Next Article in Journal
Identification of Differential Circular RNA Expression Profiles and Functional Networks in Human Macrophages Induced by Virulent and Avirulent Mycobacterium tuberculosis Strains
Next Article in Special Issue
The Relevance, Predictability, and Utility of Annexin A5 for Human Physiopathology
Previous Article in Journal
Specific Cationic Antimicrobial Peptides Enhance the Recovery of Low-Load Quiescent Mycobacterium tuberculosis in Routine Diagnostics
Previous Article in Special Issue
Unraveling Connective Tissue Growth Factor as a Therapeutic Target and Assessing Kahweol as a Potential Drug Candidate in Triple-Negative Breast Cancer Treatment
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 24
10.3390/ijms242417560
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exploiting Synthetic Lethality between Germline BRCA1 Haploinsufficiency and PARP Inhibition in JAK2V617F-Positive Myeloproliferative Neoplasms

by
Max Bermes
1,2,
Maria Jimena Rodriguez
1,2,
Marcelo Augusto Szymanski de Toledo
1,2,
Sabrina Ernst
3,
Gerhard Müller-Newen
4,
Tim Henrik Brümmendorf
1,2,
Nicolas Chatain
1,2,
Steffen Koschmieder
1,2,*,† and
Julian Baumeister
1,2,†
1
Department of Hematology, Oncology, Hemostaseology, and Stem Cell Transplantation, Faculty of Medicine, RWTH Aachen University, 52074 Aachen, Germany
2
Center for Integrated Oncology Aachen Bonn Cologne Düsseldorf (CIO ABCD), 52074 Aachen, Germany
3
Confocal Microscopy Facility, Interdisciplinary Center for Clinical Research IZKF, RWTH Aachen University, 52074 Aachen, Germany
4
Department of Biochemistry, Faculty of Medicine, RWTH Aachen University, 52074 Aachen, Germany
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(24), 17560; https://doi.org/10.3390/ijms242417560
Submission received: 18 October 2023 / Revised: 4 December 2023 / Accepted: 10 December 2023 / Published: 16 December 2023
(This article belongs to the Special Issue Novel Therapeutic Targets in Cancers 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Myeloproliferative neoplasms (MPN) are rare hematologic disorders characterized by clonal hematopoiesis. Familial clustering is observed in a subset of cases, with a notable proportion exhibiting heterozygous germline mutations in DNA double-strand break repair genes (e.g., BRCA1). We investigated the therapeutic potential of targeting BRCA1 haploinsufficiency alongside the JAK2V617F driver mutation. We assessed the efficacy of combining the PARP inhibitor olaparib with interferon-alpha (IFNα) in CRISPR/Cas9-engineered Brca1+/− Jak2V617F-positive 32D cells. Olaparib treatment induced a higher number of DNA double-strand breaks, as demonstrated by γH2AX analysis through Western blot (p = 0.024), flow cytometry (p = 0.013), and confocal microscopy (p = 0.071). RAD51 foci formation was impaired in Brca1+/− cells compared to Brca1+/+ cells, indicating impaired homologous recombination repair due to Brca1 haploinsufficiency. Importantly, olaparib enhanced apoptosis while diminishing cell proliferation and viability in Brca1+/− cells compared to Brca1+/+ cells. These effects were further potentiated by IFNα. Olaparib induced interferon-stimulated genes and increased endogenous production of IFNα in Brca1+/− cells. These responses were abrogated by STING inhibition. In conclusion, our findings suggest that the combination of olaparib and IFNα presents a promising therapeutic strategy for MPN patients by exploiting the synthetic lethality between germline BRCA1 mutations and the JAK2V617F MPN driver mutation.

Graphical Abstract

1. Introduction

Myeloproliferative neoplasms (MPN) are a rare type of blood cancer and a disorder of excess progenitor cell production induced by clonal hematopoietic stem cells (HSCs). Among the group of the BCR-ABL1-negative MPN, the three most frequent subtypes are essential thrombocythemia (ET), polycythemia vera (PV), and primary myelofibrosis (PMF). With the exception of a minority of triple-negative patients, these disease entities are typically induced by one of three classical driver mutations in the genes encoding the tyrosine kinase Janus kinase 2 (JAK2), the chaperone calreticulin (CALR), or the thrombopoietin receptor MPL, the most frequent being the JAK2V617F mutation [1]. Although MPN patients generally exhibit a more favorable prognosis compared to other hematologic malignancies, they face an increased risk of severe thrombotic and hemorrhagic events, leading to increased mortality [2].
Additionally, secondary myelofibrosis or transformation into acute myeloid leukemia (AML) can occur, significantly worsening the prognosis [3]. Hence, there is an urgent need for effective treatment strategies to enhance patients’ quality of life and improve complication-free survival. Currently, allogeneic HSC transplantation remains the only curative therapeutic option. However, due to its high morbidity and mortality, only few patients are eligible for this intervention [4].
MPN mostly occur sporadically, but in 7.6% of the cases, MPN are associated with a familial incidence [5]. In these familial MPN, affected family members may present with different MPN subtypes or driver mutations, implying a shared genetic predisposition for acquiring these driver mutations [6]. Utilizing whole-exome sequencing, we could demonstrate that four out of five families with familial MPN presented with germline mutations in genes involved in DNA double-strand break (DSB) repair-associated genes (i.e., BRCA1, BRCA2, ATM, and CHEK2), suggesting that these germline mutations might increase the risk of acquiring a somatic MPN driver mutation [7].
BRCA1 or BRCA2 (BRCA1/2)-mutated cancer cells are effectively targeted by poly ADP ribose polymerase (PARP) inhibitors, leveraging the principle of synthetic lethality [8,9]. This concept was first described in 1922 by Calvin Bridges, who observed that the simultaneous loss of two distinct genes was lethal for flies, while the loss of one alone was not [10]. In the context of BRCA1/2-mutated cancer cells, PARP plays a pivotal role in DNA single-strand break (SSB) repair. Inhibiting PARP impedes the repair of DNA SSBs, causing them to progress into more severe DSBs. In BRCA1/2-mutated cells, characterized by defective homologous recombination repair (HRR), PARP inhibition induces a substantial load of DSBs that surpass their repair capacity. This results in the accumulation of DNA damage, ultimately triggering apoptosis through the phenomenon of synthetic lethality existing between BRCA1/2 mutations and PARP inhibition.
This concept is already exploited clinically in familial breast and ovarian cancer, where patients often harbor a heterozygous BRCA1/2 germline mutation and develop cancer after a somatic loss of the second allele. These cancer cells can be targeted specifically with PARP inhibitors, while non-malignant cells, which have retained one functional allele, remain unaffected [11]. While it is widely accepted that the loss of the second allele is a prerequisite for carcinogenicity in breast cancer and ovarian cancer, BRCA1 haploinsufficient cells show functional deficits under challenging conditions, such as replicative stress [12,13]. In the context of MPN, driver mutations, such as JAK2V617F, induce replicative stress and genetic instability [14,15,16,17]. Building upon this knowledge, we postulated that PARP inhibition induces synthetic lethality, specifically in BRCA1 haploinsufficient JAK2V617F-positive cells.
Recent research utilizing an ataxia telangiectasia mutated (ATM) model, with ATM serving as the apex kinase regulating BRCA1, has unveiled that DNA damage induced by ATM loss-of-function mutations primes the type I interferon system via the cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway [18]. Interferon-alpha (IFNα) is a widely used therapeutic option in the treatment of MPN and is recognized for its ability to selectively target malignant stem cells, evoke long-lasting deep molecular remissions, and induce DNA stress [19,20,21]. With this understanding, we hypothesized that MPN cells harboring heterozygous BRCA1 mutations exhibit heightened responsiveness to IFNα treatment and that IFNα could potentially enhance the sensitivity of MPN cells with DSB repair gene haploinsufficiency to PARP inhibitors.

2. Results

2.1. DNA DSBs Are Elevated in Brca1+/− Jak2V617F Cells and Further Amplified by Olaparib

The first aim of this study was to assess whether 32D Jak2V617F Brca1+/− cells exhibited elevated numbers of DNA DSBs compared to their Jak2V617F Brca1+/+ counterparts. We also investigated whether olaparib, IFNα, or their combination induced more DSBs selectively in Brca1+/− cells. For this purpose, cells were treated with olaparib and/or IFNα for 24 h and analyzed for the frequency of γH2AX-positive cells by flow cytometry (Figure 1A). While olaparib alone exhibited a stronger impact on inducing DSBs than IFNα, the combined treatment showed the most pronounced impact. When compared to Brca1+/+ control cells, percentages of Jak2V617F Brca1+/− cells positive for γH2AX were significantly higher when treated with olaparib and the combination of olaparib and IFNα.
To confirm and complement the findings obtained from the flow cytometry analysis, we conducted Western blot experiments using Jak2V617F Brca1+/+ and Brca1+/− cells after in vitro treatment with olaparib and/or IFNα for 4 h (Figure 1B–D). In Brca1+/− cells, we observed a significant increase in γH2AX levels following treatment with DMSO, olaparib and the olaparib/IFNα combination, in comparison to Brca1+/+ cells (Figure 1B,C). Additionally, basal levels of protein poly ADP-ribosylation (PARylation), a post-translational modification at DNA lesions catalyzed by PARP, were significantly higher in the Brca1+/− cells compared to the Brca1+/+ cells (Figure 1B,D). As expected, PARylation was effectively inhibited by olaparib treatment.

2.2. Impaired HRR Mechanism and Suppressed Proliferation and Viability in Brca1+/− Jak2V617F Cells upon Treatment with Olaparib and IFNα

To investigate the impact of Brca1 haploinsufficiency on HRR within Jak2V617F cells, we analyzed the formation of γH2AX and RAD51 foci using immunofluorescence and confocal microscopy, following 24 h treatment with olaparib or DMSO. RAD51 foci are crucial indicators of HRR functionality and are commonly examined to assess impairment of this repair pathway [22]. As expected, olaparib treatment prominently triggered the formation of γH2AX foci (Figure 2A). Although not reaching statistical significance, there was a numerical enhancement in the induction of γH2AX foci in Brca1+/− cells in comparison to Brca1+/+ cells (Figure 2B). When analyzing RAD51 foci numbers, we observed an induction by olaparib, which was significantly higher in Brca1+/+ cells (Figure 2C). Olaparib-treated Brca1+/− cells displayed an increased number of γH2AX foci without a corresponding RAD51 focus compared with Brca1+/− cells (p = 0.1378; Figure S1K).
Having demonstrated the induction of DSBs by both olaparib and IFNα in Jak2V617F cells, with a notably higher effect in Brca1+/− cells compared to Brca1+/+ cells, we examined the effects of olaparib and IFNα on cell proliferation and cell viability. Our findings revealed that olaparib, IFNα, and their combination significantly reduced cell viability and cell proliferation in Brca1+/− Jak2V617F cells compared to Brca1+/+ Jak2V617F cells (Figure 3A and Figure S2A). Most importantly, and in line with the findings of our preceding experiments, proliferation, and viability were considerably more impaired in Brca1+/− cells than in Brca1+/+ cells when subjected to olaparib, IFNα, or the combination.
Thereafter, we studied the effect of olaparib and IFNα on Jak2V617F Brca1+/− and Brca1+/+ cells using MTT assays as an indicator of cell viability, proliferation, and cytotoxicity (Figure 3B–D and Figure S2B–D). These assays revealed that the reduction in metabolic activity was significantly more pronounced in Jak2V617F Brca1+/− cells than in Jak2V617F Brca1+/+ cells when treated with olaparib (Figure 3B and Figure S2C,D), IFNα (Figure 3C and Figure S2B,C), or the combination of both drugs (Figure 3D). We also analyzed the effect of olaparib and IFNα on the metabolic activity of 32D Jak2 wildtype (WT) cells. Interestingly, olaparib and IFNα exhibited a weaker impact on the metabolic activity of Jak2WT cells, with olaparib still demonstrating a stronger effect on Brca1+/− cells than on Brca1+/+ cells (Figure S3). However, for IFNα, no difference between Brca1+/− and Brca1+/+ cells was observed. Moreover, by comparing the mean relative absorbances from the MTT assays with Jak2WT cells to those with Jak2V617F cells (Table S1), we found that both olaparib and IFNα led to a more pronounced impairment of metabolic activity in Jak2V617F than in Jak2WT cells. Moreover, olaparib treatment had a stronger impact on Jak2V617F cells compared to Jak2WT cells, which was not observed for IFNα treatment.
To investigate the potential of olaparib and IFNα to induce apoptosis in Jak2V617F Brca1+/− and Brca1+/+ cells, we utilized Annexin V/7-AAD apoptosis assays (Figure 3E). IFNα induced apoptosis to a greater extent than olaparib, whereas the combination provoked the strongest response. By calculating the coefficient of drug interaction (CDI), we observed higher synergistic effects of olaparib and IFNα in Brca1+/− cells than in Brca1+/+ cells in MTT (Figure S4A) and apoptosis (Figure S4B) assays.
To assess the impact of olaparib and IFNα on the cell cycle of Jak2V617F Brca1+/+ and Brca1+/− cells, we analyzed the fraction of cells in G0/G1 or G2/M phase with FxCycle Violet by flow cytometry after 24 h of treatment with olaparib, IFNα, or their combination. A pronounced cell cycle arrest in G0/G1 was induced in Brca1+/− cells following single treatments of olaparib and IFNα, and this effect was notably enhanced by the combination treatment (Figure S5A). In contrast, the reduction in the fraction of Brca1+/+ cells in G2/M phase was less pronounced. Additionally, we analyzed the expression of negative cell cycle regulators, specifically p16 (i.e., CDKN2A gene) and p21 (i.e., CDKN1A gene). p16, also known as cyclin-dependent kinase inhibitor 2A, inhibits the progression from the G1 phase to the S phase, and p21, also called cyclin-dependent kinase inhibitor 1, is involved in inhibiting the progression through the G1, the S, and the G2 phases. The upregulation of p16 and p21 was significantly more pronounced in Brca1+/− cells when treated with both olaparib and IFNα, corroborating the flow cytometric cell cycle analysis (Figure S5B).
In summary, the results affirm our hypothesis that Jak2V617F Brca1+/− cells exhibit a higher number of DSBs compared with Brca1+/+ cells. Notably, we found that this susceptibility to DSBs is specifically heightened in Jak2V617F Brca1+/− cells through PARP inhibition. Furthermore, olaparib and IFNα preferentially compromised the metabolic activity, proliferation, viability, and cell cycle progression of Jak2V617F Brca1+/− cells. These findings underscore the elevated sensitivity of Brca1+/− cells to these therapeutic interventions.

2.3. Olaparib Induces IFNα Signaling via Activation of the cGAS-STING Pathway Specifically in Brca1+/− Jak2V617F Cells

Intriguingly, recent evidence has suggested a link between DNA damage and the activation of the cGAS-STING pathway, which is one major pathway responsible for driving the production of IFNα in response to cytosolic microbial and self-DNA [23]. This pathway is part of the innate immune system and detects cytosolic microbial DNA but can also be activated by an accumulation of DNA damage, leading to the release of DNA into the cytoplasm and subsequent activation of the cGAS-STING pathway resulting in increased production of IFNα [18]. Therefore, we postulated that (a) the cGAS-STING pathway is constitutively active in Jak2V617F Brca1+/− cells and further augmented by olaparib treatment and (b) that the activated STING-pathway results in an elevated production of IFNα (Figure 4).
To test the hypothesis that the STING pathway is activated by cytoplasmic DNA as a result of increased DSBs in Jak2V617F Brca1+/− cells, we analyzed transcriptional levels of Sting1 and several interferon-responsive genes (Stat1, Irf7, Mx1, Oas1a, and Isg15) in Jak2V617F Brca1+/− and Jak2V617F Brca1+/+ cells after treatment with olaparib, IFNα, or the combination (Figure 5). As expected, we observed an upregulation of all interferon-responsive genes after treatment with IFNα, and mRNA levels of Sting1 were not elevated in Brca1+/− cells upon treatments but even downregulated in the basal condition. However, interestingly, olaparib treatment induced the expression of Irf7, Mx1, Oas1a, and Isg15 in Jak2V617F Brca1+/− cells compared to Jak2V617F Brca1+/+ cells. Moreover, the basal expression of Isg15 and Mx1 was elevated in Brca1+/− compared to Brca1+/+ cells, and when treated with both olaparib and IFNα, Stat1, Oas1a, and Isg15 exhibited significant upregulation in Brca1+/− cells.
To confirm that the induction of the interferon-responsive genes was indeed a result of cGAS-STING pathway activation, we conducted a secretion assay, as this pathway is also known to induce heightened expression and secretion of IFNα. Supernatant harvested from olaparib- or DMSO-treated Jak2V617F Brca1+/− and Brca1+/+ cells, was added to freshly seeded Jak2V617F Brca1+/+ cells. The expression of interferon-responsive genes was then assessed by RT-qPCR to determine whether olaparib-treated cells had secreted IFNα (Figure 6A). We found that, indeed, basal levels of Oas1a and Isg15 were upregulated in those cells that have received supernatant from Jak2V617F Brca1+/− cells compared to Jak2V617F Brca1+/+ cells. This effect was further enhanced by olaparib treatment. Importantly, this effect was not observed when the cells were preincubated with an IFNαR1 blocking antibody before adding the supernatant, confirming that Brca1 haploinsufficiency in Jak2V617F Brca1+/− cells stimulates an increased production of IFNα.
Finally, to verify that the upregulation of interferon-responsive genes and the increased production of IFNα are indeed mediated through the cGAS-STING pathway, we treated Jak2V617F Brca1+/− and Brca1+/+ cells with olaparib and the STING inhibitor H-151. Subsequently, we analyzed the expression of three interferon-stimulated genes (ISGs): Mx1, Oas1a, and Isg15 (Figure 6B). Intriguingly, we observed that the increased ISG expression levels in Brca1+/− cells after treatment with olaparib were antagonized by STING inhibition, except for Oas1a. These findings indicate that DNA damage induced by PARP inhibition leads to an activation of the cGAS-STING pathway with subsequent increased production of IFNα in Jak2V617F-positive Brca1 haploinsufficient cells. This unique interplay potentially renders these cells more susceptible to IFNα and other MPN-directed treatments.

3. Discussion

Loss-of-function mutations of DNA repair-associated genes play a role in many types of cancer, but their potential significance in MPN has only recently been suggested by a whole-exome sequencing study of our group, in which heterozygous germline mutations in DSB repair genes have been identified in four out of five families with familial MPN [7]. Moreover, even in patients with sporadic MPN, the natural incidence of germline mutations in DSB repair genes would be expected to be at least 0.1–0.5% since this is the combined incidence of BRCA1 and BRCA2 mutations in the general population [24]. As it is already known that cancers harboring germline mutations in DSB repair-associated genes are susceptible to PARP inhibition, it is tempting to consider whether this principle could also be translated to patients with familial or sporadic MPN. Currently, no clear recommendations on how to manage these MPN patients are available.
In this study, we demonstrated that heterozygous Brca1 mutations in 32D Jak2V617F cells result in impaired HRR, suggesting a potential therapeutic vulnerability that could be exploited by PARP inhibitors. As previously reported, JAK2V617F induces DNA damage [14,15], and our findings suggest that Jak2V617F-positive cells harboring an additional heterozygous Brca1 mutation experience even greater DNA damage, surpassing the capacity of the defective DSB repair machinery. This effect is notably amplified by olaparib, with significantly elevated γH2AX levels as demonstrated by Western blot and flow cytometry, further supported by close-to-significant immunofluorescence analyses (p = 0.07). Based on these findings, we propose that PARP inhibition could offer a promising therapeutic strategy for familial MPN patients carrying DSB repair-associated germline mutations by exploiting synthetic lethality. Furthermore, we observed an activation of the STING pathway in olaparib-treated Brca1+/− Jak2V617F cells, leading to an increased secretion of IFNα. This cytokine, which has emerged as a standard treatment in MPN, exhibited enhanced efficacy in Brca1+/− Jak2V617F cells compared to Brca1+/+ cells. While IFNα is capable of inducing long-lasting deep molecular remission and promoting the cycling of dormant stem cells [25,26], the combination of IFNα with olaparib presents a potential synergistic drug combination worthy of further investigation.
IFNα selectively induces cycling of the JAK2V617F HSC, leading to cell cycle stress-associated genomic instability and increased susceptibility towards PARP inhibition, particularly in cells with defective DNA repair mechanisms. To our knowledge, this therapeutic approach of combining PARP inhibitors with IFNα has not been investigated yet and holds potential for application in non-familial MPN patients as well, as BRCA1 is epigenetically inactivated in 40% of all MPN samples analyzed [22], and alterations in DNA repair genes are a frequent feature in MPN patients [27]. This suggests that effective treatment options targeting defective DNA repair mechanisms might extend beyond familial MPN cases to encompass a larger cohort of MPN patients who could benefit from this targeted therapeutic approach. Supporting this notion, the effectiveness of PARP inhibitors in MPN with no detected DSB repair-associated gene mutation has already been demonstrated [28].
The cGAS-STING pathway has been recognized as an activator of the antitumor immune response [29], and in triple-negative breast cancer, the efficacy of olaparib depends on the activation of the cGAS-STING pathway, which recruits CD8+ T cells into the tumor microenvironment, thereby triggering an antitumor immune response [30]. Our findings indicate that olaparib induces an upregulation of the cGAS-STING pathway in Brca1+/− cells, leading to an increase in intrinsic IFNα production.
Our study on murine Jak2V617F-positive 32D cells indicates the potential relevance of Brca1 haploinsufficiency to human MPN disease. Given the rarity of MPN and the low prevalence of BRCA1 mutations in the general population, identifying MPN patients harboring BRCA1 mutations is challenging. To address this, we are actively conducting an extensive screening on patients with familial MPN. Subsequently, we plan to validate our mechanistic findings in further studies, utilizing primary MPN patient samples harboring BRCA1 mutations and haploinsufficient Brca1 animal models to assess how the concept of synthetic lethality between BRCA1 haploinsufficiency and PARP inhibition translates clinically into JAK2V617F-driven MPN. Considering that BRCA1 mutations in patients with familial MPN extend beyond the bone marrow, data from triple-negative breast and ovarian cancer patients harboring heterozygous germline BRCA1 mutations who have undergone olaparib treatment might aid in estimating treatment-associated side effects on BRCA1-haploinsufficient non-cancerous cells. Nevertheless, our MTT assays have already demonstrated that both olaparib and the combination with IFNα exert a more pronounced effect on Brca1+/− cells with an additional Jak2V617F driver mutation when compared to Brca1+/− Jak2WT cells. Although PARP inhibitors are already approved for the treatment of other cancers and their efficacy and safety have been assessed in clinical trials [31,32], in vivo studies are required to assess the efficacy and safety of PARP inhibitors, both alone and in combination with IFNα, for the treatment in MPN. Additionally, considering that PARP inhibitors may impair DNA damage repair and pose a carcinogenic risk for homologous recombination proficient cells [33], further studies are required to estimate the risk of developing secondary cancers. This is underlined by reports suggesting an increased risk of developing AML or myelodysplastic syndrome in breast or ovarian cancer patients treated with PARP inhibitors over extended periods [34]. In conclusion, our findings suggest the potential of combining olaparib and IFNα as a promising therapeutic strategy in MPN patients by exploiting the synthetic lethality between germline BRCA1 mutations and the JAK2V617F MPN driver mutation.

4. Materials and Methods

4.1. Cell Lines

32D Jak2V617F Brca1+/− cells were generated by CRISPR/Cas9 using two guideRNAs targeting Brca1 exon 10 (CD.Cas9.LFMV2350.AA (AGTCCAAAGGTGACAGCTAA) and CD.Cas9.LFMV2350.AB (GGTTAAGCGCGTGTCTCAAG) and Cas9 nuclease according to the manufacturer’s protocol (IDT technologies, Coralville, IA, USA). Parental 32D cells (RRID:CVCL_0118, DSMZ, Braunschweig, Germany) were retrovirally transduced with pMSCV-Jak2V617F-IRES-GFP. Clones were screened by Sanger sequencing (genomic DNA and mRNA) for frameshift mutations inducing premature stop codons in the same region as the human BRCA1 c.2722G>T Glu908* missense mutation that was identified in our whole-exome sequencing analysis in familial MPN [7]. Off-target analysis was performed as described in the Supplementary Materials and relevant off-target effects of the CRISPR/Cas9 process were ruled out. In all experiments, two different clones of each genotype were examined.

4.2. Flow Cytometry Analysis of DSBs

We treated, 2 × 106 cells in a concentration of 1 × 106 cells/mL with either DMSO (Serva, Heidelberg, Germany) or olaparib (10 µM) (Selleckchem, Cologne, Germany) and with H2O or IFNα (10,000 U/mL) in RPMI-1640 (PAN-Biotech, Aidenbach, Germany) medium with 10% fetal calf serum (FCS; PAN-Biotech), 5 ng/mL murine interleukin 3 (mIL-3, ImmunoTools, Friesoythe, Germany), and 1% penicillin/streptomycin (Gibco-Thermo Fisher Scientific, Waltham, MA, USA) for 24 h. The positive control was treated with etoposide (10 µM) (Merck, Darmstadt, Germany) for 4 h, and the negative control was treated with the ATM inhibitor Ku55933 (10 µM) (Selleckchem) for 4 h. Cells were fixed and permeabilized using the FIX and PERM Cell Fixation and Cell Permeabilization Kit (Thermo Fisher Scientific, Waltham, WA, USA) and stained with Phospho-Histone H2A.X (γH2AX, Ser139) monoclonal antibody (CR55T33, PE) (eBioscience, Frankfurt am Main, Germany) and FxCycle Violet stain (Thermo Fisher Scientific). Cells were analyzed in a Gallios flow cytometer (Beckman Coulter, Pasadena, CA, USA) and analyzed with FlowJo (LLC; v10, BD Life Sciences, Franklin Lakes, NJ, USA). A detailed protocol is provided in the Supplementary Materials.

4.3. MTT Assay

We performed 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays as previously published but with 1.5 × 104 cells per well instead of 104 cells in RPMI-1640 medium with 10% FCS, 5 ng/mL mIL-3 and 1% penicillin/streptomycin [35].

4.4. SDS-PAGE and Western Blot

We treated 2 × 106 cells in a concentration of 1 × 106 cells/mL for 4 h with IFNα (10,000 U/mL), olaparib (10 µM), or the combination in RPMI-1640 medium with 10% FCS, 5 ng/mL mIL-3, and 1% penicillin/streptomycin. Generation of lysates, SDS-PAGE, and Western blots were performed as previously published [36]. The used antibodies are listed in the Supplementary Materials (Table S2).

4.5. Apoptosis Assay

We treated 4 × 105 cells in a concentration of 2 × 105 cells/mL for 48 h with olaparib (10 µM) or IFNα (10,000 U/mL) in RPMI-1640 medium with 10% FCS, 5 ng/mL mIL-3, and 1% penicillin/streptomycin and then, 1 × 106 cells were subjected to apoptosis assays, using the APC Annexin V Apoptosis Detection Kit (BioLegend, San Diego, CA, USA), with the samples being analyzed in triplicates with a Gallios flow cytometer (Beckman Coulter) and FlowJo (LLC; v10).

4.6. Cell Proliferation Assay

The different cell clones were seeded in a concentration of 2 × 105 cells/mL in RPMI-1640 medium with 10% FCS, 5 ng/mL mIL-3, and 1% penicillin/streptomycin and treated with the following drugs: IFNα (10,000 U/mL), olaparib (10 µM), or the combination of IFNα and olaparib. Then, the cells were analyzed with a CASY-TTC cell analyzer (OMNI Life Science, Bremen, Germany) after 24 h, 48 h, and 72 h.

4.7. RT-qPCR

Reverse transcriptase quantitative PCR (RT-qPCR) for the analysis of cDNA transcripts was performed as previously published (20). Primer sequences are given in the Supplementary Materials (Table S3).

4.8. Confocal Microscopy Assay

We treated 1 × 105 cells/mL with either olaparib (10 µM) or DMSO in RPMI-1640 medium with 10% FCS, 5 ng/mL mIL-3, and 1% penicillin/streptomycin for 24 h. Then, the cells were harvested, washed with PBS 1X, and centrifuged using Cytospin 4 centrifuge (Thermo Fisher Scientific) at 650 rpm for 5 min. After fixation with 4% paraformaldehyde for 20 min, the cells were permeabilized with 0.5% Triton X-100 for 10 min, blocked with 5% BSA for 1 h, and incubated with primary antibodies (γH2AX 1:500 Cell Signaling #9718, Danvers, MA, USA; RAD51 1:500 Invitrogen MA1-23271) at 4 °C overnight. Subsequently, the cells were washed and incubated with fluorochrome-conjugated secondary antibodies (anti-mouse Alexa Fluor 488 1:200 and anti-rabbit Alexa Fluor 594 1:200) for 1 h at room temperature, and nuclei were stained with Hoechst 33342 (Thermo Fisher Scientific). Images were captured with a Zeiss LSM 710 confocal microscope (Carl Zeiss GmbH, Jena, Germany) using ZEN black 2.3 SP1 software (version 14.0.27.201, Carl Zeiss GmbH). At least 200 cells in nine different areas of the sample were analyzed to quantify RAD51 and γH2AX foci. For γH2AX/RAD51 quantification, the percentage of cells with ten/five (respectively) or more foci per nucleus was scored.

4.9. Secretion Assay

For every clone, 5 × 106 cells were cultured in 5 mL RPMI-1640 medium with 10% FCS, 1% penicillin/streptomycin, mIL-3 (5 ng/mL) and olaparib (10 µM) or DMSO for 24 h. Then, cells were washed twice with PBS and resuspended in 3 mL RPMI-1640 medium with 10% FCS, 1% penicillin/streptomycin and mIL-3 (5 ng/mL) and incubated for 4 h. Cells were centrifuged at 400× g and the supernatant was isolated, sterile-filtered, and one half of the supernatant was added to 5 × 105 32D Jak2WT Brca1+/+ cells preincubated for 30 min with an IFNα receptor blocking antibody (10 µg/mL). As a control group, the other half of the supernatant was added to 5 × 105 32D Jak2WT Brca1+/+ cells, and then, the cells were incubated for 24 h. Afterwards, RNA was isolated with the RNA purification kit from Macherey-Nagel (Düren, Germany) to generate cDNA and perform qPCRs.

4.10. Cell Culture

We acquired 32D cells from the DSMZ and cultured them in RPMI-1640 medium with 10% WEHI-3B supernatant as mIL-3 source, 10% fetal calf serum, and 1% penicillin/streptomycin. Cells were cultured at 37 °C with 5% CO2. For the assays, to have a steady mIL-3 concentration, the RPMI-1640 medium was supplemented with 5 ng/mL mIL-3 instead of 10% WEHI-3B supernatant.

4.11. Statistical Analysis

Statistical analysis was performed using GraphPad Prism 8.4.0 (GraphPad Software, Boston, MA, USA) to calculate independent t-tests or, in case of multiple comparisons and, unless otherwise stated, two-way ANOVAs (Tukey post hoc test). The results are displayed as individual values with mean and standard deviation (SD) if not indicated otherwise.

5. Conclusions

In summary, our study has demonstrated that Brca1 haploinsufficiency induces DNA damage in Jak2V617F-positive cells while priming the type I interferon system via STING, rendering them more susceptible to olaparib treatment, whether applied as a standalone therapy or in conjunction with IFNα. This combined therapeutic approach, which targets DSB repair mechanisms, presents the potential for the treatment of MPN patients with germline DSB repair gene mutations, including those with familial and sporadic MPN. Further investigations are needed to fully elucidate the clinical implications of our findings and to assess the feasibility of implementing genetic counseling for DSB repair germline mutational testing in all MPN patients [7].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms242417560/s1.

Author Contributions

Conceptualization, M.B., S.K. and J.B.; Formal analysis, M.B., M.J.R., M.A.S.d.T., S.E., G.M.-N., T.H.B., N.C., S.K. and J.B.; Funding acquisition, S.K.; Investigation, M.B., M.J.R., M.A.S.d.T., S.E., G.M.-N., T.H.B., N.C., S.K. and J.B.; Methodology, M.B., M.J.R., S.E., G.M.-N. and J.B.; Supervision, S.K. and J.B.; Writing—original draft, M.B., M.J.R., T.H.B., S.K. and J.B.; Writing—review & editing, M.B., M.J.R., M.A.S.d.T., S.E., G.M.-N., T.H.B., N.C., S.K. and J.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported in part by funds from the German Cancer Aid (Deutsche Krebshilfe; DKH) to S.K. (70114726).

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

This work was in part supported by the Flow Cytometry Facility and the Confocal Microscopy Facility, core facilities of the Interdisciplinary Center for Clinical Research (IZKF) Aachen within the Faculty of Medicine at RWTH Aachen University. Parts of this work were generated within the MD thesis work of M.B. Illustrations were created with Biorender.com (license accessed on the 4 December 2023).

Conflicts of Interest

Steffen Koschmieder received research grant/funding from Geron, Janssen, AOP Pharma, and Novartis; received honoraria from Pfizer, Incyte, Ariad, Novartis, AOP Pharma, Bristol Myers Squibb, Celgene, Geron, Janssen, CTI BioPharma, Roche, Bayer, PharmaEssentia, Sierra Oncology, Glaxo-Smith Kline (GSK), iOMEDICO, Abbvie, Astra Zeneca; received travel/accommodation support from Alexion, Novartis, Bristol Myers Squibb, Incyte, AOP Pharma, CTI BioPharma, Pfizer, Celgene, Janssen, Geron, Roche, AbbVie, Sierra Oncology, GSK, iOMEDICO, and Karthos; had a patent issued for a BET inhibitor at RWTH Aachen University; participated on advisory boards for Pfizer, Incyte, Ariad, Novartis, AOP Pharma, BMS, Celgene, Geron, Janssen, CTI BioPharma, Roche, Bayer, Sierra Oncology, PharmaEssentia, AbbVie, Sierra Oncology, and GSK. Tim H Brümmendorf served as consultant/speaker for Gilead, Janssen, Merck, Novartis, Pfizer, and received research support from Novartis and Pfizer. The remaining authors do not declare any conflict of interest.

References

  1. Vainchenker, W.; Kralovics, R. Genetic Basis and Molecular Pathophysiology of Classical Myeloproliferative Neoplasms. Blood 2017, 129, 667–679. [Google Scholar] [CrossRef] [PubMed]
  2. Brodmann, S.; Passweg, J.R.; Gratwohl, A.; Tichelli, A.; Skoda, R.C. Myeloproliferative Disorders: Complications, Survival and Causes of Death. Ann. Hematol. 2000, 79, 312–318. [Google Scholar] [CrossRef] [PubMed]
  3. Kreipe, H.; Hussein, K.; Göhring, G.; Schlegelberger, B. Progression of Myeloproliferative Neoplasms to Myelofibrosis and Acute Leukaemia. J. Hematop. 2011, 4, 61–68. [Google Scholar] [CrossRef]
  4. Deeg, H.J. Role of HSCT in Patients with MPD. Hematol. Oncol. Clin. N. Am. 2014, 18, 1023–1035. [Google Scholar] [CrossRef]
  5. Rumi, E.; Passamonti, F.; Della Porta, M.G.; Elena, C.; Arcaini, L.; Vanelli, L.; Del Curto, C.; Pietra, D.; Boveri, E.; Pascutto, C.; et al. Familial Chronic Myeloproliferative Disorders: Clinical Phenotype and Evidence of Disease Anticipation. J. Clin. Oncol. 2007, 25, 5630–5635. [Google Scholar] [CrossRef] [PubMed]
  6. Rumi, E.; Cazzola, M. Diagnosis, Risk Stratification, and Response Evaluation in Classical Myeloproliferative Neoplasms. Blood 2017, 129, 680–692. [Google Scholar] [CrossRef]
  7. Elbracht, M.; Meyer, R.; Kricheldorf, K.; Gezer, D.; Eggermann, T.; Betz, B.; Kurth, I.; Teichmann, L.L.; Brümmendorf, T.H.; Germing, U.; et al. Germline Variants in DNA Repair Genes, Including BRCA1/2, May Cause Familial Myeloproliferative Neoplasms. Blood Adv. 2021, 5, 3373–3376. [Google Scholar] [CrossRef]
  8. Farmer, H.; McCabe, H.; Lord, C.J.; Tutt, A.H.J.; Johnson, D.A.; Richardson, T.B.; Santarosa, M.; Dillon, K.J.; Hickson, I.; Knights, C.; et al. Targeting the DNA Repair Defect in BRCA Mutant Cells as a Therapeutic Strategy. Nature 2005, 434, 917–921. [Google Scholar] [CrossRef]
  9. Bryant, H.E.; Schultz, N.; Thomas, H.D.; Parker, K.M.; Flower, D.; Lopez, E.; Kyle, S.; Meuth, M.; Curtin, N.J.; Helleday, T. Specific Killing of BRCA2-Deficient Tumours with Inhibitors of Poly(ADP-Ribose) Polymerase. Nature 2005, 434, 913–917. [Google Scholar] [CrossRef]
  10. Bridges, C.B. The Origin of Variations in Sexual and Sex-Limited Characters. Am. Nat. 1922, 56, 51–63. [Google Scholar] [CrossRef]
  11. Hartwell, L.H.; Szankasi, P.; Roberts, C.J.; Murray, A.W.; Friend, S.H. Integrating Genetic Approaches into the Discovery of Anticancer Drugs. Science 1997, 278, 1064–1068. [Google Scholar] [CrossRef] [PubMed]
  12. Buchholz, T.A.; Wu, X.; Hussain, A.; Tucker, S.L.; Mills, G.B.; Haffty, B.; Bergh, S.; Story, M.; Geara, F.B.; Brock, W.A. Evidence of Haplotype Insufficiency in Human Cells Containing a Germline Mutation in BRCA1 or BRCA2. Int. J. Cancer 2002, 97, 557–561. [Google Scholar] [CrossRef] [PubMed]
  13. Konishi, H.; Mohseni, M.; Tamaki, A.; Garay, J.P.; Croessmann, S.; Karnan, S.; Ota, A.; Wong, H.Y.; Konishi, Y.; Karakas, B.; et al. Mutation of a Single Allele of the Cancer Susceptibility Gene BRCA1 Leads to Genomic Instability in Human Breast Epithelial Cells. Proc. Natl. Acad. Sci. USA 2011, 108, 17773–17778. [Google Scholar] [CrossRef] [PubMed]
  14. Chen, E.; Sook Ahn, J.; Massie, C.E.; Clynes, D.; Godfrey, A.L.; Li, J.; Park, H.J.; Nangalia, J.; Silber, Y.; Mullally, A.; et al. JAK2V617F Promotes Replication Fork Stalling with Disease-Restricted Impairment of the Intra-S Checkpoint Response. Proc. Natl. Acad. Sci. USA 2014, 111, 15190–15195. [Google Scholar] [CrossRef] [PubMed]
  15. Marty, C.; Lacout, C.; Droin, N.; Le Couédic, J.P.; Ribrag, V.; Solary, E.; Vainchenker, W.; Villeval, J.L.; Plo, I. A Role for Reactive Oxygen Species in JAK2 V617F Myeloproliferative Neoplasm Progression. Leukemia 2013, 27, 2187–2195. [Google Scholar] [CrossRef] [PubMed]
  16. Li, J.; Spensberger, D.; Ahn, J.S.; Anand, S.; Beer, P.A.; Ghevaert, C.; Chen, E.; Forrai, A.; Scott, L.M.; Ferreira, R.; et al. JAK2 V617F Impairs Hematopoietic Stem Cell Function in a Conditional Knock-in Mouse Model of JAK2 V617F-Positive Essential Thrombocythemia. Blood 2010, 116, 1528–1538. [Google Scholar] [CrossRef] [PubMed]
  17. Plo, I.; Nakatake, M.; Malivert, L.; De Villartay, J.P.; Giraudier, S.; Villeval, J.L.; Wiesmuller, L.; Vainchenker, W. JAK2 Stimulates Homologous Recombination and Genetic Instability: Potential Implication in the Heterogeneity of Myeloproliferative Disorders. Blood 2008, 112, 1402–1412. [Google Scholar] [CrossRef] [PubMed]
  18. Härtlova, A.; Erttmann, S.F.; Raffi, F.A.M.; Schmalz, A.M.; Resch, U.; Anugula, S.; Lienenklaus, S.; Nilsson, L.M.; Kröger, A.; Nilsson, J.A.; et al. DNA Damage Primes the Type I Interferon System via the Cytosolic DNA Sensor STING to Promote Anti-Microbial Innate Immunity. Immunity 2015, 42, 332–343. [Google Scholar] [CrossRef]
  19. Quintás-Cardama, A.; Kantarjian, H.; Manshouri, T.; Luthra, R.; Estrov, Z.; Pierce, S.; Richie, M.A.; Borthakur, G.; Konopleva, M.; Cortes, J.; et al. Pegylated Interferon Alfa-2a Yields High Rates of Hematologic and Molecular Response in Patients with Advanced Essential Thrombocythemia and Polycythemia Vera. J. Clin. Oncol. 2009, 27, 5418–5424. [Google Scholar] [CrossRef]
  20. Mullally, A.; Bruedigam, C.; Poveromo, L.; Heidel, F.H.; Purdon, A.; Vu, T.; Austin, R.; Heckl, D.; Breyfogle, L.J.; Kuhn, C.P.; et al. Depletion of Jak2V617F Myeloproliferative Neoplasm-Propagating Stem Cells by Interferon-α in a Murine Model of Polycythemia Vera. Blood 2013, 121, 3692–3702. [Google Scholar] [CrossRef]
  21. Austin, R.J.; Straube, J.; Bruedigam, C.; Pali, G.; Jacquelin, S.; Vu, T.; Green, J.; Gräsel, J.; Lansink, L.; Cooper, L.; et al. Distinct Effects of Ruxolitinib and Interferon-Alpha on Murine JAK2V617F Myeloproliferative Neoplasm Hematopoietic Stem Cell Populations. Leukemia 2020, 34, 1075–1089. [Google Scholar] [CrossRef] [PubMed]
  22. Poh, W.; Dilley, R.L.; Moliterno, A.R.; Maciejewski, J.P.; Pratz, K.W.; McDevitt, M.A.; Herman, J.G. BRCA1 Promoter Methylation Is Linked to Defective Homologous Recombination Repair and Elevated MiR-155 to Disrupt Myeloid Differentiation in Myeloid Malignancies. Clin. Cancer Res. 2019, 25, 2513–2522. [Google Scholar] [CrossRef] [PubMed]
  23. Sun, L.; Wu, J.; Du, F.; Chen, X.; Chen, Z.J. Cyclic GMP-AMP Synthase Is a Cytosolic DNA Sensor That Activates the Type I Interferon Pathway. Science 2013, 339, 786–791. [Google Scholar] [CrossRef] [PubMed]
  24. Maxwell, K.N.; Domchek, S.M.; Nathanson, K.L.; Robson, M.E. Population Frequency of Germline BRCA1/2 Mutations. J. Clin. Oncol. 2016, 34, 4183–4185. [Google Scholar] [CrossRef] [PubMed]
  25. Hasselbalch, H.C. A New Era for IFN-α in the Treatment of Philadelphia-Negative Chronic Myeloproliferative Neoplasms. Expert Rev. Hematol. 2011, 4, 637–655. [Google Scholar] [CrossRef] [PubMed]
  26. Essers, M.A.G.; Offner, S.; Blanco-Bose, W.E.; Waibler, Z.; Kalinke, U.; Duchosal, M.A.; Trumpp, A. IFNα Activates Dormant Haematopoietic Stem Cells in Vivo. Nature 2009, 458, 904–908. [Google Scholar] [CrossRef] [PubMed]
  27. Kirschner, M.; Bornemann, A.; Schubert, C.; Gezer, D.; Kricheldorf, K.; Isfort, S.; Brümmendorf, T.H.; Schemionek, M.; Chatain, N.; Skorski, T.; et al. Transcriptional Alteration of DNA Repair Genes in Philadelphia Chromosome Negative Myeloproliferative Neoplasms. Ann. Hematol. 2019, 98, 2703–2709. [Google Scholar] [CrossRef]
  28. Nieborowska-Skorska, M.; Maifrede, S.; Dasgupta, Y.; Sullivan, K.; Flis, S.; Le, B.V.; Solecka, M.; Belyaeva, E.A.; Kubovcakova, L.; Nawrocki, M.; et al. Ruxolitinib-Induced Defects in DNA Repair Cause Sensitivity to PARP Inhibitors in Myeloproliferative Neoplasms. Blood 2017, 130, 2848–2859. [Google Scholar] [CrossRef]
  29. Corrales, L.; McWhirter, S.M.; Dubensky, T.W.; Gajewski, T.F. The Host STING Pathway at the Interface of Cancer and Immunity. J. Clin. Investig. 2016, 126, 2404–2411. [Google Scholar] [CrossRef]
  30. Pantelidou, C.; Sonzogni, O.; Taveira, M.D.O.; Mehta, A.K.; Kothari, A.; Wang, D.; Visal, T.; Li, M.K.; Pinto, J.; Castrillon, J.A.; et al. Parp Inhibitor Efficacy Depends on CD8+ T-Cell Recruitment via Intratumoral Sting Pathway Activation in Brca-Deficient Models of Triple-Negative Breast Cancer. Cancer Discov. 2019, 9, 722–737. [Google Scholar] [CrossRef]
  31. Nambiar, D.K.; Mishra, D.; Singh, R.P. Targeting DNA Repair for Cancer Treatment: Lessons from PARP Inhibitor Trials. Oncol. Res. 2023, 31, 405–421. [Google Scholar] [CrossRef] [PubMed]
  32. Guo, X.X.; Wu, H.L.; Shi, H.Y.; Su, L.; Zhang, X. The Efficacy and Safety of Olaparib in the Treatment of Cancers: A Meta-Analysis of Randomized Controlled Trials. Cancer Manag. Res. 2018, 10, 2553–2562. [Google Scholar] [CrossRef] [PubMed]
  33. McMahon, M.; Frangova, T.G.; Henderson, C.J.; Wolf, C.R. Olaparib, Monotherapy or with Ionizing Radiation, Exacerbates DNA Damage in Normal Tissues: Insights from a New P21 Reporter Mouse. Mol. Cancer Res. 2016, 14, 1195–1203. [Google Scholar] [CrossRef] [PubMed]
  34. Zhao, Q.; Ma, P.; Fu, P.; Wang, J.; Wang, K.; Chen, L.; Yang, Y. Myelodysplastic Syndrome/Acute Myeloid Leukemia Following the Use of Poly-ADP Ribose Polymerase (PARP) Inhibitors: A Real-World Analysis of Postmarketing Surveillance Data. Front. Pharmacol. 2022, 13, 912256. [Google Scholar] [CrossRef]
  35. Baumeister, J.; Chatain, N.; Hubrich, A.; Maié, T.; Costa, I.G.; Denecke, B.; Han, L.; Küstermann, C.; Sontag, S.; Seré, K.; et al. Hypoxia-Inducible Factor 1 (HIF-1) Is a New Therapeutic Target in JAK2V617F-Positive Myeloproliferative Neoplasms. Leukemia 2020, 34, 1062–1074. [Google Scholar] [CrossRef]
  36. Han, L.; Schubert, C.; Köhler, J.; Schemionek, M.; Isfort, S.; Brümmendorf, T.H.; Koschmieder, S.; Chatain, N. Calreticulin-Mutant Proteins Induce Megakaryocytic Signaling to Transform Hematopoietic Cells and Undergo Accelerated Degradation and Golgi-Mediated Secretion. J. Hematol. Oncol. 2016, 9, 45. [Google Scholar] [CrossRef]
Ijms 24 17560 g001
Figure 1. Enhanced double-strand break induction by olaparib in Brca1+/− Jak2V617F cells. (A) Jak2V617F Brca1+/+ and Brca1+/− cells were treated with olaparib (ola, 10 µM), interferon-alpha (IFNα, 10,000 U/mL), or DMSO for 24 h. As a negative control, cells were treated with the ATM inhibitor Ku55933 (Ku, 10 µM) and as a positive control, cells were treated with the topoisomerase II inhibitor etoposide (eto, 10 µM). After treatment, the cells were stained with a phospho-histone H2A.X (Ser139) monoclonal antibody and FxCycle™ Violet stain and then analyzed by flow cytometry (n = 4 of two clones respectively, exemplary flow cytometry plots see Figure S1). (B) Protein levels of γH2AX and protein PARylation were analyzed in Jak2V617F Brca1+/+ and Brca1+/− cells after incubation for 4 h with olaparib (10 µM), IFNα (10,000 U/mL), and DMSO by Western blot (WB) using GAPDH as a loading control. (C) γH2AX and (D) PAR densitometric analyses from four independent WB experiments (relative to GAPDH as loading control and relative to Brca1+/+ DMSO, n = 4 with two clones each). Data are presented as mean ± SD and significances defined as: * p < 0.05 and ** p < 0.01, ns means no significance.
Figure 1. Enhanced double-strand break induction by olaparib in Brca1+/− Jak2V617F cells. (A) Jak2V617F Brca1+/+ and Brca1+/− cells were treated with olaparib (ola, 10 µM), interferon-alpha (IFNα, 10,000 U/mL), or DMSO for 24 h. As a negative control, cells were treated with the ATM inhibitor Ku55933 (Ku, 10 µM) and as a positive control, cells were treated with the topoisomerase II inhibitor etoposide (eto, 10 µM). After treatment, the cells were stained with a phospho-histone H2A.X (Ser139) monoclonal antibody and FxCycle™ Violet stain and then analyzed by flow cytometry (n = 4 of two clones respectively, exemplary flow cytometry plots see Figure S1). (B) Protein levels of γH2AX and protein PARylation were analyzed in Jak2V617F Brca1+/+ and Brca1+/− cells after incubation for 4 h with olaparib (10 µM), IFNα (10,000 U/mL), and DMSO by Western blot (WB) using GAPDH as a loading control. (C) γH2AX and (D) PAR densitometric analyses from four independent WB experiments (relative to GAPDH as loading control and relative to Brca1+/+ DMSO, n = 4 with two clones each). Data are presented as mean ± SD and significances defined as: * p < 0.05 and ** p < 0.01, ns means no significance.
Ijms 24 17560 g001
Ijms 24 17560 g002
Figure 2. Impaired homologous recombination repair mechanism in olaparib-treated Jak2V617F Brca1+/− cells. (A) Jak2V617F Brca1+/+ and Brca1+/− cells have been treated for 24 h with DMSO or olaparib (10 µM), stained with anti-RAD51 and anti-γH2AX antibodies, incubated with anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 594 and counterstained with Hoechst 33342. Images were taken with a Zeiss LSM 710 confocal microscope using Zen software (scale bar = 10 µm). (B) The percentage of cells with ≥10 γH2AX foci was scored of at least 200 cells per condition (n = 4). (C) The percentage of cells with ≥5 RAD51 foci was scored at least 200 cells per condition (n = 4). Data are presented as mean ± SD and significances defined as: * p < 0.05.
Figure 2. Impaired homologous recombination repair mechanism in olaparib-treated Jak2V617F Brca1+/− cells. (A) Jak2V617F Brca1+/+ and Brca1+/− cells have been treated for 24 h with DMSO or olaparib (10 µM), stained with anti-RAD51 and anti-γH2AX antibodies, incubated with anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 594 and counterstained with Hoechst 33342. Images were taken with a Zeiss LSM 710 confocal microscope using Zen software (scale bar = 10 µm). (B) The percentage of cells with ≥10 γH2AX foci was scored of at least 200 cells per condition (n = 4). (C) The percentage of cells with ≥5 RAD51 foci was scored at least 200 cells per condition (n = 4). Data are presented as mean ± SD and significances defined as: * p < 0.05.
Ijms 24 17560 g002
Ijms 24 17560 g003
Figure 3. Olaparib and IFNα reduce cell proliferation and viability and induce apoptosis preferentially in Jak2V617F Brca1+/− cells. (A) Cell viability was analyzed in Jak2V617F Brca1+/+ and Brca1+/− cells treated with olaparib (ola, 10 µM), interferon-alpha (IFNα, 10,000 U/mL) or DMSO by analysis with a CASY cell counter after 24 h, 48 h, and 72 h (n = 3 with two clones each). (B–D) Metabolic activity was assessed by MTT assays in Jak2V617F Brca1+/+ and Brca1+/− cells after treatment for 48 h with DMSO or increasing concentrations of IFNα and an additional fixed concentration of olaparib (10 µM) (n = 3 each). The relative absorption of Brca1+/+ and Brca1+/− cells was compared after treatment with olaparib (10 µM) (B), with IFNα (10,000 U/mL) (C), and with the combination of olaparib (10 µM) and IFNα (10,000 U/mL) (D). (E) Apoptosis was analyzed in 32D Jak2V617F Brca1+/+ and Brca1+/− cells treated with olaparib (10 µM), IFNα (10,000 U/mL) or DMSO for 48 h using AnnexinV-APC/7-AAD through flow cytometry. The experiment was done in triplicates (n = 5 with two clones each). Data are presented as mean ± SD and significances defined as: * p < 0.05, ** p < 0.01, and *** p < 0.001, ns means no significance.
Figure 3. Olaparib and IFNα reduce cell proliferation and viability and induce apoptosis preferentially in Jak2V617F Brca1+/− cells. (A) Cell viability was analyzed in Jak2V617F Brca1+/+ and Brca1+/− cells treated with olaparib (ola, 10 µM), interferon-alpha (IFNα, 10,000 U/mL) or DMSO by analysis with a CASY cell counter after 24 h, 48 h, and 72 h (n = 3 with two clones each). (B–D) Metabolic activity was assessed by MTT assays in Jak2V617F Brca1+/+ and Brca1+/− cells after treatment for 48 h with DMSO or increasing concentrations of IFNα and an additional fixed concentration of olaparib (10 µM) (n = 3 each). The relative absorption of Brca1+/+ and Brca1+/− cells was compared after treatment with olaparib (10 µM) (B), with IFNα (10,000 U/mL) (C), and with the combination of olaparib (10 µM) and IFNα (10,000 U/mL) (D). (E) Apoptosis was analyzed in 32D Jak2V617F Brca1+/+ and Brca1+/− cells treated with olaparib (10 µM), IFNα (10,000 U/mL) or DMSO for 48 h using AnnexinV-APC/7-AAD through flow cytometry. The experiment was done in triplicates (n = 5 with two clones each). Data are presented as mean ± SD and significances defined as: * p < 0.05, ** p < 0.01, and *** p < 0.001, ns means no significance.
Ijms 24 17560 g003
Ijms 24 17560 g004
Figure 4. Hypothesis: PARP inhibition activates the cGAS-STING pathway in Jak2V617F Brca1+/− cells. (1) The Jak2V617F mutation leads to the formation of reactive oxygen species and thereby causes DNA stress, resulting in an increased number of single- and double-strand breaks (SSBs/DSBs). (2) PARP inhibition suppresses the repair of SSBs, resulting in the formation of double-strand breaks (DSBs) that also cannot be repaired sufficiently due to the Brca1 haploinsufficiency. (3) The accumulation of DSBs results in the translocation of DNA fragments into the cytoplasm. (4) cGAS recognizes cytosolic DNA and, upon detection of cytosolic DNA, synthesizes cGAMP. (5) cGAMP is detected by STING and, together with TBK1, phosphorylates and activates the transcription factors NF-κB and IRF3. (6) NF-κB and IRF3 translocate into the nucleus and induce the production of proinflammatory cytokines (e.g., TNF, IL-6, type I interferons). (7) Those cytokines are secreted into the interstitium where they bind to the membrane receptors of the original and the surrounding cells and hence induce a proinflammatory state. Created with Biorender.com (accessed on 17 October 2023).
Figure 4. Hypothesis: PARP inhibition activates the cGAS-STING pathway in Jak2V617F Brca1+/− cells. (1) The Jak2V617F mutation leads to the formation of reactive oxygen species and thereby causes DNA stress, resulting in an increased number of single- and double-strand breaks (SSBs/DSBs). (2) PARP inhibition suppresses the repair of SSBs, resulting in the formation of double-strand breaks (DSBs) that also cannot be repaired sufficiently due to the Brca1 haploinsufficiency. (3) The accumulation of DSBs results in the translocation of DNA fragments into the cytoplasm. (4) cGAS recognizes cytosolic DNA and, upon detection of cytosolic DNA, synthesizes cGAMP. (5) cGAMP is detected by STING and, together with TBK1, phosphorylates and activates the transcription factors NF-κB and IRF3. (6) NF-κB and IRF3 translocate into the nucleus and induce the production of proinflammatory cytokines (e.g., TNF, IL-6, type I interferons). (7) Those cytokines are secreted into the interstitium where they bind to the membrane receptors of the original and the surrounding cells and hence induce a proinflammatory state. Created with Biorender.com (accessed on 17 October 2023).
Ijms 24 17560 g004
Ijms 24 17560 g005
Figure 5. Induction of cGAS-STING pathway target genes by olaparib in Brca1+/− Jak2V617F cells. mRNA levels of Sting1, Stat1, Irf7, Mx1, Oas1, and Isg15 in Jak2V617F Brca1+/+ and Brca1+/− cells treated for 24 h with olaparib (ola, 10 µM), interferon-alpha (IFNα, 10,000 U/mL), the combination, or DMSO (n = 3 with two clones each). Data are presented as mean ± SD and significances defined as: * p < 0.05, ** p < 0.01, and **** p < 0.0001, ns means no significance.
Figure 5. Induction of cGAS-STING pathway target genes by olaparib in Brca1+/− Jak2V617F cells. mRNA levels of Sting1, Stat1, Irf7, Mx1, Oas1, and Isg15 in Jak2V617F Brca1+/+ and Brca1+/− cells treated for 24 h with olaparib (ola, 10 µM), interferon-alpha (IFNα, 10,000 U/mL), the combination, or DMSO (n = 3 with two clones each). Data are presented as mean ± SD and significances defined as: * p < 0.05, ** p < 0.01, and **** p < 0.0001, ns means no significance.
Ijms 24 17560 g005
Ijms 24 17560 g006
Figure 6. cGAS-STING pathway activation augments the production of IFNα in Brca1+/− Jak2V617F cells. (A) Jak2V617F Brca1+/− and Brca1+/+ cells were first treated for 24 h with olaparib (10 µM) and then cultivated in new medium for 4 h. The supernatant (SN) was added to new Brca1+/+ cells for 24 h, and transcriptional levels of the interferon-stimulated genes (ISGs) Mx1, Oas1a, and Isg15 were analyzed by RT-qPCR. As a negative control, the cells were incubated with an IFNαR1 blocking antibody (n = 3 with two clones each). (B) Jak2V617F Brca1+/− and Brca1+/+ cells were treated with olaparib (ola, 10 µM) and the STING inhibitor H-151 (0.75 µM) for 24 h, and gene expression of Mx1, Oas1a and Isg15 was analyzed by RT-qPCR (n = 4 with two clones each). Statistical analysis was performed using one-way ANOVA. Data are presented as mean ± SD and significances defined as: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001, ns means no significance.
Figure 6. cGAS-STING pathway activation augments the production of IFNα in Brca1+/− Jak2V617F cells. (A) Jak2V617F Brca1+/− and Brca1+/+ cells were first treated for 24 h with olaparib (10 µM) and then cultivated in new medium for 4 h. The supernatant (SN) was added to new Brca1+/+ cells for 24 h, and transcriptional levels of the interferon-stimulated genes (ISGs) Mx1, Oas1a, and Isg15 were analyzed by RT-qPCR. As a negative control, the cells were incubated with an IFNαR1 blocking antibody (n = 3 with two clones each). (B) Jak2V617F Brca1+/− and Brca1+/+ cells were treated with olaparib (ola, 10 µM) and the STING inhibitor H-151 (0.75 µM) for 24 h, and gene expression of Mx1, Oas1a and Isg15 was analyzed by RT-qPCR (n = 4 with two clones each). Statistical analysis was performed using one-way ANOVA. Data are presented as mean ± SD and significances defined as: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001, ns means no significance.
Ijms 24 17560 g006
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bermes, M.; Rodriguez, M.J.; de Toledo, M.A.S.; Ernst, S.; Müller-Newen, G.; Brümmendorf, T.H.; Chatain, N.; Koschmieder, S.; Baumeister, J. Exploiting Synthetic Lethality between Germline BRCA1 Haploinsufficiency and PARP Inhibition in JAK2V617F-Positive Myeloproliferative Neoplasms. Int. J. Mol. Sci. 2023, 24, 17560. https://doi.org/10.3390/ijms242417560

AMA Style

Bermes M, Rodriguez MJ, de Toledo MAS, Ernst S, Müller-Newen G, Brümmendorf TH, Chatain N, Koschmieder S, Baumeister J. Exploiting Synthetic Lethality between Germline BRCA1 Haploinsufficiency and PARP Inhibition in JAK2V617F-Positive Myeloproliferative Neoplasms. International Journal of Molecular Sciences. 2023; 24(24):17560. https://doi.org/10.3390/ijms242417560

Chicago/Turabian Style

Bermes, Max, Maria Jimena Rodriguez, Marcelo Augusto Szymanski de Toledo, Sabrina Ernst, Gerhard Müller-Newen, Tim Henrik Brümmendorf, Nicolas Chatain, Steffen Koschmieder, and Julian Baumeister. 2023. "Exploiting Synthetic Lethality between Germline BRCA1 Haploinsufficiency and PARP Inhibition in JAK2V617F-Positive Myeloproliferative Neoplasms" International Journal of Molecular Sciences 24, no. 24: 17560. https://doi.org/10.3390/ijms242417560

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop