. [Google Scholar]
- Li, H.; Wei, X.; Yang, J.; Dong, D.; Hao, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Ma, Y.; et al. circFGFR4 promotes differentiation of myoblasts via binding miR-107 to relieve its inhibition of Wnt3a. Mol. Ther. Nucleic Acids 2018, 11, 272–283. [Google Scholar]
- Zhang, D.; Ni, N.; Wang, Y.; Tang, Z.; Gao, H.; Ju, Y.; Sun, N.; He, X.; Gu, P.; Fan, X. CircRNA-vgll3 promotes osteogenic differentiation of adipose-derived mesenchymal stem cells via modulating miRNA-dependent integrin α5 expression. Cell Death Differ. 2021, 28, 283–302. [Google Scholar]
- Kang, Z.; Zhang, S.; Jiang, E.; Wang, X.; Wang, Z.; Chen, H.; Lan, X. circFLT1 and lncCCPG1 sponges miR-93 to regulate the proliferation and differentiation of adipocytes by promoting lncSLC30A9 expression. Mol. Ther. Nucleic Acids 2020, 22, 484–499. [Google Scholar] [CrossRef]
- Jiang, R.; Li, H.; Yang, J.; Shen, X.; Song, C.; Yang, Z.; Wang, X.; Huang, Y.; Lan, X.; Lei, C.; et al. circRNA Profiling Reveals an Abundant circFUT10 that Promotes Adipocyte Proliferation and Inhibits Adipocyte Differentiation via Sponging let-7 (J). Mol. Ther. Nucleic Acids 2020, 20, 491–501. [Google Scholar]
- Salzman, J.; Gawad, C.; Wang, P.L.; Lacayo, N.; Brown, P.O. Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types. PLoS ONE 2012, 7, e30733. [Google Scholar]
- Fan, X.; Zhang, X.; Wu, X.; Guo, H.; Hu, Y.; Tang, F.; Huang, Y. Single-cell RNA-seq transcriptome analysis of linear and circular RNAs in mouse preimplantation embryos. Genome Biol. 2015, 16, 148. [Google Scholar]
- Fröjdö, S.; Vidal, H.; Pirola, L. Alterations of insulin signaling in type 2 diabetes: A review of the current evidence from humans. Biochim. Biophys. Acta 2009, 1792, 83–92. [Google Scholar]
- Arcidiacono, B.; Chiefari, E.; Foryst-Ludwig, A.; Currò, G.; Navarra, G.; Brunetti, F.S.; Mirabelli, M.; Corigliano, D.M.; Kintscher, U.; Britti, D.; et al. Obesity-related hypoxia via miR-128 decreases insulin-receptor expression in human and mouse adipose tissue promoting systemic insulin resistance. eBiomedicine 2020, 59, 102912. [Google Scholar]
- Abdul-Ghani, M.A.; DeFronzo, R.A. Pathogenesis of insulin resistance in skeletal muscle. J. Biomed. Biotechnol. 2010, 2010, 476279. [Google Scholar]
- Softic, S.; Boucher, J.; Solheim, M.H.; Fujisaka, S.; Haering, M.F.; Homan, E.P.; Winnay, J.; Perez-Atayde, A.R.; Kahn, C.R. Lipodystrophy due to adipose tissue-specific insulin receptor knockout results in progressive NAFLD. Diabetes 2016, 65, 2187–2200. [Google Scholar]
- Han, H.; Wei, W.; Chu, W.; Liu, K.; Tian, Y.; Jiang, Z.; Chen, J. Muscle conditional medium reduces intramuscular adipocyte differentiation and lipid accumulation through regulating insulin signaling. Int. J. Mol. Sci. 2017, 18, 1799. [Google Scholar]
- Guo, X.; Zhou, Q.; Su, D.; Luo, Y.; Fu, Z.; Huang, L.; Li, Z.; Jiang, D.; Kong, Y.; Li, Z.; et al. Circular RNA circBFAR promotes the progression of pancreatic ductal adenocarcinoma via the miR-34b-5p/MET/Akt axis. Mol. Cancer 2020, 19, 83. [Google Scholar]
- Shen, P.; Yang, T.; Chen, Q.; Yuan, H.; Wu, P.; Cai, B.; Meng, L.; Huang, X.; Liu, J.; Zhang, Y.; et al. CircNEIL3 regulatory loop promotes pancreatic ductal adenocarcinoma progression via miRNA sponging and A-to-I RNA-editing. Mol. Cancer 2021, 20, 51. [Google Scholar]
- Gulyaeva, O.; Dempersmier, J.; Sul, H.S. Genetic and epigenetic control of adipose development. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 3–12. [Google Scholar]
- Chen, C.; Zhang, X.; Deng, Y.; Cui, Q.; Zhu, J.; Ren, H.; Liu, Y.; Hu, X.; Zuo, J.; Peng, Y. Regulatory roles of circRNAs in adipogenesis and lipid metabolism: Emerging insights into lipid-related diseases. FEBS J. 2021, 288, 3663–3682. [Google Scholar]
- Cignarelli, A.; Genchi, V.A.; Perrini, S.; Natalicchio, A.; Laviola, L.; Giorgino, F. Insulin and insulin receptors in adipose tissue development. Int. J. Mol. Sci. 2019, 20, 759. [Google Scholar]
- Rong, Z.; Shi, S.; Tan, Z.; Xu, J.; Meng, Q.; Hua, J.; Liu, J.; Zhang, B.; Wang, W.; Yu, X.; et al. Circular RNA CircEYA3 induces energy production to promote pancreatic ductal adenocarcinoma progression through the miR-1294/c-Myc axis. Mol. Cancer 2021, 20, 106. [Google Scholar]
- Ahmed, B.; Sultana, R.; Greene, M.W. Adipose tissue and insulin resistance in obese. Biomed. Pharmacother. 2021, 137, 111315. [Google Scholar]
- Posner, B.I. Insulin signalling: The inside story. Can. J. Diabetes 2017, 41, 108–113. [Google Scholar]
- Chen, R.X.; Chen, X.; Xia, L.P.; Zhang, J.X.; Pan, Z.Z.; Ma, X.D.; Han, K.; Chen, J.W.; Judde, J.G.; Deas, O.; et al. N(6)-methyladenosine modification of circNSUN2 facilitates cytoplasmic export and stabilizes HMGA2 to promote colorectal liver metastasis. Nat. Commun. 2019, 10, 4695. [Google Scholar]
- Tang, K.; Wu, Z.; Sun, M.; Huang, X.; Sun, J.; Shi, J.; Wang, X.; Miao, Z.; Gao, P.; Song, Y.; et al. Elevated MMP10/13 mediated barrier disruption and NF-κB activation aggravate colitis and colon tumorigenesis in both individual or full miR-148/152 family knockout mice. Cancer Lett. 2022, 529, 53–69. [Google Scholar]
- Fan, Y.; Gan, M.; Tan, Y.; Chen, L.; Shen, L.; Niu, L.; Liu, Y.; Tang, G.; Jiang, Y.; Li, X.; et al. Mir-152 regulates 3T3-L1 preadipocyte proliferation and differentiation. Molecules 2019, 24, 3379. [Google Scholar]
- Song, C.; Fang, X.; Yang, Z.; Wang, Q.; Meng, F.; Chen, Y.; Chen, J.; Zhao, B.; Wang, Y.; Fang, X.; et al. miR-152 regulates bovine myoblast proliferation by targeting KLF6. Animals 2021, 11, 3001. [Google Scholar]
- Yin, H.; He, H.; Cao, X.; Shen, X.; Han, S.; Cui, C.; Zhao, J.; Wei, Y.; Chen, Y.; Xia, L.; et al. MiR-148a-3p regulates skeletal muscle satellite cell differentiation and apoptosis via the PI3K/AKT signaling pathway by targeting Meox2. Front. Genet. 2020, 11, 512. [Google Scholar]
- Timmons, J.A.; Wennmalm, K.; Larsson, O.; Walden, T.B.; Lassmann, T.; Petrovic, N.; Hamilton, D.L.; Gimeno, R.E.; Wahlestedt, C.; Baar, K.; et al. Myogenic gene expression signature establishes that brown and white adipocytes originate from distinct cell lineages. Proc. Natl Acad. Sci. USA 2007, 104, 4401–4406. [Google Scholar]
- Liu, P.; Kong, F.; Wang, J.; Lu, Q.; Xu, H.; Qi, T.; Meng, J. Involvement of IGF-1 and MEOX2 in PI3K/Akt1/2 and ERK1/2 pathways mediated proliferation and differentiation of perivascular adipocytes. Exp. Cell Res. 2015, 331, 82–96. [Google Scholar]
- Jiang, Y.; Liu, P.; Jiao, W.; Meng, J.; Feng, J. Gax suppresses chemerin/CMKLR1-induced preadipocyte biofunctions through the inhibition of Akt/mTOR and ERK signaling pathways. Cell Physiol. 2018, 233, 572–586. [Google Scholar]
- Suter, D.M.; Molina, N.; Gatfield, D.; Schneider, K.; Schibler, U.; Naef, F. Mammalian genes are transcribed with widely different bursting kinetics. Science 2011, 332, 472–474. [Google Scholar]
- Ramírez-Amaya, V.; Vazdarjanova, A.; Mikhael, D.; Rosi, S.; Worley, P.F.; Barnes, C.A. Spatial exploration-induced Arc mRNA and protein expression: Evidence for selective, network-specific reactivation. J. Neurosci. 2005, 25, 1761–1768. [Google Scholar]
- Slobodin, B.; Han, R.; Calderone, V.; Vrielink, J.A.F.O.; Loayza-Puch, F.; Elkon, R.; Agami, R. Transcription impacts the efficiency of mRNA translation via co-transcriptional N6-adenosine methylation. Cell 2017, 169, 326–337.e12. [Google Scholar]
- Arango, D.; Sturgill, D.; Alhusaini, N.; Dillman, A.A.; Sweet, T.J.; Hanson, G.; Hosogane, M.; Sinclair, W.R.; Nanan, K.K.; Mandler, M.D.; et al. Acetylation of cytidine in mRNA promotes translation efficiency. Cell 2018, 175, 1872–1886.e24. [Google Scholar]
Name of Primers | GenBank Accession Number | Sequences (5′-3′) |
---|---|---|
circINSR forward | CTGCCACTGTCATCAACGG | |
circINSR reverse | GCAGCCGGGTGAGATTATTC | |
PPARγ forward | NM_001100921.1 | ATCTTGACGGGAAAGACGAC |
PPARγ reverse | AAACTGACACCCCTGGAAGAT | |
FABP4 forward | NM_001114667.1 | AAACTGGGATGGGAAATCAACC |
FABP4 reverse | TGCTCTCTCGTAAACTCTGGTAGC | |
Adiponectin forward | NM_001308565.1 | ATCCCCGGGCTGTACTACTT |
Adiponectin reverse | CTGGTCCACGTTCTGGTTCT | |
C/EBPα forward | NM_001308574.1 | TCCGTGGACAAGAACAGCAA |
C/EBPα reverse | TCATTGTCACTGGTCAGCTCC | |
β-Actin forward | NM_001009784.3 | TGATGATATTGCTGCGCTCG |
β-Actin reverse | GGGTCAGGATGCCTCTCTTG | |
miR-152 | GCGCGCTCAGTGCATGACAGAAC | |
U6 forward | XR_003587591.1 | CTCGCTTCGGCAGCACA |
U6 reverse | AACGCTTCACGAATTTGCGT | |
MEOX2 forward | XM_004007766.5 | AGCGATAGCTCAGACTCCCA |
MEOX2 reverse | TCGCCTCAGTCTGGTCAGATA | |
ARHGAP21 forward | ARHGAP21 | GCGCTTGCTCCGGAAAGAT |
ARHGAP21 reverse | CTCCTGTGCAGCTAGTGAGG | |
FBN1 forward | XM_012181624.4 | GGCAAACGGTTTTTCAAAGACAT |
FBN1 reverse | TCCAGAGCAAAGCCGCTATC | |
CYTH3 forward | XM_042240307.1 | GGATGAAGTCCATCAGAGCGA |
CYTH3 reverse | ACTCTGCTGTGGGGTTTCAG |
Name | Sequences (5′-3′) |
---|---|
circINSR convergent | F: TGGAGAGCCTGAAGGACTTG |
R: CCAGGTAGCAGAGTTCATTGTT | |
circINSR divergent | F: CTGCCACTGTCATCAACGG |
R: GCAGCCGGGTGAGATTATTC |
Name | Sequences (5′-3′) |
---|---|
si-circINSR-1 | CCACTGCCAGAAAGTGTGC |
si-circINSR-2 | AAAGTGTGCCCCGGTATGG |
Names | Sequences (5′-3′) |
---|---|
sh-MEOX2-1 forward | GATCCGCAGAATTTGCCCATCATAATTTCAAGAGAATTATGATGGGCAAATTCTGCTTTTTTG |
sh-MEOX2-1 reverse | AATTCAAAAAAGCAGAATTTGCCCATCATAATTCTCTTGAAATTATGATGGGCAAATTCTGCG |
sh-MEOX2-2 forward | GATCCGCTCTGAGCATGCACACTTATTTCAAGAGAATAAGTGTGCATGCTCAGAGCTTTTTTG |
sh-MEOX2-2 reverse | AATTCAAAAAAGCTCTGAGCATGCACACTTATTCTCTTGAAATAAGTGTGCATGCTCAGAGCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, B.; Zhang, H.; Zhao, D.; Liang, Y.; Qiao, L.; Liu, J.; Pan, Y.; Yang, K.; Liu, W. circINSR Inhibits Adipogenic Differentiation of Adipose-Derived Stromal Vascular Fractions through the miR-152/MEOX2 Axis in Sheep. Int. J. Mol. Sci. 2023, 24, 3501. https://doi.org/10.3390/ijms24043501
Zhao B, Zhang H, Zhao D, Liang Y, Qiao L, Liu J, Pan Y, Yang K, Liu W. circINSR Inhibits Adipogenic Differentiation of Adipose-Derived Stromal Vascular Fractions through the miR-152/MEOX2 Axis in Sheep. International Journal of Molecular Sciences. 2023; 24(4):3501. https://doi.org/10.3390/ijms24043501
Chicago/Turabian StyleZhao, Bishi, Hanyue Zhang, Dan Zhao, Yu Liang, Liying Qiao, Jianhua Liu, Yangyang Pan, Kaijie Yang, and Wenzhong Liu. 2023. "circINSR Inhibits Adipogenic Differentiation of Adipose-Derived Stromal Vascular Fractions through the miR-152/MEOX2 Axis in Sheep" International Journal of Molecular Sciences 24, no. 4: 3501. https://doi.org/10.3390/ijms24043501