Photoperiod Induces the Epigenetic Change of the GNAQ Gene in OVX+E2 Ewes
Abstract
:1. Introduction
2. Results
2.1. The DNA Methylation in the GNAQ Gene using Whole Genome Methylation Sequencing (WGBS)
2.2. The Expression of Major Methylated Transferase Genes in the Different Photoperiods
2.3. GNAQ Gene Core Promoter Identification
2.4. The DNA Methylation Verification of the DMR in the GNAQ Gene
2.5. The DNA Methylation Analysis of the CpG Island in the Core Promoter Region
2.6. Hypothalamic Histone H3 Acetylation under Different Photoperiods
2.7. The Expression Differences of GNAQ in Different Photoperiods
3. Discussion
4. Materials and Methods
4.1. Animals and Sample Collection
4.2. DNA Isolation and Bisulfite Treatments
4.3. Whole Genome Methylation Sequencing (WGBS)
4.4. Isolation of 5′-Flanking Region and Luciferase Reporter Vector Construction
4.5. Cell culture, Transfections, and Luciferase Assay
4.6. Pyrosequencing Analysis
4.7. Chromatin Immunoprecipitation-qPCR (ChIP-qPCR)
4.8. Quantitative Real-Time PCR (qPCR)
4.9. Western Blot Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dawson, A.; King, V.M.; Bentley, G.E.; Ball, G.F. Photoperiodic control of seasonality in birds. J. Biol. Rhythm. 2001, 16, 365–380. [Google Scholar] [CrossRef] [PubMed]
- Weems, P.W.; Goodman, R.L.; Lehman, M.N. Neural mechanisms controlling seasonal reproduction: Principles derived from the sheep model and its comparison with hamsters. Front. Neuroendocr. Neuroendocrinol. 2015, 37, 43–51. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, T.J.; Liddle, T.A.; Stewart, C.; Marshall, C.J.; Majumdar, G. Neural programming of seasonal physiology in birds and mammals: A modular perspective. Horm. Behav. 2022, 142, 105153. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.A.; Meléndez-Fernández, O.H.; Bumgarner, J.R.; Nelson, R.J. Effects of light pollution on photoperiod-driven seasonality. Horm. Behav. 2022, 141, 105150. [Google Scholar] [CrossRef]
- Stephan, F.K.; Zucker, I. Circadian rhythms in drinking behavior and locomotor activity of rats are eliminated by hypothalamic lesions. Proc. Natl. Acad. Sci. USA 1972, 69, 1583–1586. [Google Scholar] [CrossRef]
- van Diepen, H.C.; Schoonderwoerd, R.A.; Ramkisoensing, A.; Janse, J.A.M.; Hattar, S.; Meijer, J.H. Distinct contribution of cone photoreceptor subtypes to the mammalian biological clock. Proc. Natl. Acad. Sci. USA 2021, 118, e2024500118. [Google Scholar] [CrossRef]
- Porcu, A.; Riddle, M.; Dulcis, D.; Welsh, D.K. Photoperiod-Induced Neuroplasticity in the Circadian System. Neural Plast. 2018, 2018, 5147585. [Google Scholar] [CrossRef]
- He, X.; Di, R.; Guo, X.; Cao, X.; Zhou, M.; Li, X.; Xia, Q.; Wang, X.; Zhang, J.; Zhang, X.; et al. Transcriptomic Changes of Photoperiodic Response in the Hypothalamus Were Identified in Ovariectomized and Estradiol-Treated Sheep. Front. Mol. Biosci. 2022, 9, 848144. [Google Scholar] [CrossRef]
- Ji, K.; Ye, L.; Mason, M.D.; Jiang, W.G. The Kiss-1/Kiss-1R complex as a negative regulator of cell motility and cancer metastasis (Review). Int. J. Mol. Med. 2013, 32, 747–754. [Google Scholar] [CrossRef]
- Kotani, M.; Detheux, M.; Vandenbogaerde, A.; Communi, D.; Vanderwinden, J.M.; Le Poul, E.; Brézillon, S.; Tyldesley, R.; Suarez-Huerta, N.; Vandeput, F.; et al. The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J. Biol. Chem. 2001, 276, 34631–34636. [Google Scholar] [CrossRef]
- Zhang, C.; Bosch, M.A.; Rønnekleiv, O.K.; Kelly, M.J. Kisspeptin activation of TRPC4 channels in female GnRH neurons requires PIP2 depletion and cSrc kinase activation. Endocrinology 2013, 154, 2772–2783. [Google Scholar] [CrossRef]
- Wettschureck, N.; Moers, A.; Wallenwein, B.; Parlow, A.F.; Maser-Gluth, C.; Offermanns, S. Loss of Gq/11 family G proteins in the nervous system causes pituitary somatotroph hypoplasia and dwarfism in mice. Mol. Cell Biol. 2005, 25, 1942–1948. [Google Scholar] [CrossRef] [PubMed]
- Schneider, B.; Riedel, K.; Zhivov, A.; Huehns, M.; Zettl, H.; Guthoff, R.F.; Jünemann, A.; Erbersdobler, A.; Zimpfer, A. Frequent and Yet Unreported GNAQ and GNA11 Mutations are Found in Uveal Melanomas. Pathol. Oncol. Res. 2019, 25, 1319–1325. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.Y.; Lee, Y.S.; Shim, D.M.; Seo, S.W. Effect of GNAQ alteration on RANKL-induced osteoclastogenesis in human non-small-cell lung cancer. Bone Jt. Res. 2020, 9, 29–35. [Google Scholar] [CrossRef]
- Shi, C.; Li, G.; Guo, H.; Liu, X. Forkhead transcription factor FOXO1 is involved in hypoxia/reoxygenation-induced gonadotropin-releasing hormone decline. Neuroreport 2020, 31, 1296–1301. [Google Scholar] [CrossRef] [PubMed]
- Hoo, R.L.; Chan, K.Y.; Leung, F.K.; Lee, L.T.; Leung, P.C.; Chow, B.K. Involvement of NF-kappaB subunit p65 and retinoic acid receptors, RARalpha and RXRalpha, in transcriptional regulation of the human GnRH II gene. FEBS J. 2007, 274, 2695–2706. [Google Scholar] [CrossRef] [PubMed]
- Retis-Resendiz, A.M.; González-García, I.N.; León-Juárez, M.; Camacho-Arroyo, I.; Cerbón, M.; Vázquez-Martínez, E.R. The role of epigenetic mechanisms in the regulation of gene expression in the cyclical endometrium. Clin. Epigenet. 2021, 13, 116. [Google Scholar] [CrossRef]
- Stevenson, T.J.; Prendergast, B.J. Reversible DNA methylation regulates seasonal photoperiodic time measurement. Proc. Natl. Acad. Sci. USA 2013, 110, 16651–16656. [Google Scholar] [CrossRef]
- Dupré, S.M.; Miedzinska, K.; Duval, C.V.; Yu, L.; Goodman, R.L.; Lincoln, G.A.; Davis, J.R.; McNeilly, A.S.; Burt, D.D.; Loudon, A.S. Identification of Eya3 and TAC1 as long-day signals in the sheep pituitary. Curr. Biol. 2010, 20, 829–835. [Google Scholar] [CrossRef]
- Alenghat, T.; Meyers, K.; Mullican, S.E.; Leitner, K.; Adeniji-Adele, A.; Avila, J.; Bućan, M.; Ahima, R.S.; Kaestner, K.H.; Lazar, M.A. Nuclear receptor corepressor and histone deacetylase 3 govern circadian metabolic physiology. Nature 2008, 456, 997–1000. [Google Scholar] [CrossRef]
- Herb, B.R.; Wolschin, F.; Hansen, K.D.; Aryee, M.J.; Langmead, B.; Irizarry, R.; Amdam, G.V.; Feinberg, A.P. Reversible switching between epigenetic states in honeybee behavioral subcastes. Nat. Neurosci. 2012, 15, 1371–1373. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; He, X.; Liu, Q.; Liu, Q.; Di, R.; Chu, M. Identification of photoperiod-induced specific miRNAs in the adrenal glands of Sunite sheep (Ovis aries). Front. Vet. Sci. 2022, 9, 888207. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; He, X.; Di, R.; Wang, X.; Chu, M. Photoperiods induced the circRNA differential expression in the thyroid gland of OVX+E(2) ewes. Front. Endocrinol. 2022, 13, 974518. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Liu, X.; Hu, G.; Xie, Y.; Lin, S.; Zhao, Z.; Chen, J. Identification and analysis of microRNAs-mRNAs pairs associated with nutritional status in seasonal sheep. Biochem. Biophys. Res. Commun. 2018, 499, 321–327. [Google Scholar] [CrossRef] [PubMed]
- Yurchenko, A.A.; Deniskova, T.E.; Yudin, N.S.; Dotsev, A.V.; Khamiruev, T.N.; Selionova, M.I.; Egorov, S.V.; Reyer, H.; Wimmers, K.; Brem, G.; et al. High-density genotyping reveals signatures of selection related to acclimation and economically important traits in 15 local sheep breeds from Russia. BMC Genom. 2019, 20 (Suppl. S3), 294. [Google Scholar] [CrossRef]
- Zhu, M.; Zhang, H.; Yang, H.; Zhao, Z.; Blair, H.T.; Liang, H.; Wu, P.; Yu, Q. Targeting GNAQ in hypothalamic nerve cells to regulate seasonal estrus in sheep. Theriogenology 2022, 181, 79–88. [Google Scholar] [CrossRef]
- Yang, H.; Lin, S.; Lei, X.; Yuan, C.; Yu, Y.; Zhao, Z.; Chen, J. Nutritional status affects the microRNA profile of the hypothalamus of female sheep. Reprod. Fertil. Dev. 2018, 30, 946–957. [Google Scholar] [CrossRef]
- Daniels, A.B.; Lee, J.E.; MacConaill, L.E.; Palescandolo, E.; Van Hummelen, P.; Adams, S.M.; DeAngelis, M.M.; Hahn, W.C.; Gragoudas, E.S.; Harbour, J.W.; et al. High throughput mass spectrometry-based mutation profiling of primary uveal melanoma. Investig. Ophthalmol. Vis. Sci. 2012, 53, 6991–6996. [Google Scholar] [CrossRef]
- Lietman, C.D.; McKean, M. Targeting GNAQ/11 through PKC inhibition in uveal melanoma. Cancer Gene Ther. 2022, 29, 1809–1813. [Google Scholar] [CrossRef]
- Silva-Rodríguez, P.; Fernández-Díaz, D.; Bande, M.; Pardo, M.; Loidi, L.; Blanco-Teijeiro, M.J. GNAQ and GNA11 Genes: A Comprehensive Review on Oncogenesis, Prognosis and Therapeutic Opportunities in Uveal Melanoma. Cancers 2022, 14, 3066. [Google Scholar] [CrossRef]
- Tirot, L.; Jullien, P.E. Epigenetic dynamics during sexual reproduction: At the nexus of developmental control and genomic integrity. Curr. Opin. Plant Biol. 2022, 69, 102278. [Google Scholar] [CrossRef] [PubMed]
- Gunes, S.; Esteves, S.C. Role of genetics and epigenetics in male infertility. Andrologia 2021, 53, e13586. [Google Scholar] [CrossRef]
- Kong, S.; Zhou, C.; Bao, H.; Ni, Z.; Liu, M.; He, B.; Huang, L.; Sun, Y.; Wang, H.; Lu, J. Epigenetic control of embryo-uterine crosstalk at peri-implantation. Cell Mol. Life Sci. 2019, 76, 4813–4828. [Google Scholar] [CrossRef]
- Toro, C.A.; Aylwin, C.F.; Lomniczi, A. Hypothalamic epigenetics driving female puberty. J. Neuroendocr. Neuroendocrinol. 2018, 30, e12589. [Google Scholar] [CrossRef] [PubMed]
- Lomniczi, A.; Wright, H.; Ojeda, S.R. Epigenetic regulation of female puberty. Front. Neuroendocr. Neuroendocrinol. 2015, 36, 90–107. [Google Scholar] [CrossRef] [PubMed]
- Manotas, M.C.; González, D.M.; Céspedes, C.; Forero, C.; Rojas Moreno, A.P. Genetic and Epigenetic Control of Puberty. Sex. Dev. 2022, 16, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.Y.; Song, J.; Liu, Y.; Song, C.X.; Yi, C. Mapping the epigenetic modifications of DNA and RNA. Protein Cell 2020, 11, 792–808. [Google Scholar] [CrossRef]
- Li, S.; Zhang, M.; Zhang, H.; Hu, K.; Cai, C.; Wang, J.; Shi, L.; Ma, P.; Xu, Y.; Zheng, P. Exosomal long noncoding RNA lnc-GNAQ-6:1 may serve as a diagnostic marker for gastric cancer. Clin. Chim. Acta 2020, 501, 252–257. [Google Scholar] [CrossRef]
- Yang, H.; Fu, L.; Luo, Q.; Li, L.; Zheng, F.; Liu, X.; Zhao, Z.; Wang, Z.; Xu, H. Comparative Analysis and Identification of Differentially Expressed microRNAs in the Hypothalamus of Kazakh Sheep Exposed to Different Photoperiod Conditions. Biochem. (Mosc) 2021, 86, 1315–1325. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, Y.; Yin, J.; Gao, Y.; Li, Y.; Bai, D.; He, W.; Li, X.; Zhang, P.; Li, R.; et al. Distinct H3K9me3 and DNA methylation modifications during mouse spermatogenesis. J. Biol. Chem. 2019, 294, 18714–18725. [Google Scholar] [CrossRef]
- Tatehana, M.; Kimura, R.; Mochizuki, K.; Inada, H.; Osumi, N. Comprehensive histochemical profiles of histone modification in male germline cells during meiosis and spermiogenesis: Comparison of young and aged testes in mice. PLoS ONE 2020, 15, e0230930. [Google Scholar] [CrossRef] [PubMed]
- Lomniczi, A.; Loche, A.; Castellano, J.M.; Ronnekleiv, O.K.; Bosch, M.; Kaidar, G.; Knoll, J.G.; Wright, H.; Pfeifer, G.P.; Ojeda, S.R. Epigenetic control of female puberty. Nat. Neurosci. 2013, 16, 281–289. [Google Scholar] [CrossRef] [PubMed]
- Soni, R.; Haldar, C.; Mohini Chaturvedi, C. Retinal and extra-retinal photoreceptor responses and reproductive performance of Japanese quail (Coturnix coturnix japonica) following exposure to different photoperiodic regime. Gen. Comp. Endocrinol. 2021, 302, 113667. [Google Scholar] [CrossRef]
- Jurkowska, R.Z.; Jurkowski, T.P.; Jeltsch, A. Structure and function of mammalian DNA methyltransferases. Chembiochem 2011, 12, 206–222. [Google Scholar] [CrossRef]
- Chen, Z.; Zhang, Y. Role of Mammalian DNA Methyltransferases in Development. Annu. Rev. Biochem. 2020, 89, 135–158. [Google Scholar] [CrossRef] [PubMed]
- Lynch, E.W.; Coyle, C.S.; Lorgen, M.; Campbell, E.M.; Bowman, A.S.; Stevenson, T.J. Cyclical DNA Methyltransferase 3a Expression Is a Seasonal and Estrus Timer in Reproductive Tissues. Endocrinology 2016, 157, 2469–2478. [Google Scholar] [CrossRef]
- Song, J.; Xie, C.; Jiang, L.; Wu, G.; Zhu, J.; Zhang, S.; Tang, M.; Song, L.; Li, J. Transcription factor AP-4 promotes tumorigenic capability and activates the Wnt/β-catenin pathway in hepatocellular carcinoma. Theranostics 2018, 8, 3571–3583. [Google Scholar] [CrossRef]
- Shakir, D.; Batie, M.; Rocha, S. Use of ChIP-qPCR to Study the Crosstalk Between HIF and NF-κB Signaling in Hypoxia and Normoxia. Methods Mol. Biol. 2021, 2366, 255–265. [Google Scholar]
Location | Primer Name | Sequences (5′-3′) | Product Size (bp) |
---|---|---|---|
DMR | GNAQ-F1 | TGATTTTTGGTTTGGGAAGATTTTAT | 203 |
GNAQ-R1 | AATCTTTATTACTATACCAATTTTTCCT | ||
GNAQ-S1 | AGTTTATGTGTTTTAGAGTTAG | ||
GNAQ-F2 | TTAGTGTTATTTGGGAGGATTATATTAGG | 198 | |
GNAQ-R2 | CACTACATACTACCACCAATACCTA | ||
GNAQ-S2 | CCAATACCTATAATCACCT | ||
GNAQ-F3 | GGAATTGTAGTTTTGTTAAGAGAAATGTAA | 136 | |
GNAQ-R3 | ATCCACTTCCAAAAAAAACATTTACTA | ||
GNAQ-S3 | GGAATGAGAAATGTGGT | ||
Core promoter | GNAQ-F1 | GGTATAAAAAGTTGGAAGTTAGTAGG | 269 |
GNAQ-R1 | AAATATATCCCCTCACCTCTAATCCAAATT | ||
GNAQ-S1 | ATAATATACACTCAACTATACAAT | ||
GNAQ-F2 | GGTATAAAAAGTTGGAAGTTAGTAGG | 329 | |
GNAQ-R2 | ACTCTTCCCCTAATTCAATATTCTTTCC | ||
GNAQ-S2 | ATTATTTAATTTGGATTAGAGGT |
Usage | Primer Name | Sequences (5′-3′) | Product Size (bp) |
---|---|---|---|
qPCR | GNAQ-F | GGACAGGAGAGAGTGGCAAG | 127 |
GNAQ-R | TAGGGGATCTTGAGCGTGTC | ||
ACTB-F | GCTGTATTCCCCTCCATCGT | 97 | |
ACTB-R | GGATACCTCTCTTGCTCTGG | ||
DNMT1-F | AGCCCCAGTCTTGGTTCCA | 85 | |
DNMT1-R | GCGCTCATGTCCTTGCAAAT | ||
MGB-Probe | CCATCCTCAGGGATC | ||
DNMT3A-F | CGTCTCGGCTCCAGATGTTC | 59 | |
DNMT3A-R | CTTCGGAGGGTCGAATTCCT | ||
MGB-Probe | CGCCAACAACCATG | ||
DNMT3B-F | ACCGACGGCGGCCTAT | 59 | |
DNMT3B-R | CAAGTACCCTGTTGCAATTCCA | ||
MGB-Probe | CGAGTCTTGTCGCTGTT | ||
ACTB-F | GCAGCCAAAAGCATCACCAA | 114 | |
ACTB-R | TCACCGGAGTCCATCACGAT | ||
MGB-Probe | GCAGCCAAAAGCATCACCAA | ||
ChIP + qPCR | F | GTGTCCTCCCCAGTCGCA | |
R | CGGCTCTTCGCCTAGTTCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, W.; Du, X.; Chu, M.; He, X. Photoperiod Induces the Epigenetic Change of the GNAQ Gene in OVX+E2 Ewes. Int. J. Mol. Sci. 2023, 24, 16442. https://doi.org/10.3390/ijms242216442
Wang W, Du X, Chu M, He X. Photoperiod Induces the Epigenetic Change of the GNAQ Gene in OVX+E2 Ewes. International Journal of Molecular Sciences. 2023; 24(22):16442. https://doi.org/10.3390/ijms242216442
Chicago/Turabian StyleWang, Wei, Xiaolong Du, Mingxing Chu, and Xiaoyun He. 2023. "Photoperiod Induces the Epigenetic Change of the GNAQ Gene in OVX+E2 Ewes" International Journal of Molecular Sciences 24, no. 22: 16442. https://doi.org/10.3390/ijms242216442