Next Article in Journal
High-Throughput Transcriptomics Differentiates Toxic versus Non-Toxic Chemical Exposures Using a Rat Liver Model
Next Article in Special Issue
Identification and Expression Analysis of the Nucleotidyl Transferase Protein (NTP) Family in Soybean (Glycine max) under Various Abiotic Stresses
Previous Article in Journal
The Interactive Complex between Cytomegalovirus Kinase vCDK/pUL97 and Host Factors CDK7–Cyclin H Determines Individual Patterns of Transcription in Infected Cells
Previous Article in Special Issue
Analysis of Raffinose Synthase Gene Family in Bread Wheat and Identification of Drought Resistance and Salt Tolerance Function of TaRS15-3B
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 24
10.3390/ijms242417424
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield

by
Ya-Yi Meng
1,2,3,
Ning Wang
2,
Hai-Yan Zhang
4,
Ran Xu
1,2,3 and
Cheng-Cheng Si
1,2,3,*
1
Collaborative Innovation Center of Nanfan and High-Efficiency Tropical Agriculture, Hainan University, Sanya 572025, China
2
Key Laboratory of Quality Regulation of Tropical Horticultural Crop in Hainan Province, School of Tropical Agriculture and Forestry (School of Agricultural and Rural, School of Rural Revitalization), Hainan University, Danzhou 571700, China
3
School of Breeding and Multiplication (Sanya Institute of Breeding and Multiplication), Hainan University, Sanya 572025, China
4
Scientific Observation and Experimental Station of Tuber and Root Crops in Huang-Huai-Hai Region of Agriculture Ministry, Crop Research Institute, Shandong Academy of Agricultural Sciences, Ji’nan 250100, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(24), 17424; https://doi.org/10.3390/ijms242417424
Submission received: 17 November 2023 / Revised: 6 December 2023 / Accepted: 10 December 2023 / Published: 13 December 2023
(This article belongs to the Special Issue Abiotic Stress in Plant: From Gene to the Fields 2.0)
Browse Figures
Review Reports Versions Notes

Abstract

:
Ammonium, as a major inorganic source of nitrogen (N) for sweet potato N utilization and growth, is specifically transported by ammonium transporters (AMTs). However, the activities of AMT family members in sweet potatoes have not been analyzed. In the present study, the sweet potato cultivar ‘Pushu 32’, which is planted in a large area in China, was used in field experiments at the Agricultural Base of Hainan University (20°06′ N, 110°33′ E) in 2021, and Sanya Nanfan Research Institute of Hainan University (18°30′ N, 109°60′ E) in 2022. Four N levels were tested: 0, 60, 120, and 180 kg ha−1. The results are as follows. Twelve IbAMT genes were identified in the sweet potato genome, which were classified into three distinct subgroups based on phylogeny; the same subgroup genes had similar properties and structures. IbAMT1.3 and IbAMT1.5 were mostly expressed in the storage roots under N deficiency. Compared with the NN and HN groups, IbAMT1.3 and IbAMT1.5 expressions, N content in storage roots, N uptake efficiency at the canopy closure, N fertilization contribution rates, number of storage roots per plant, storage root weight, and yield were all increased in the MN group. Furthermore, there was a significant positive correlation between the expressions of IbAMT1.3 and IbAMT1.5 with N content in the storage roots of sweet potato. In a word, IbAMT1.3 and IbAMT1.5 may regulate N utilization, affect the development of the storage root. and determine the yield of sweet potato. The results provide valuable insights into the AMT gene family’s role in the use of N and effects on storage root development and yield in sweet potatoes.

1. Introduction

Sweet potato (Ipomoea batatas (L.) Lam.) yield is determined by storage root development, and nitrogen (N) is the key nutrient regulating storage root development [1]. A too high or too low application of N is not conducive to storage root formation: N deficiency, which reduces dry matter accumulation, is not conducive to storage root formation and reduces the yield of sweet potato [2], although N use efficiency is higher under N deficiency condition [3]. Applying the appropriate amount of N is beneficial for increasing the number of storage roots, the dry matter accumulation in storage roots, and the yield of sweet potato [3,4,5]. Excessive N application leads to the excessive growth of shoots [6], increased plant N accumulation [7,8,9], and increased dry matter accumulation in the whole plant, but to delayed storage root formation, significantly reduced N use efficiency (NUE), and decreased yield of sweet potato [10,11,12]. Therefore, proper N application is an effective measure to promote storage root formation and increase the yield of sweet potato.
Both ammonium and nitrate are crucial for plant growth and yield. Ammonium requires less energy to assimilate; therefore, ammonium nitrogen is preferentially absorbed [13] and is considered as a superior nitrogen source [14]. Urea is the most commonly used N fertilizer because of its low cost, high N content, and rapid N release [15]; it can be hydrolyzed into ammonium (NH4+) by urease [16]. The transportation of NH4+ by the roots from the soil is the start of ammonia assimilation and the foundational step for N utilization [17]. The ammonium transporter (AMT) exists widely in plants, which is a kind of plasma membrane protein that exclusively transports NH4+ [18]. The first ammonium transporter AtAMT1.1 was isolated from the model plant Arabidopsis through growth complementarity [19]. Subsequently, several AMT genes have been identified in Arabidopsis, rice, tomato, and other plant species [20,21,22]. Plant AMT genes form a polygenic family, divided into AMT1s and AMT2s subfamilies according to gene homology [23]. For example, there are five AMT1 genes and one AMT2 gene in Arabidopsis thaliana [24]. Among them, AtAMT1.2, AtAMT1.3, AtAMT1.5, and AtAMT2 were found to be mainly expressed in the roots; AtAMT1.4 showed pollen-specific expression; and AtAMT1.1 was expressed in roots, stems, and leaves [25,26]. In rice, OsAMT1;2 and OsAMT1;3 are mainly expressed in the roots, while OsAMT1;1, OsAMT2;1, and OsAMT3;1 are expressed in both the roots and shoots [19]. In tomatoes, SlAMT1-1 and SlAMT1-2 were found to be mainly expressed in roots and leaves and SlAMT1-3 in seedlings and leaves [27]. AMT genes are differentially expressed. Additionally, the expression of the AMT gene is affected by nitrogen levels and nitrogen forms. Studies on cassava showed that the expression of all MeAMT1 genes in roots was upregulated under low NH4+ (NH4Cl) stress [28]. After rape seedlings that were cultured in water for 10 days under N (NH4Cl)-suitable conditions were transferred to a N (NH4Cl)-deficient environment for 5 days, it was found that the expression of all AMT genes in the roots was upregulated [29]. In rice, the transcript levels of OsAMT1.1 in roots exhibited a several-fold decrease within 48 h when plants acclimated to 10 μM external NH4+ ((NH4)2SO4) for 3 weeks were transferred to 10 mM NH4+ ((NH4)2SO4) [30]. This suggests that increased NH4+ concentrations significantly reduce the expression of OsAMT1.1. Compared with ammonium, nitrate can inhibit the absorption of ammonium salts, resulting in a decrease in the expression of OsAMT genes (OsAMT1;1, OsAMT1;2, and OsAMT1;3) under ammonium–nitrate mixed conditions [31]. Studies on Arabidopsis revealed that ammonium transporters, such as AtAMT1.1 AtAMT1.3 and AtAMT2, are transcriptionally regulated by urea [32]. Therefore, it can be concluded that urea has the ability to affect the activity of AMT genes, and the upregulation of these genes can enhance the plant roots’ ability to uptake NH4+. However, compared to other crops, there is a lack of research on the AMT gene family in sweet potatoes and the function of IbAMT transporters in NH4+ absorption and utilization. Additionally, it remains unclear whether the expression of IbAMTs is related to sweet potato storage root development and yield under different nitrogen treatments.
To address this gap in knowledge, this study aimed to identify the members of the AMT gene family in sweet potatoes and screen for key IbAMT genes that may regulate N utilization and impact storage root development and yield in sweet potatoes. The findings of this study provide a theoretical basis for further investigation into the function and mechanism of IbAMT regulating N uptake and utilization in sweet potatoes.

2. Results

2.1. Yield and Agronomic Traits at Harvest

The effect of N on yield was similar in both years (Table 1). The number of storage roots per plant and storage root weight and yield increased first and then decreased with increasing N application, with the highest value recorded in the MN treatment. The difference between MN and NN was significant (p < 0.05).
In Table 2, the results of two years of field experiments showed that the leaf, petiole, and stem weight increased significantly (p < 0.05) with increasing N application. Storage root weight per plant increased first and then decreased with increasing N application, with the peak recorded in the MN treatment. The difference between MN and NN was significant (p < 0.05).

2.2. Agronomic Traits at Canopy Closure

Figure 1 shows the sweet potato in the MN treatment grew best among the four N levels (Figure 1). The weight of the leaves, petioles, and stems increased first and then decreased with the increase in N application and reached a peak in MN in 2021 and 2022 (Figure 2). Compared with NN, these values were significantly higher in MN (p < 0.05).
In both years at canopy closure, with the increase in N application, number of storage roots per plant, storage root weight, and storage root weight per plant increased first and then decreased (Table 3), and reached the peak in the MN treatment. There was a significant difference between MN and NN (p < 0.05).

2.3. N Content

In 2021 and 2022 (Figure 3), at canopy closure, with increasing N application, the N content in the leaf, petiole, stem, and storage root increased first and then decreased, reaching the maximum in MN, which was significantly different from NN (p < 0.05). At harvest, the N content in the leaf, petiole, and stem increased with the increase in the N application rate, and the difference was significant between MN and NN (p < 0.05). The N content in the storage root increased first and then decreased with the increase in N application, reaching the maximum in MN, which was significantly different from NN (p < 0.05).

2.4. N Use Efficiencies

N uptake efficiency increased first and then decreased with the increase in N application, reaching a peak in the MN treatment, and MN was significantly different from NN at canopy closure (p < 0.05). However, N uptake efficiency significantly decreased with the increase in N application at harvest time (p < 0.05). N use efficiency significantly decreased with the increase in N application (p < 0.05). N fertilization contribution rates increased first and then decreased with the increase in N application and reached a peak in the MN treatment. MN was significantly different from NN (p < 0.05) (Table 4).

2.5. Genome-Wide Identification

After removing redundant entries, 12 AMT genes with the specific domain were identified from the sweet potato genome database via a BLAST search and TBtools software, from IbAMT1.1 to IbAMT1.5 and IbAMT2.1 to IbAMT2.7 based on their location on the chromosomes (Figure S1) and the result of the phylogenetic tree (Figure 4). The protein sequences of the IbAMT protein comprised 327–718 amino acids (aa), and the predicted molecular weights varied from 35,229.26 (IbAMT2.6) to 76,762.08 Da (IbAMT1.3). The range of the theoretical isoelectric point (pI) was 5.94 (IbAMT1.1)—8.77 (IbAMT2.2), and the instability index ranged from 23.74 (IbAMT1.4) to 45.62 (IbAMT1.3). Furthermore, subcellular localization prediction showed that most of the IbAMT gene family members are located on the plasma membrane (Table 5).

2.6. Phylogenetic Analysis

The determined full-length amino acid sequences from seven different species were aligned using ClustalW, and then a phylogenetic analysis was performed based on the multiple alignments results. The phylogenetic tree shows that the AMT proteins are divided into two subfamilies, and AMT2 can be further divided into two clusters, while AMT1 members are all concentrated in AMT1 (Figure 4), confirming that the AMT1 gene has were more conserved than the AMT2 gene during evolution.

2.7. Gene Structure and Motif Composition

The structure of IbAMT proteins and genes were further analyzed, including the IbAMT conserved motif and the conserved domain according to the evolutionary relationship (Figure 5). In the phylogenetic tree, the similarities between motif compositions, gene structures, and similarity alignment of AMT proteins in the same subgroup suggest that IbAMT genes were conserved during evolution (Figure 5, Table S3). Five conserved motifs were identified, and motif 2 is highly conserved in the IbAMT family, whereas motifs 5 are present only in the IbAMT1 subfamily (Figure 5B and Figure S2). In Figure 5C, IbAMT1.2 and IbAMT1.4 do not contain any introns, and members in the AMT2 subfamily contain more introns than members in the AMT1 subfamily.

2.8. Synteny Analysis

Gene family expansion and genomic evolution mechanisms depend on the gene duplication events that occurred during plant evolution [33,34]. We looked for duplication events and found three pairs of tandem AMT duplicated genes in the sweet potato chromosome (Figure 6), suggesting that some IbAMT genes may have been generated via gene duplication, and the tandem duplication played a significant role in the expansion of the IbAMT family. Moreover, the IbAMT gene family was subjected to strong purification selection pressure during evolution, because the Ka/Ks values of the syntenic gene pairs in this study were less than one (Table S4).
Synteny analysis is a critical analytical strategy in comparative genomics that plays an essential role in assessing the molecular evolutionary relationships between species [35]. To better understand the phylogenetic relationships among the AMT family in plants, comparative syntenic maps of associations among sweet potato AMT and those found in two wild sweet potato species (Ipomoea trifida and Ipomoea triloba), cassava, tomato, Arabidopsis thaliana, and rice were constructed (Figure 7). Among all the IbAMT genes, 10 IbAMT genes (IbAMT1.1, IbAMT1.2, IbAMT1.3, IbAMT1.4, IbAMT1.5, IbAMT2.1, IbAMT2.3, IbAMT2.4, IbAMT2.5, IbAMT2.7) displayed a syntenic relationship with other crops.

2.9. Analysis of Cis-Regulatory Elements

Characterization of the promoter regions of genes is essential for understanding potential transcriptional regulatory mechanisms. PlantCare was used to analyze the 2000 bp upstream sequence of the starting point of IbAMT translation to detect cis elements. A total of 39 types of cis-regulatory elements (CREs) were detected in the promotor regions (Figure 8). According to the biological function of the tested elements, they can be divided into four categories, including light-responsive elements, hormone-responsive elements, stress-related elements, plant-development-related elements (Figure S3).

2.10. qRT-PCR Expression Analysis

Because AMT1 play a more important role in NH4+ uptake than AMT2 [25,26], we selected all AMT1s to design primers to determine their expressions. To understand the response of IbAMT1 genes to NH4+ deficiency, the expressions of IbAMT1 genes were analyzed in different tissues under NN using qRT-PCR. As shown in Figure 9, IbAMT1.1 displayed an overall lower expression level than the other genes, and IbAMT1.2 and IbAMT1.4 were expressed to higher levels in the shoots than in the storage roots. Notably, the expressions of IbAMT1.3 and IbAMT1.5 in the storage roots were significantly higher than those in the leaves, petioles, and stems (p < 0.05).
Figure 10 shows that the expression level of IbAMT1 genes was the highest in the leaves in the MN treatment, and the difference was significant (p < 0.05), except for IbAMT1.1. In the petioles, the expression level of IbAMT1 genes of MN was significantly higher (p < 0.05) than that in NN. The expression level of IbAMT1 genes was the highest in stems in MN, and the difference was significant (p < 0.05), except for IbAMT1.3. In the storage roots, the expression level of IbAMT1 genes was the highest in MN, and the difference was significant (p < 0.05). The expression level of the IbAMT1.5 gene was the highest, followed by IbAMT1.3.

2.11. Relationship between N Content and IbAMT1 Gene Expression

As shown in Figure 11, the expression of IbAMT1 genes positively correlated with the N content in storage roots (r > 0). Among them, the expression of IbAMT1.3 had a significant correlation (r = 0.97 *) with the N content, and the expression of IbAMT1.5 had an extremely significant correlation (r = 1.00 ***) with the N content.

3. Discussion

3.1. Effect of N Uptake and Utilization on Growth, Development, and Yield

Nitrogen (N) is closely related to sweet potato yield [36]. Applying an appropriate amount of N is beneficial for increasing the number of storage roots, storage root weight, and yield of sweet potato [4,11]. The results of this study showed that the storage root number per plant, storage root weight, storage root weight per plant at canopy closure and harvest, and yield increased first and then decreased with increasing N application, which are findings similar to those reported in previous studies [7,37]. Meanwhile, compared with NN, the yield, storage root number per plant, and storage root weight in the MN treatment were significantly higher (p < 0.05). Additionally, MN plants had significantly increased leaf, petiole, and stem weight (p < 0.05) compared with NN plants at canopy closure and harvest. The above results showed that MN coordinated the development of N sources and sinks in sweet potato, which is similar to the results of previous studies on sweet potato [5,9]. Thus, the optimum N application rate is 120 kg ha−1 (MN) in this study.
N is the key nutrient element that regulates the growth and development of sweet potato [7], and N uptake is mainly concentrated within 60 DAP in sweet potato [38]. The results of present study support this conclusion: the N content in plant at canopy closure (50 DAP) was much higher than that at harvest. In this study, the N content in the leaf, petiole, stem, and storage root and N uptake efficiency increased at first and then decreased with the increase in N application, being highest in the MN treatment, and MN was significantly (p < 0.05) different from NN at 50 DAP. At harvest, the storage roots’ N content and NFCR increased first and then decreased with the increase in N application and were the highest in the MN treatment, which was significantly (p < 0.05) different from the NN treatment. The N contents in the leaf, petiole, and stem increased with the increase in N application. results are similar to those in previous studies on maize, wheat, and sweet potato [3,39,40,41]. Moreover, N use efficiency decreased with the increase in N application rate, mainly because the increase in the N content in shoots was higher than that in the storage roots with the increase in N application. This finding is consistent with those of previous studies by Du et al. [10,42]. To summarize, the main reasons for the increase in the number of storage roots per plant and storage root weight and yield in the MN plants may be the increase in the N content in the storage roots and NFCR. Previous studies in sweet potato and wheat support this conclusion [3,43].

3.2. Relationship between AMT Gene Family and N Uptake and Utilization

Sweet potato prefer ammonium over nitrate [44,45], and the ammonium transporter (AMT) plays crucial roles in ammonium transport [18]. The AMT gene family has been identified in many plants such as Arabidopsis, tomato, rice, and cassava [23,27,28,46,47] but not sweet potato. We performed a genome-wide analysis to identify 12 AMT family genes that belong to two subfamilies in sweet potato. The phylogenetic analyses of the AMT proteins among sweet potato, Arabidopsis, rice, tomato, cassava, soybean, and maize AMT proteins indicated that the AMT of the studied species can be divided into three groups according to homology [48]. Furthermore, IbAMT1.3, AtAMT1.1, and SlAMT1.1 are homologous, and IbAMT1.5 shows a close relationship with AtAMT1.2 and SlAMT1.2. Phylogenetic and synteny analyses suggest that IbAMT genes were conserved during evolution. The differential expression of the AMT genes in the different plant tissues has been reported in many species. This study shows that IbAMT1.3 and IbAMT1.5 are mainly expressed in the roots, and their homologous genes AMT1.1 and AMT1.2 from tomato and Arabidopsis are also expressed in the roots [25,26,27]. Gansel suggested that NH4+ uptake is predominantly regulated by the local N status of the roots [49]. The upregulation of AMT genes can improve the ability of plant roots to uptake NH4+ [28,29,30]. In this study, the expressions of IbAMT1.3 and IbAMT1.5 in the roots increased first and then decreased with the increase in the N application at 50 DAP, which is similar to the findings of a previous study [19]. The expressions of IbAMT1.3 and IbAMT1.5 in the roots was the highest in the MN treatment, which was significantly higher than that in the NN treatment, indicating that the N uptake capacity of the roots of sweet potato was the highest in the MN treatment. Furthermore, there was a significant positive correlation between the expressions of IbAMT1.3 and IbAMT1.5 in the roots and the content of N in the storage roots, suggesting that IbAMT1.3 and IbAMT1.5 are related to N uptake. In this study, two candidate IbAMT1 genes (IbAMT1.3 and IbAMT1.5) for efficient N utilization in sweet potato were identified, but their molecular mechanism remains to be verified.

4. Materials and Methods

4.1. Experimental Site and Plant Material

Field experiments were conducted using sweet potato ‘Pushu 32’ (Ipomoea batatas (L.) Lam.) from October 2021 to February 2022 at the Agricultural Base of Hainan University (20°06′ N, 110°33′ E) and from October 2022 to February 2023 at Sanya Nanfan Research Institute of Hainan University (18°30′ N, 109°60′ E), respectively. In Table 6, climate data for the two growth seasons are listed, which were provided by Hefeng weather (https://www.qweather.com/ (accessed on 5 September 2023)); the details are shown in Table 1. The soil type of both fields was sandy loam. In Haikou, the organic matter concentration in the 0–20 cm soil layer of the field was 1.4%, and the total and available N, P, and K concentrations were 87.65, 16.00, and 77.80 mg kg−1 dry soil, respectively. In Sanya, the organic matter concentration was 1.7%, and the total and available N, P, and K concentrations were 83.67, 18.83, and 76.56 mg kg−1 dry soil, respectively.

4.2. Field Experiments

For the field experiments, we adopted a random blocks design with three replications. The used fertilizers were CH4N2O (urea, 46%), K2O (potassium sulfate, 50%), and P2O5 (calcium superphosphate, 16%), which were provided by Sinofert Holdings Limited (Beijing, China). Four different N fertilizer applications treatments were used: 0 kg ha−1 (NN), 60 kg ha−1 (LN), 120 kg ha−1 (MN), and 180 kg ha−1 (HN). Potassium fertilizer at a level of 240 kg K ha−1 and phosphate fertilizer at a level of 240 kg P ha−1 were applied in all treatments. The four treatment groups, each in quadruplicate, were allocated to different subplots. Each subplot had an area of 16 m2, with a row spacing of 0.8 m. The slips were spaced at 0.20 m and were planted at a depth of approximately 0.10 m in soil beds.

4.3. Plant Sampling and Analysis

The fresh samples were collected t 50 days after planting (DAP). The leaves, petioles, stems, and roots of each plant were mixed and then cut into 1 cm pieces, separately, then rapidly frozen with liquid N and stored at −80 °C for later enzymatic activity measurements and qRT-PCR. At canopy closure (50 DAP) and harvest (150 DAP) in the field, we selected five plants to investigate the fresh weight of the leaves, petioles, stems, and storage roots, and number of storage roots in sweet potato. Then, the plants were sterilized at 105 °C, dried at 60 °C, and the dry weight was recorded. Last, the dried plants were ground to powder and stored in a desiccator prior to quantification of N content. At harvest (150 DAP), roots that were greater than 1.0 cm in diameter were selected as storage roots. The number of storage roots per plant was counted, and the fresh weight of storage root was weighed to calculate the yield.

4.4. Total N Content

A Dumas N analyzer was used to determine the N content in different parts of sweet potato during the canopy closure and harvest. The Dumas N Analyzer uses the Primacs SN100 Dumas N Analyzer from SKALAR (Breda, The Netherlands).

4.5. Calculations

The indicators were calculated as follows [3,50,51,52,53]:
N accumulation amount (g) = Plant dry matter accumulation × Plant N content
N uptake efficiency (kg kg−1) = Plant N accumulation/Soil available N
N use efficiency (kg kg−1) = Dry matter quality of storage roots/Plant N accumulation
N fertilization contribution rates (NFCR) = (Yield in N application area − Yield in non-N application area)/Yield in N application area

4.6. Sweet Potato AMT Family Genes’ Identification and Analysis

A hidden Markov model (HMM) describing the ammonium transporter domain (PF00909) was downloaded from the Pfam database (http://pfam.xfam.org/ (accessed on 25 April 2022)). This model was used to identify AMT proteins from the sweet potato genome (https://sweetpotao.com/ (accessed on 25 April 2022)) using a HMMER search program with an E-value cut of 1 × 10−5. All potential proteins were confirmed using Pfam, CDD (https://www.ncbi.nlm.nih.gov/cdd/ (accessed on 12 August 2022)), and SMART (http://smart.embl.de/smart/batch.pl (accessed on 12 August 2022)). ExPASy-ProtParam (http://web.expasy.org/protparam/ (accessed on 13 August 2022)) was used to analyze the physicochemical properties, the protein’s molecular weight (MW), and theoretical isoelectric point (pI) of the identified AMT proteins. WoLF PSORT Prediction (https://wolfpsort.hgc.jp/ (accessed on 2 November 2023)) was used to analyze the subcellular localization. The chromosome gene density and IbAMT locations on chromosomes were visualized using TBtools v1.098669 [54].

4.7. Phylogenetic Analysis

AMT proteins from Arabidopsis, rice (Oryza sativa), soybean (Glycine max) [55], maize (Zea mays) [56], cassava (Manihot esculenta Crantz) [23,28], and tomato (Solanum lycopersicum) [27] were downloaded from the TAIR (http://www.arabidopsis.org/ (accessed on 25 April 2022)), NCBI (https://www.ncbi.nlm.nih.gov/ (accessed on 25 April 2022)), and Phytozome (https://phytozome-next.jgi.doe.gov/ (accessed on 25 April 2022)) databases. Sequence similarity analysis was performed using the CLUSTALW website (https://www.genome.jp/tools-bin/clustalw (accessed on 13 August 2022)). The amino acid sequences of the seven species of AMT proteins were aligned using ClustalW [57]. Using the maximum likelihood (ML) method with 1000 bootstrap replications, a phylogenetic tree was generated with MEGA 11 (Arizona State University, Tempe, AZ, USA) software and clarified using the EvolView online tool (http://www.evolgenius.info/evolview (accessed on 14 May 2023))).

4.8. Conserved Motifs, Gene Structures, and Chromosomal Distribution Analysis

The amino acid sequences of the IbAMT proteins were aligned using ClustalW. Using the maximum-likelihood (ML) method with 1000 bootstrap replications, a phylogenetic tree was generated with MEGA 11 (Arizona State University, Tempe, AZ, USA) software. A conserved motif search was performed on IbAMT proteins using Multi Em for Motif Elicitation (http://meme-suite.org/tools/meme (accessed on 13 August 2022)) using the default parameters. The maximum number of motifs was set to 5 (width range = 1–100 motifs). Exon/intron information of AMT genes, including mRNA, CDS, and untranslated region (UTR) locations, were extracted from the sweet potato genome in a general feature format (GFF) file using a Biolinux system. Gene structure was visualized using TBtools v1.098669 [54].

4.9. Ka/Ks Analyses and Gene Collinearity

The nucleotide substitution parameters Ks (synonymous) and Ka (nonsynonymous) of the duplicated genes were assessed using TBtools v1.098669 [54], and then the Ka/Ks ratio was calculated [23]. The gene duplication events of sweet potato AMT and collinearity analysis with six other species were assessed and performed, respectively, according to the method of Yao et al. [58].

4.10. Cis-Regulatory Elements

Promoter sequences were extracted from the sweet potato genome database. The cis-regulatory elements were scanned into PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ (accessed on 24 August 2022)) and visualized using TBtools v1.098669 [54].

4.11. qRT-PCR Analysis

Total RNA was extracted using an RNA extraction kit according to the manufacturer’s protocol (Tiangen, Beijing, China, DP437). One microgram of RNA was reverse-transcribed to cDNA using HiScript II Q RT SuperMix for quantitative real-time PCR (qRT-PCR) (Vazyme, Nanjing, China, R223). To detect the transcript levels of the IbAMT genes in response to low N, quantitative qRT-PCR was performed with gene-specific primers using TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, Tokyo, Japan, RR820A) on a qRT-PCR machine (qTOWER3G, Jena, Germany) for the qRT-PCR reaction. The housekeeping gene Actin was used as an internal control [59]. The relative expressions were calculated using the 2−∆∆CT method. Three independent biological replicates were conducted. The primers used in this experiment are shown in Table 7.

4.12. Statistical Analysis

All data were statistically analyzed using Microsoft Excel 2003 (Microsoft, Redmond, WD, USA) to calculate means. The analytics software program SPSS 19.0 (IBM, Armonk, NY, USA) was used to conduct one-factor ANOVA, two-way ANOVA, and Duncan’s multiple range test.
Graphs in this study were visualized using GraphPad Prism 8.0.2.263 (GraphPad Software Inc., San Diego, CA, USA, www.graphpad.com (accessed on 24 August 2022)), TBtools v1.098669 [54], and R 4.0.2 [60].

5. Conclusions

This study explored the regulatory impacts of nitrogen (N) levels on N absorption and utilization, as well as the growth, development, and yield of sweet potato in a field experiment, identifying an optimum N application rate of 120 kg ha⁻1. Utilizing bioinformatics analysis and quantitative reverse-transcription PCR (qRT-PCR), two candidate IbAMT1 genes (IbAMT1.3 and IbAMT1.5) related to N uptake and accumulation in sweet potato were identified, establishing a basis for subsequent investigations into the molecular mechanism of efficient N utilization in sweet potato.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms242417424/s1.

Author Contributions

Supervision, funding acquisition, experiment design, writing—review and editing, C.-C.S.; experiment, data analysis, visualization, writing—original draft, Y.-Y.M.; experiment, N.W.; provide experimental materials, experiment design, H.-Y.Z.; data analysis, R.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant no. 32060716), the Hainan Province Science and Technology Special Fund (grant no. ZDYF2022XDNY264), the Natural Science Foundation of Hainan Province (grant no. 320QN190), and the Project of Sanya Yazhou Bay Science and Technology City (grant no. SCKJ-JYRC-2023-24).

Data Availability Statement

Data are available on request due to restrictions, e.g., privacy-based or ethical restrictions.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ravi, V.; Saravanan, R. Fruit, Vegetable and Cereal Science and Biotechnology Crop Physiology of Sweetpotato. Fruit Veg. Cereal Sci. Biotechnol. 2012, 6, 17–29. [Google Scholar]
  2. Darko, C.; Yeboah, S.; Amoah, A.; Opoku, A.; Berchie, J.N. Productivity of sweet potato (Ipomoea batatas (L) Lam) as influenced by fertilizer application in different agro-ecologies in Ghana. Sci. Afr. 2020, 10, e00560. [Google Scholar] [CrossRef]
  3. Wu, C.-H.; Liu, Q.; Kong, F.-M.; Li, H.; Shi, Y.-X. Effects of Nitrogen Application Rates on Root Yield and Nitrogen Utilization in Different Purple Sweetpotato Varieties. Acta Agron. Sin. 2016, 42, 113–122. [Google Scholar] [CrossRef]
  4. Njoku, J.C.; Okpara, D.A.; Asiegbu, J.E. Growth and yield responses of sweet potato to inorganic nitrogen and potassium in a tropical ultisol. Niger. Agric. J. 2001, 32, 295–310. [Google Scholar] [CrossRef]
  5. Ning, Y.-W.; Ma, H.-B.; Zhang, H.; Wang, J.-D.; Xu, X.-J.; Zhang, Y.-C. Response of sweetpotato in source-sink relationship establishment, expanding, and balance to nitrogen application rates. Acta Agron. Sin. 2015, 41, 432–439. [Google Scholar] [CrossRef]
  6. Njiti, V.N.; Xia, Q.; Tyler, L.S.; Stewart, L.D.; Tenner, A.T.; Zhang, C.; Alipoe, D.; Chukwuma, F.; Gao, M. Influence of Prohexadione Calcium on Sweetpotato Growth and Storage Root Yield. HortScience Horts 2013, 48, 73–76. [Google Scholar] [CrossRef]
  7. Duan, W.; Zhang, H.; Xie, B.; Wang, B.; Hou, F.; Li, A.; Dong, S.; Qin, Z.; Wang, Q.; Zhang, L. Nitrogen utilization characteristics and early storage root development in nitrogen-tolerant and nitrogen-susceptible sweet potato. Physiol. Plant. 2021, 173, 1090–1104. [Google Scholar] [CrossRef]
  8. Sawicka, B.; Pszczółkowski, P.; Krochmal-Marczak, B.; Barbaś, P.; Özdemir, F.A. The effects of variable nitrogen fertilization on amino acid content in sweet potato tubers (Ipomoea batatas L. [Lam.]) cultivated in central and eastern Europe. J. Sci. Food Agric. 2020, 100, 4132–4138. [Google Scholar] [CrossRef]
  9. Taranet, P.; Harper, S.; Kirchhof, G.; Fujinuma, R.; Menzies, N. Growth and yield response of glasshouse- and field-grown sweetpotato to nitrogen supply. Nutr. Cycl. Agroecosyst. 2017, 108, 309–321. [Google Scholar] [CrossRef]
  10. Du, X.; Xi, M.; Kong, L. Split application of reduced nitrogen rate improves nitrogen uptake and use efficiency in sweetpotato. Sci. Rep. 2019, 9, 14058. [Google Scholar] [CrossRef]
  11. Xiaoguang, C.; Meng, K.; Zhonghou, T.; Aijun, Z.; Hongmin, L. The use of humic acid urea fertilizer for increasing yield and utilization of nitrogen in sweet potato. Plant Soil Environ. 2017, 63, 201–206. [Google Scholar] [CrossRef] [PubMed]
  12. Alves, A.; Oliveira, A.; Alves, E.; Oliveira, A.; Cardoso, E.; Matos, B. Management of nitrogen fertilization for sweet potato: Sources and application parceling. Ciência E Agrotecnol. 2009, 33, 1554–1559. [Google Scholar] [CrossRef]
  13. Bloom, A.J.; Sukrapanna, S.S.; Warner, R.L. Root Respiration Associated with Ammonium and Nitrate Absorption and Assimilation by Barley. Plant Physiol. 1992, 99, 1294–1301. [Google Scholar] [CrossRef] [PubMed]
  14. Masumoto, C.; Miyazawa, S.; Ohkawa, H.; Fukuda, T.; Taniguchi, Y.; Murayama, S.; Kusano, M.; Saito, K.; Fukayama, H.; Miyao, M. Phosphoenolpyruvate Carboxylase Intrinsically Located in the Chloroplast of Rice Plays a Crucial Role in Ammonium Assimilation. Proc. Natl. Acad. Sci. USA 2010, 107, 5226–5231. [Google Scholar] [CrossRef] [PubMed]
  15. Cheng, W.; Sudo, S.; Tsuruta, H.; Yagi, K.; Hartley, A. Temporal and Spatial Variations in N2O Emissions from a Chinese Cabbage Field as a Function of Type of Fertilizer and Application. Nutr. Cycl. Agroecosyst. 2006, 74, 147–155. [Google Scholar] [CrossRef]
  16. Qiqige, S.; Liguo, J.; Qin, Y.; Chen, Y.; Fan, M. Effects of Different Nitrogen Forms on Potato Growth and Development. J. Plant Nutr. 2017, 40, 1651–1659. [Google Scholar] [CrossRef]
  17. Ninnemann, O.; Jauniaux, J.; Frommer, W. Identification of a high affinity NH4+ transporter from plants. EMBO J. 1994, 13, 3464–3471. [Google Scholar] [CrossRef]
  18. Li, B.-Z.; Merrick, M.; Li, S.-M.; Li, H.-Y.; Zhu, S.-W.; Shi, W.-M.; Su, Y.-H. Molecular Basis and Regulation of Ammonium Transporter in Rice. Rice Sci. 2009, 16, 314–322. [Google Scholar] [CrossRef]
  19. Loqué, D.; Wirén, N. Regulatory levels for the transport of ammonium in plant roots. J. Exp. Bot. 2004, 55, 1293–1305. [Google Scholar] [CrossRef]
  20. Hao, D.L.; Zhou, J.Y.; Yang, S.Y.; Qi, W.; Yang, K.J.; Su, Y.H. Function and Regulation of Ammonium Transporters in Plants. Int. J. Mol. Sci. 2020, 21, 3557. [Google Scholar] [CrossRef]
  21. Li, H.; Han, J.L.; Chang, Y.H.; Lin, J.; Yang, Q.S. Gene characterization and transcription analysis of two new ammonium transporters in pear rootstock (Pyrus betulaefolia). J. Plant Res. 2016, 129, 737–748. [Google Scholar] [CrossRef] [PubMed]
  22. Sun, L.; Di, D.W.; Li, G.; Li, Y.; Kronzucker, H.J.; Shi, W. Transcriptome analysis of rice (Oryza sativa L.) in response to ammonium resupply reveals the involvement of phytohormone signaling and the transcription factor OsJAZ9 in reprogramming of nitrogen uptake and metabolism. J. Plant Physiol. 2020, 246–247, 153137. [Google Scholar] [CrossRef] [PubMed]
  23. Xia, J.; Wang, Y.; Zhang, T.; Pan, C.; Ji, Y.; Zhou, Y.; Jiang, X. Genome-wide identification, expression profiling, and functional analysis of ammonium transporter 2 (AMT2) gene family in cassava (Manihot esculenta crantz). Front. Genet. 2023, 14, 1145735. [Google Scholar] [CrossRef]
  24. Gazzarrini, S.; Lejay, L.; Gojon, A.; Ninnemann, O.; Frommer, W.B.; von Wirén, N. Three functional transporters for constitutive, diurnally regulated, and starvation-induced uptake of ammonium into Arabidopsis roots. Plant Cell 1999, 11, 937–948. [Google Scholar] [CrossRef] [PubMed]
  25. Loqué, D.; Yuan, L.; Kojima, S.; Gojon, A.; Wirth, J.; Gazzarrini, S.; Ishiyama, K.; Takahashi, H.; Wirén, N. A nitrogen-dependent additive contribution of AtAMT1;1 and AtAMT1;3 to ammonium uptake across the plasma membrane of Arabidopsis roots. Plant J. Cell Mol. Biol. 2006, 48, 522–534. [Google Scholar] [CrossRef] [PubMed]
  26. Yuan, L.; Loqué, D.; Kojima, S.; Rauch, S.; Ishiyama, K.; Inoue, E.; Takahashi, H.; von Wirén, N. The organization of high-affinity ammonium uptake in Arabidopsis roots depends on the spatial arrangement and biochemical properties of AMT1-type transporters. Plant Cell 2007, 19, 2636–2652. [Google Scholar] [CrossRef] [PubMed]
  27. Filiz, E.; Akbudak, M.A. Ammonium transporter 1 (AMT1) gene family in tomato (Solanum lycopersicum L.): Bioinformatics, physiological and expression analyses under drought and salt stresses. Genomics 2020, 112, 3773–3782. [Google Scholar] [CrossRef]
  28. Xia, Y.; Liu, Y.; Zhang, T.; Wang, Y.; Jiang, X.; Zhou, Y. Genome-wide identification and expression analysis of ammonium transporter 1 (AMT1) gene family in cassava (Manihot esculenta Crantz) and functional analysis of MeAMT1;1 in transgenic Arabidopsis. 3 Biotech 2021, 12, 4. [Google Scholar] [CrossRef]
  29. Dai, J.; Han, P.; Walk, T.C.; Yang, L.; Chen, L.; Li, Y.; Gu, C.; Liao, X.; Qin, L. Genome-Wide Identification and Characterization of Ammonium Transporter (AMT) Genes in Rapeseed (Brassica napus L.). Genes 2023, 14, 658. [Google Scholar] [CrossRef]
  30. Kumar, A.; Silim, S.N.; Okamoto, M.; Siddiqi, M.Y.; Glass, A.D.M. Differential expression of three members of the AMT1 gene family encoding putative high-affinity NH4+ transporters in roots of Oryza sativa subspecies indica. Plant Cell Environ. 2003, 26, 907–914. [Google Scholar] [CrossRef]
  31. Yan, Y.; Zhang, Z.; Sun, H.; Liu, X.; Xie, J.; Qiu, Y.; Chai, T.; Chu, C.; Hu, B. Nitrate confers rice adaptation to high ammonium by suppressing its uptake but promoting its assimilation. Mol. Plant 2023, 23, 363–365. [Google Scholar] [CrossRef] [PubMed]
  32. Mérigout, P.; Lelandais, M.; Bitton, F.; Renou, J.P.; Briand, X.; Meyer, C.; Daniel-Vedele, F. Physiological and transcriptomic aspects of urea uptake and assimilation in Arabidopsis plants. Plant Physiol. 2008, 147, 1225–1238. [Google Scholar] [CrossRef] [PubMed]
  33. Vision, T.J.; Brown, D.G.; Tanksley, S.D. The origins of genomic duplications in Arabidopsis. Science 2000, 290, 2114–2117. [Google Scholar] [CrossRef] [PubMed]
  34. Kent, W.J.; Baertsch, R.; Hinrichs, A.; Miller, W.; Haussler, D. Evolution’s cauldron: Duplication, deletion, and rearrangement in the mouse and human genomes. Proc. Natl. Acad. Sci. USA 2003, 100, 11484–11489. [Google Scholar] [CrossRef]
  35. Zhao, T.; Schranz, M.E. Network approaches for plant phylogenomic synteny analysis. Curr. Opin. Plant Biol. 2017, 36, 129–134. [Google Scholar] [CrossRef] [PubMed]
  36. Phillips, S.; Warren, J.G.; Mullins, G.L. Nitrogen Rate and Application Timing Affect ‘Beauregard’ Sweetpotato Yield and Quality. HortSci. A Publ. Am. Soc. Hortic. Sci. 2005, 40, 214–217. [Google Scholar] [CrossRef]
  37. Fernandes, A.M.; Campos, L.G.; Senna, M.S.; da Silva, C.L.; Assunção, N.S. Yield and Nitrogen Use Efficiency of Sweet Potato in Response to Cover Crop and Nitrogen Management. Agron. J. 2018, 110, 2004–2015. [Google Scholar] [CrossRef]
  38. Lihui, B.; Minjian, R.; Xianxiang, Z. Research Progress on absorption and Utilization of nitrogen, phosphorus and potassium by Sweet Potato. Agric. Technol. 2023, 43, 1–3. [Google Scholar] [CrossRef]
  39. Zheng, W.; Liu, Z.; Zhang, M.; Shi, Y.; Zhu, Q.; Sun, Y.; Zhou, H.; Li, C.; Yang, Y.; Geng, J. Improving crop yields, nitrogen use efficiencies, and profits by using mixtures of coated controlled-released and uncoated urea in a wheat-maize system. Field Crops Res. 2017, 205, 106–115. [Google Scholar] [CrossRef]
  40. Zhang, L.; Liang, Z.-Y.; He, X.-M.; Meng, Q.-F.; Hu, Y.; Schmidhalter, U.; Zhang, W.; Zou, C.-Q.; Chen, X.-P. Improving grain yield and protein concentration of maize (Zea mays L.) simultaneously by appropriate hybrid selection and nitrogen management. Field Crops Res. 2020, 249, 107754. [Google Scholar] [CrossRef]
  41. Osaki, M.; Ueda, H.; Shinano, T.; Matsui, H.; Tadano, T. Accumulation of carbon and nitrogen compounds in sweet potato plants grown under deficiency of N, P, or K nutrients. Soil Sci. Plant Nutr. 1995, 41, 557–566. [Google Scholar] [CrossRef]
  42. Yu, X.; Keitel, C.; Zhang, Y.; Wangeci, A.N.; Dijkstra, F.A. Global meta-analysis of nitrogen fertilizer use efficiency in rice, wheat and maize. Agric. Ecosyst. Environ. 2022, 338, 108089. [Google Scholar] [CrossRef]
  43. Zhang, G.; Liu, S.; Dong, Y.; Liao, Y.; Han, J. A nitrogen fertilizer strategy for simultaneously increasing wheat grain yield and protein content: Mixed application of controlled-release urea and normal urea. Field Crops Res. 2022, 277, 108405. [Google Scholar] [CrossRef]
  44. Chunyu, S.; Xiaodong, Z.; Chao, Z.; Xiaoguang, C.J.P.N.; Science, F. Absorption and utilization of different nitrogen forms by sweet potato. Plant Nutr. Fertil. Sci. 2010, 16, 389–394. [Google Scholar] [CrossRef]
  45. Dawa, K.; Abdel-Fattah, A.; El-Gamiely, E.; El-Din, U. Studies on bio and chemical fertilization on sweet potato (ipomea batatas, l) 1-effect of some chemical nitrogen sources, rates and biofertilizer (nitrobien) on plant growth, yield and quality of tuber roots. J. Plant Prod. 2000, 25, 5397–5411. [Google Scholar] [CrossRef]
  46. Glass, A.D.M.; Britto, D.T.; Kaiser, B.N.; Kinghorn, J.R.; Kronzucker, H.J.; Kumar, A.; Okamoto, M.; Rawat, S.; Siddiqi, M.Y.; Unkles, S.E.; et al. The regulation of nitrate and ammonium transport systems in plants. J. Exp. Bot. 2002, 53, 855–864. [Google Scholar] [CrossRef] [PubMed]
  47. Liu, Y.; von Wirén, N. Ammonium as a signal for physiological and morphological responses in plants. J. Exp. Bot. 2017, 68, 2581–2592. [Google Scholar] [CrossRef]
  48. Chen, M.; Zhu, K.; Xie, J.; Liu, J.; Tan, P.; Peng, F. Genome-Wide Identification and Expression Analysis of AMT and NRT Gene Family in Pecan (Carya illinoinensis) Seedlings Revealed a Preference for NH(4)(+)-N. Int. J. Mol. Sci. 2022, 23, 13314. [Google Scholar] [CrossRef] [PubMed]
  49. Gansel, X.; Muños, S.; Tillard, P.; Gojon, A. Differential regulation of the NO3− and NH4+ transporter genes AtNrt2.1 and AtAmt1.1 in Arabidopsis: Relation with long-distance and local controls by N status of the plant. Plant J. 2001, 26, 143–155. [Google Scholar] [CrossRef]
  50. Huggins, D.R.; Pan, W.L. Nitrogen Efficiency Component Analysis: An Evaluation of Cropping System Differences in Productivity. Agron. J. 1993, 85, 898–905. [Google Scholar] [CrossRef]
  51. Hao, X.; Sun, L.; Zhou, B.; Ma, X.; Wang, S.; Liu, S.; Ji, J.; Kuang, E.; Qiu, S. Change in maize yield, N use efficiencies and climatic warming potential after urea combined with Nitrapyrin and NBPT during the growing season in a black soil. Soil Tillage Res. 2023, 231, 105721. [Google Scholar] [CrossRef]
  52. Li, H.; Wang, H.; Fang, Q.; Jia, B.; Li, D.; He, J.; Li, R. Effects of irrigation and nitrogen application on NO3--N distribution in soil, nitrogen absorption, utilization and translocation by winter wheat. Agric. Water Manag. 2023, 276, 108058. [Google Scholar] [CrossRef]
  53. Congreves, K.A.; Otchere, O.; Ferland, D.; Farzadfar, S.; Williams, S.; Arcand, M.M. Nitrogen Use Efficiency Definitions of Today and Tomorrow. Front. Plant Sci. 2021, 12, 637180. [Google Scholar] [CrossRef]
  54. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  55. Yang, W.; Dong, X.; Yuan, Z.; Zhang, Y.; Li, X.; Wang, Y. Genome-Wide Identification and Expression Analysis of the Ammonium Transporter Family Genes in Soybean. Int. J. Mol. Sci. 2023, 24, 3991. [Google Scholar] [CrossRef]
  56. Xu, Y.; Liu, F.; Rehman, S.; Dong, H.; Hu, Q.; Tu, Z.; Li, X. Genome-Wide Analysis of AMT Gene Family and its Response to Mycorrhizal Symbiosis in Maize. J. Plant Growth Regul. 2023, 42, 1134–1143. [Google Scholar] [CrossRef]
  57. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
  58. Yao, Y.; Sun, L.; Wu, W.; Wang, S.; Xiao, X.; Hu, M.; Li, C.; Zhao, H.; Chen, H.; Wu, Q. Genome-Wide Investigation of Major Enzyme-Encoding Genes in the Flavonoid Metabolic Pathway in Tartary Buckwheat (Fagopyrum tataricum). J. Mol. Evol. 2021, 89, 269–286. [Google Scholar] [CrossRef]
  59. Mo, C.; Wan, S.; Xia, Y.; Ren, N.; Zhou, Y.; Jiang, X. Expression Patterns and Identified Protein-Protein Interactions Suggest that Cassava CBL-CIPK Signal Networks Function in Responses to Abiotic Stresses. Front. Plant Sci. 2018, 9, 269. [Google Scholar] [CrossRef]
  60. R Core Team. R: A Language and Environment for Statistical Computing. Available online: https://www.r-project.org (accessed on 18 May 2023).
Ijms 24 17424 g001
Figure 1. Growth of sweet potato at canopy closure. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N.
Figure 1. Growth of sweet potato at canopy closure. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N.
Ijms 24 17424 g001
Ijms 24 17424 g002
Figure 2. Weight of different organs of sweet potato at canopy closure. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N. Values followed by different letters within a group are significantly different among organs (p < 0.05).
Figure 2. Weight of different organs of sweet potato at canopy closure. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N. Values followed by different letters within a group are significantly different among organs (p < 0.05).
Ijms 24 17424 g002
Ijms 24 17424 g003
Figure 3. N content in different organs of sweet potato at canopy closure and harvest. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N. Values followed by different lowercase letters within a group are significantly different among nitrogen treatments (p < 0.05).
Figure 3. N content in different organs of sweet potato at canopy closure and harvest. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N. Values followed by different lowercase letters within a group are significantly different among nitrogen treatments (p < 0.05).
Ijms 24 17424 g003
Ijms 24 17424 g004
Figure 4. Phylogenetic tree for AMT proteins, constructed in MEGAX. The four primary subgroups were named Groups 1–3; different colors represent different subgroups. Pink circles, red stars, orange stars, green squares, blue triangles, purple circles, and black checks represent MeAMTs, AtAMT, IbAMTs, GmAMTs, OsAMTs, ZmAMTs, and SlAMTs; solid graphics represent AMT1; hollow graphics represent AMT2, respectively.
Figure 4. Phylogenetic tree for AMT proteins, constructed in MEGAX. The four primary subgroups were named Groups 1–3; different colors represent different subgroups. Pink circles, red stars, orange stars, green squares, blue triangles, purple circles, and black checks represent MeAMTs, AtAMT, IbAMTs, GmAMTs, OsAMTs, ZmAMTs, and SlAMTs; solid graphics represent AMT1; hollow graphics represent AMT2, respectively.
Ijms 24 17424 g004
Ijms 24 17424 g005
Figure 5. Phylogenetic relationships, conserved protein motifs, and gene structures of the 12 IbAMT proteins and genes. (A) The phylogenetic tree was constructed based on the full-length sequences of sweet potato AMT proteins using MEGA 7.0.26. (B) Motif distribution of the AMT proteins. The conserved motifs of AMT proteins were determined using MEME (http://meme-suite.org/tools/meme (accessed on 13 August 2022)) and visualized using TBtools v1.098669. The motifs, numbered 1–5, are displayed in different colored boxes. (C) IbAMT genes’ exon–intron structures. Black lines indicate introns, and yellow boxes represent exons.
Figure 5. Phylogenetic relationships, conserved protein motifs, and gene structures of the 12 IbAMT proteins and genes. (A) The phylogenetic tree was constructed based on the full-length sequences of sweet potato AMT proteins using MEGA 7.0.26. (B) Motif distribution of the AMT proteins. The conserved motifs of AMT proteins were determined using MEME (http://meme-suite.org/tools/meme (accessed on 13 August 2022)) and visualized using TBtools v1.098669. The motifs, numbered 1–5, are displayed in different colored boxes. (C) IbAMT genes’ exon–intron structures. Black lines indicate introns, and yellow boxes represent exons.
Ijms 24 17424 g005
Ijms 24 17424 g006
Figure 6. Schematic representations of the chromosomal distribution and interchromosomal relationships among sweet potato AMT genes. Chromosomes are represented in different colors. Red lines between IbAMT genes represent segmental duplication events that occurred in the sweet potato AMT gene family.
Figure 6. Schematic representations of the chromosomal distribution and interchromosomal relationships among sweet potato AMT genes. Chromosomes are represented in different colors. Red lines between IbAMT genes represent segmental duplication events that occurred in the sweet potato AMT gene family.
Ijms 24 17424 g006
Ijms 24 17424 g007
Figure 7. Synteny analyses of AMT genes between sweet potato and other representative plant species (Arabidopsis, cassava, rice, tomato, Ipomoea trifida, and Ipomoea triloba). Gray lines indicate significantly collinear blocks within and among plant genomes. Green lines indicate significantly collinear blocks within and among plant genomes between AMT genes. The red triangle represents the position of IbAMT genes on the chromosome of sweet potato.
Figure 7. Synteny analyses of AMT genes between sweet potato and other representative plant species (Arabidopsis, cassava, rice, tomato, Ipomoea trifida, and Ipomoea triloba). Gray lines indicate significantly collinear blocks within and among plant genomes. Green lines indicate significantly collinear blocks within and among plant genomes between AMT genes. The red triangle represents the position of IbAMT genes on the chromosome of sweet potato.
Ijms 24 17424 g007
Ijms 24 17424 g008
Figure 8. The cis-element analysis of IbAMT promoters.
Figure 8. The cis-element analysis of IbAMT promoters.
Ijms 24 17424 g008
Ijms 24 17424 g009
Figure 9. Expression profile of IbAMT1 genes in different organs of sweet potato. Values followed by different lowercase letters within a group are significantly different among nitrogen treatments (p < 0.05).
Figure 9. Expression profile of IbAMT1 genes in different organs of sweet potato. Values followed by different lowercase letters within a group are significantly different among nitrogen treatments (p < 0.05).
Ijms 24 17424 g009
Ijms 24 17424 g010
Figure 10. Expression of IbAMT1 genes in storage root of sweet potato. NN, no N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N. Values followed by different lowercase letters within a group are significantly different among nitrogen treatments (p < 0.05).
Figure 10. Expression of IbAMT1 genes in storage root of sweet potato. NN, no N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N. Values followed by different lowercase letters within a group are significantly different among nitrogen treatments (p < 0.05).
Ijms 24 17424 g010
Ijms 24 17424 g011
Figure 11. Correlation analysis between N content (NC) and IbAMT1 gene expression in storage root of sweet potato. Blue represents positive correlation, and red represents negative correlation, where the darker the color, the stronger the correlation. * p < 0.05, *** p < 0.001.
Figure 11. Correlation analysis between N content (NC) and IbAMT1 gene expression in storage root of sweet potato. Blue represents positive correlation, and red represents negative correlation, where the darker the color, the stronger the correlation. * p < 0.05, *** p < 0.001.
Ijms 24 17424 g011
Table 1. Yield components and yield.
Table 1. Yield components and yield.
YearTreatmentStorage Root Number per PlantStorage Root Weight (g)Yield (kg ha−1)
2021NN3.00 ± 0.53 b68.07 ± 2.87 b10,035.58 ± 1717.58 c
LN3.50 ± 0.53 ab87.81 ± 4.76 a15,335.75 ± 2230.94 ab
MN3.88 ± 0.64 a90.00 ± 6.08 a17,356.83 ± 2501.77 a
HN3.25 ± 0.46 b86.09 ± 2.85 a13,975.53 ± 1901.70 b
2022NN2.75 ± 0.46 b73.43 ± 4.18 b10,108.88 ± 1867.65 c
LN3.25 ± 0.71 ab84.83 ± 7.11 a13,653.75 ± 2601.93 ab
MN3.50 ± 0.76 a86.95 ± 4.69 a15,179.02 ± 3123.49 a
HN2.88 ± 0.64 ab81.99 ± 5.90 a11,854.79 ± 3036.84 bc
ANOVA
Year1.56 *22.80 34,895,725.64 *
Treatment2.04 **1017.34 **110,543,895.31 **
Year × Treatment0.0277.424,467,957.23
Note: NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N, two-way ANOVA, LSD. The values after the ± sign are the standard deviation; values followed by lowercase letters within a column are significantly different among N treatments (p < 0.05). * p < 0.05; ** p < 0.01.
Table 2. Agronomic characteristics of sweet potato at harvest.
Table 2. Agronomic characteristics of sweet potato at harvest.
YearTreatmentLeaf Weight per Plant
(g)		Petiole Weight per Plant
(g)		Stem Weight per Plant
(g)		Storage Root Weight per Plant
(g)
2021NN41.87 ± 2.55 d56.33 ± 3.31 d74.43 ± 5.33 d200.71 ± 34.35 c
LN76.66 ± 3.03 c107.36 ± 5.16 c123.61 ± 5.61 c306.72 ± 44.62 ab
MN90.97 ± 5.38 b126.88 ± 5.96 b153.89 ± 3.73 b347.14 ± 50.04 a
HN97.50 ± 2.09 a150.07 ± 5.77 a207.27 ± 5.64 a279.51 ± 38.03 b
2022NN46.92 ± 1.69 c43.23 ± 1.91 d105.42 ± 5.69 d202.18 ± 37.35 c
LN63.36 ± 5.03 b74.53 ± 1.71 c145.92 ± 4.49 c273.08 ± 52.04 ab
MN88.81 ± 4.40 a95.75 ± 2.50 b185.98 ± 3.50 b303.58 ± 62.47 a
HN90.78 ± 7.00 a123.20 ± 5.22 a204.81 ± 8.05 a237.10 ± 34.54 bc
ANOVA
Year293.99 **10,799.89 **6880.54 **13,958.29 *
Treatment8260.67 **21,558.12 **39,354.79 **44,217.56 **
Year × Treatment238.19 **320.08 **1033.28 **1787.18
Note: NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N, two-way ANOVA, LSD. The values after the ± sign are the standard deviation; values followed by lowercase letters within a column are significantly different among N treatments (p < 0.05). * p < 0.05; ** p < 0.01.
Table 3. The storage root number per plant and weight at canopy closure.
Table 3. The storage root number per plant and weight at canopy closure.
YearN Application Rate
(kg ha−1)		Storage Root Number per PlantStorage Root Weight per Plant
(g)		Storage Root Weight per Plant
(g)
2021NN---
LN3.50 ± 0.53 ab9.22 ± 0.50 b32.09 ± 3.90 b
MN4.13 ± 0.64 a11.43 ± 1.65 a46.36 ± 3.86 a
HN3.25 ± 0.71 b9.12 ± 0.68 b29.75 ± 6.99 b
2022NN2.63 ± 0.84 c8.84 ± 2.02 b22.60 ± 6.28 c
LN3.30 ± 0.64 ab9.76 ± 1.64 b31.79 ± 5.58 b
MN3.55 ± 0.50 a12.07 ± 2.08 a42.71 ± 9.14 a
HN2.98 ± 0.49 bc10.20 ± 1.07 b29.96 ± 2.74 b
ANOVA analysis
Year1.476.8118.77
Treatment2.27 **23.70 **971.80 **
Year × Treatment0.160.3317.53
Note: NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N, two-way ANOVA, LSD. The values after the ± sign are the standard deviation; values followed by lowercase letters within a column are significantly different among N treatments (p < 0.05). ** p < 0.01.
Table 4. N use efficiencies of sweet potato at canopy closure and harvest.
Table 4. N use efficiencies of sweet potato at canopy closure and harvest.
PeriodYearTreatmentN Uptake Efficiency
(kg kg−1)		N Use Efficiency
(kg kg−1)		N Fertilization Contribution Rates
Canopy Closure Period2021NN---
LN19.49 ± 0.27 b0.30 ± 0.01 a-
MN25.42 ± 0.16 a0.17 ± 0.01 b-
HN9.54 ± 0.09 c0.18 ± 0.01 b-
2022NN-0.58 ± 0.05 a-
LN22.72 ± 1.19 b0.27 ± 0.02 b-
MN27.66 ± 0.67 a0.17 ± 0.01 c-
HN11.86 ± 0.23 c0.15 ± 0.01 c-
Harvest Time2021NN-0.78 ± 0.09 a-
LN107.04 ± 8.45 a0.55 ± 0.05 b0.35 ± 0.02 b
MN73.96 ± 3.86 b0.45 ± 0.02 c0.42 ± 0.01
HN44.01 ± 2.58 c0.39 ± 0.02 c0.28 ± 0.01
2022NN-1.17 ± 0.22 a-
LN68.49 ± 8.43 a0.77 ± 0.10 b0.26 ± 0.01
MN47.29 ± 5.04 b0.62 ± 0.07 bc0.33 ± 0.02
HN32.72 ± 3.04 c0.44 ± 0.05 c0.15 ± 0.01
ANOVA
Canopy Closure PeriodYear30.42 **0-
Treatment388.74 **0.13 **-
Year × Treatment0.450-
Harvest TimeYear2926.28 **0.26 **0.05 **
Treatment3672.63 **0.35 **0.04 **
Year × Treatment280.17 **0.030.00 **
Note: Table 4 was calculated with original data from Tables S1 and S2 by the formula in Section 4.5. Calculations. NN, no N; LN, 60 kg ha−1 N; MN, 120 kg ha−1 N; HN, 180 kg ha−1 N, two-way ANOVA, LSD. The values after the ± sign are standard deviation; values followed by lowercase letters within a column are significantly different among N treatments (p < 0.05). ** p < 0.01.
Table 5. Features of AMT family members in sweet potato. (a Length (no. of amino acids) of the deduced polypeptide, b molecular weight of the deduced polypeptide, c isoelectric point of the deduced polypeptide).
Table 5. Features of AMT family members in sweet potato. (a Length (no. of amino acids) of the deduced polypeptide, b molecular weight of the deduced polypeptide, c isoelectric point of the deduced polypeptide).
Gene IDRenameChromosome+/−FromToProtein
(aa) a		MW
(Da) b		PI cInstability IndexSubcellular Localization
g5252.t1IbAMT1.1LG2−6,966,1306,967,72847450,364.835.9426.04Plasma membrane
g8186.t1IbAMT1.2LG2−29,455,17529,457,13050053,162.086.4925.23Plasma membrane
g8219.t1IbAMT1.3LG2+29,703,63029,707,68871876,762.858.5445.62Plasma membrane
g9593.t1IbAMT2.1LG3+1,155,1991,157,12846150,746.348.4942.93Plasma membrane
g14003.t1IbAMT1.4LG4+8,704,9658,706,76049552,496.557.1123.74Cytosol
g17995.t1IbAMT2.2LG5+9,624,6039,630,15145048,335.518.7728.96Plasma membrane
g23921.t1IbAMT2.3LG6−22,757,71322,760,44740444,089.466.2232.83Plasma membrane
g27616.t1IbAMT2.4LG7+17,584,80017,610,97948052,074.748.3435.08Plasma membrane
g29440.t1IbAMT2.5LG7−30,456,11330,458,23941044,766.86.3437.27Plasma membrane
g37079.t1IbAMT2.6LG9−22,670,10822,674,02532735,229.268.7434.14Plasma membrane
g44418.t1IbAMT2.7LG11−22,000,41322,003,75744948,838.246.3031.50Plasma membrane
g54923.t1IbAMT1.5LG13+26,814,00226,816,03351054,360.356.8527.43Plasma membrane
Table 6. Climate during the sweet potato growing season.
Table 6. Climate during the sweet potato growing season.
CityYearMonthTotal Rainfall
(mm)		Maximum Temperature
(°C)		Minimum Temperature
(°C)		Average Temperature
(°C)
Haikou202110505.3032.0018.0024.90
1126.3030.0017.0022.70
1257.9025.0014.0019.00
2022116.7026.0014.0019.70
2140.6026.008.0016.80
Sanya1045.0031.0020.0025.70
112.1031.0020.0025.60
120.2029.0015.0021.70
202313.0028.0014.0021.30
29.0031.0018.0023.40
Table 7. Primers for qRT-PCR.
Table 7. Primers for qRT-PCR.
Gene NameForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
ActinTATGGTTGGGATGGGACAGAACGGTAAGAAGGACAGGGTGCT
IbAMT1.1CAACGGCGTGGAAGACAAATTCGGAAGACTAGGTAGGCGGAGAAGAGG
IbAMT1.2GGAAGACGAAATGGCGGGTATGGTGCGGGTTCAATCCTTCTCATTTGG
IbAMT1.3CATATCCATACCGACGCCCATGTACCTCCTCCCTCCCATCTCTCATCAAG
IbAMT1.4TGTCGGGGCATTGGAAAGTTACGATTAAGACCAGAGCCGCCACAAAC
IbAMT1.5CGGAAGATGAGACCTGCGGAATGGTGTGGGAGTATTGGACGGTTCG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Meng, Y.-Y.; Wang, N.; Zhang, H.-Y.; Xu, R.; Si, C.-C. Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield. Int. J. Mol. Sci. 2023, 24, 17424. https://doi.org/10.3390/ijms242417424

AMA Style

Meng Y-Y, Wang N, Zhang H-Y, Xu R, Si C-C. Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield. International Journal of Molecular Sciences. 2023; 24(24):17424. https://doi.org/10.3390/ijms242417424

Chicago/Turabian Style

Meng, Ya-Yi, Ning Wang, Hai-Yan Zhang, Ran Xu, and Cheng-Cheng Si. 2023. "Genome-Wide Analysis of Sweet Potato Ammonium Transporter (AMT): Influence on Nitrogen Utilization, Storage Root Development and Yield" International Journal of Molecular Sciences 24, no. 24: 17424. https://doi.org/10.3390/ijms242417424

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop