Next Article in Journal
CRISPR/Cas9 Editing Sites Identification and Multi-Elements Association Analysis in Camellia sinensis
Previous Article in Journal
Acute Kidney Injury by Ischemia/Reperfusion and Extracellular Vesicles
Previous Article in Special Issue
Effect of Aging on Tendon Biology, Biomechanics and Implications for Treatment Approaches
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 20
10.3390/ijms242015318
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

miR-103-3p Regulates the Proliferation and Differentiation of C2C12 Myoblasts by Targeting BTG2

by
Yulin He
1,2,
Peiyu Yang
1,2,
Tiantian Yuan
1,2,
Lin Zhang
1,2,
Gongshe Yang
1,2,
Jianjun Jin
1,2,* and
Taiyong Yu
1,2,*
1
Laboratory of Animal Fat Deposition and Muscle Development, College of Animal Science and Technology, Northwest A&F University, Yangling, Xianyang 712100, China
2
Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Yangling, Xianyang 712100, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(20), 15318; https://doi.org/10.3390/ijms242015318
Submission received: 31 August 2023 / Revised: 10 October 2023 / Accepted: 13 October 2023 / Published: 18 October 2023
(This article belongs to the Special Issue Molecular and Tissue Engineering Approaches in Musculoskeletal Regenerative Medicine 4.0)
Browse Figures
Versions Notes

Abstract

:
Skeletal muscle, a vital and intricate organ, plays a pivotal role in maintaining overall body metabolism, facilitating movement, and supporting normal daily activities. An accumulating body of evidence suggests that microRNA (miRNA) holds a crucial role in orchestrating skeletal muscle growth. Therefore, the primary aim of this study was to investigate the influence of miR-103-3p on myogenesis. In our study, the overexpression of miR-103-3p was found to stimulate proliferation while suppressing differentiation in C2C12 myoblasts. Conversely, the inhibition of miR-103-3p expression yielded contrasting effects. Through bioinformatics analysis, potential binding sites of miR-103-3p with the 3’UTR region of BTG anti-proliferative factor 2 (BTG2) were predicted. Subsequently, dual luciferase assays conclusively demonstrated BTG2 as the direct target gene of miR-103-3p. Further investigation into the role of BTG2 in C2C12 myoblasts unveiled that its overexpression impeded proliferation and encouraged differentiation in these cells. Notably, co-transfection experiments showcased that the overexpression of BTG2 could counteract the effects induced by miR-103-3p. In summary, our findings elucidate that miR-103-3p promotes proliferation while inhibiting differentiation in C2C12 myoblasts by targeting BTG2.

1. Introduction

Skeletal muscle is the largest motor and metabolic organ in the body, and it is also one of the most important components of the body [1]. Skeletal muscle generation involves three primary stages: myogenic progenitor cells undergo proliferation and differentiation into myoblasts, which subsequently differentiate and merge to form myotubes. Finally, myotubes undergo further differentiation to become mature muscle fibers [2]. This intricate developmental process is regulated by a variety of factors, including non-coding RNAs [3], transcription factors [4], and epigenetic modifications [5]. Among these factors miRNAs have emerged as key players, particularly in the regulation of skeletal muscle growth, regeneration, aging, and muscle atrophy [6].
miRNAs, highly conserved non-coding RNAs typically around 22 nucleotides in length, are widely distributed across plants and animals [7]. They bind to the 3’UTR sequences of target genes via complementary pairing, leading to mRNA degradation or inhibition of target gene translation, thus exerting post-transcriptional control over target gene expression [8]. In recent years, numerous studies have underscored the crucial roles of miRNAs in skeletal muscle development. For example, miR-27b-3p regulates myoblast proliferation and differentiation by targeting myostatin gene [9]. miR-21, through its modulation of TGFβ1 and the PI3K/Akt/mTOR signaling pathway, governs prenatal skeletal muscle development in pigs [10]. miR-223-3p promotes muscle regeneration through regulating inflammation [11]. miR-322 exacerbates dexamethasone-induced muscle atrophy by targeting IGF1R and INSR [12].
miR-103-3p, a significant member of the miRNA family, has been reported to promote hepatic steatosis and exacerbate nonalcoholic fatty liver disease by targeting ACOX1 [13]. It can also target the m6A methyltransferase METTL14, thereby inhibiting osteoblastic bone formation [14]. Furthermore, miR-103-3p regulates neural stem cell proliferation and differentiation by targeting Ndel1 [15]. In our prior study, we observed that in dexamethasone-induced muscular atrophy models, the lncRNA SYISL binds to miR-103-3p and accelerates muscle atrophy [16], suggesting a potential role for miR-103-3p in mitigating muscle atrophy. However, the effects and mechanisms of miR-103-3p on muscle growth, myoblast proliferation, and differentiation remain unclear.
BTG2, a transcription factor which is a member of the BTG/Tob anti-proliferative protein family [17], could form mRNA deadenylation complexes with Ccr4-associated factor 1 (CAF1) and CCR4, thereby facilitating mRNA decay [18]. Its expression can be activated by P53, leading to the inhibition of the cell cycle process [19]. In addition, BTG2 was also involved in many biological processes such as cell senescence [20], cell differentiation [21], oxidative damage [22] and DNA damage repair [23]. Then, what role does BTG2 play in the muscles? Studies have suggested that BTG2 may act as a regulator of MuSC aging and promote the senescence of muscle stem cells [23]. Yang et al. found that BTG2 may be the target gene of miR-222-3p, which could regulate the proliferation and differentiation of C2C12 myoblasts [24]. Ren et al. observed BTG2 distribution in a model of 4 h skeletal muscle injury [25]. These findings collectively highlight the significant role of BTG2 in muscle homeostasis and myogenic differentiation.
In our study, we observed high expression levels of miR-103-3p in mouse skeletal muscle. Through overexpression and inhibition experiments with miR-103-3p in C2C12 myoblasts, we found that miR-103-3p promotes the proliferation of C2C12 myoblasts while inhibiting their differentiation. The dual luciferase reporter assays further confirmed that miR-103-3p directly targets BTG2 and regulates its expression, consequently influencing the proliferation and differentiation of C2C12 myoblasts. In conclusion, our study identifies miR-103-3p as a potential regulator of skeletal muscle growth and development.

2. Results

2.1. miR-103-3p Promotes the Proliferation of C2C12 Myoblasts

To determine the expression pattern of miR-103-3p in skeletal muscle, we measured the expression level of miR-103-3p in the tissues of 5-month-old mice. The results showed that miR-103-3p was predominantly expressed in muscle and adipose tissue (Figure 1A). In previous studies, C2C12 myoblasts have been established as a valid model for studying skeletal muscle development [26]. Hence, we chose to conduct our research using C2C12 myoblasts. Our investigation revealed that miR-103-3p exhibited elevated expression levels during the initial phase of myoblast cell proliferation, with a subsequent decline in expression as the cells differentiated into myotubes (Figure 1B). To investigate the effects of miR-103-3p on the proliferation of C2C12 myoblasts, we transfected miR-103-3p mimics and inhibitor into C2C12 myoblasts. The real-time quantitative PCR (RT-qPCR) results showed that the overexpression of miR-103-3p significantly increased the expression level of proliferation-related genes Ki67, CDK4 and CDK6 (Figure 1C, p < 0.05). Additionally, the Western blot results showed that the overexpression of miR-103-3p significantly increased the expression level of proliferation-related genes Ki67, Cyclin E and Cyclin D (Figure 1D,E). Conversely, the inhibition of miR-103-3p led to a notable decrease in the expression levels of proliferation-related genes (Figure 1F–H). Furthermore, the EdU incorporation assay showed that the overexpression of miR-103-3p significantly promoted myoblast proliferation, and the knockdown of miR-103-3p significantly inhibited myoblast proliferation (Figure 1I–K). Similarly, CCK-8 experiment demonstrated that the overexpression of miR-103-3p could significantly promote the proliferation of myoblasts, while interference with miR-103-3p could significantly inhibit the proliferation of myoblasts. (Figure 1L,M). In summary, these results collectively demonstrate that miR-103-3p plays a pivotal role in promoting the proliferation of C2C12 myoblasts.

2.2. miR-103-3p Inhibited the Differentiation of C2C12 Myoblasts

Subsequently, we transfected mimics and inhibitor miR-103-3p into C2C12 cells to induce myoblast differentiation and assessed the effect of miR-103-3p on myoblast differentiation. The results from RT-qPCR and Western blot analyses clearly indicated that the overexpression of miR-103-3p led to a significant reduction in the expression levels of differentiation marker genes such as MyHC, MyoD, and MyoG (Figure 2A–C). Furthermore, immunofluorescence staining of MyHC confirmed that miR-103-3p overexpression inhibited myogenic differentiation (Figure 2G,H). In contrast, the knockdown of miR-103-3p resulted in a noteworthy increase in the expression of myoblast differentiation-related genes, including MyoD, MyoG, and MyHC, thereby promoting myoblast differentiation (Figure 2D–F,I,J). These findings collectively suggest that miR-103-3p possesses the capacity to impede the differentiation of C2C12 myoblasts.

2.3. miR-103-3p Directly Targeted BTG2

As the small non-coding RNAs, miRNAs will regulate the expression of target genes mainly by binding to target gene mRNA. Therefore, we predicted the target genes of miR-103-3p with miRDB, targetscan and ENCORI online tool. This analysis yielded 266 potential binding target genes (Figure 3A). Furthermore, the Gene Ontology (GO) analysis revealed that these target genes were prominently associated with biological processes such as cell proliferation, cell development, and cell differentiation (Figure 3B). Among these target genes, we identified six that were particularly relevant to myoblast proliferation and differentiation: KPNA1 [27], FOXJ2 [28], DGCR8 [29], BTG2 [30], RASSF5 [31] and Axin2 [32]. To validate whether miR-103-3p could directly regulate the expression of these target genes, we conducted RT-qPCR experiments. The results showed that miR-103-3p could directly target and regulate the expression of BTG2 in proliferating and differentiating myoblasts (Figure 3C–F). Subsequently, we examined the expression level of BTG2 in the tissues of 5-month-old mice and found that BTG2 was predominantly expressed in muscle (Figure 3G). We also measured the mRNA and protein expression level of BTG2 in C2C12 myoblasts during its 3-day differentiated myotubes and the results showed that BTG2 was highly expressed during the proliferation and differentiation period (Figure 3H–J). Finally, dual-luciferase reporter assays provided compelling evidence that miR-103-3p mimics significantly inhibited the luciferase activity of the wild-type BTG2 mRNA 3’ UTR reporter, while the dual fluorescence activity of the vector carrying the mutated miR-103-3p binding site remained largely unaffected (Figure 3K–M). These results demonstrated that BTG2 could be a direct target gene of miR-103-3p.

2.4. BTG2 Inhibits the Proliferation and Promotes the Differentiation of C2C12 Myoblasts

To verify the role of BTG2 in myogenesis, we overexpressed BTG2 in C2C12 cells. The results demonstrated that BTG2 significantly suppressed the mRNA expression of Ki67, CDK4, and CDK6 (Figure 4A). In addition, the BTG2 significantly down-regulated the protein expression of Ki67, Cyclin E and Cyclin D (Figure 4B,C). EdU staining revealed that BTG2 significantly decreased the proportion of EdU-positive cells (Figure 4G), suggesting that BTG2 inhibits the C2C12 myoblasts proliferation. Furthermore, overexpression of BTG2 significantly increased the expression of the myogenic genes MyHC, MyoD and MyoG in mRNA (Figure 4D) and their protein level (Figure 4E,F). Immunofluorescence staining of MyHC showed that overexpression of BTG2 significantly increased the number of myotubes (Figure 4H). In summary, these results provide strong evidence that BTG2 has the capacity to inhibit the proliferation of C2C12 myoblasts and promote myogenic differentiation.

2.5. miR-103-3p Regulates Myogenesis by Targeting BTG2

To provide evidence that miR-103-3p promotes the proliferation of C2C12 myoblasts and inhibits myogenic differentiation primarily by targeting BTG2, we co-transfected miR-103-3p and BTG2 overexpression vectors into C2C12 myoblasts. RT–qPCR results showed that the overexpression of BTG2 could significantly offset the upregulation effect of the overexpression of miR-103-3p on the mRNA (Figure 5A) and protein level (Figure 5B,C) of myoblast proliferation genes. Additionally, EdU staining showed that overexpression of BTG2 could effectively reduce higher ratio of EdU-positive cells resulting from the overexpression of miR-103-3p in C2C12 cells (Figure 5D,E). These findings strongly support the conclusion that miR-103-3p promotes the proliferation of C2C12 myoblasts by targeting BTG2.
Furthermore, we co-transfected miR-103-3p and BTG2 overexpression vectors into C2C12 myoblasts to induce differentiation and then assessed the expression of related genes. The results revealed that the overexpression of BTG2 mitigated the inhibitory effects of miR-103-3p on the expression of differentiation genes such as MyHC, MyoD, and MyoG (Figure 6A–C). Similarly, immunofluorescence staining of MyHC revealed that the overexpression of BTG2 alleviated the inhibitory effect of miR-103-3p on myogenic differentiation (Figure 6D,E). In conclusion, these results strongly suggest that miR-103-3p inhibits C2C12 myogenic differentiation by targeting BTG2.

3. Discussion

Skeletal muscle growth and development represent intricate and finely regulated processes [33]. In this context, miRNAs have emerged as crucial players. For instance, miR-33a has been reported to hinder myoblast proliferation by targeting IGF1, follistatin, and cyclin D1 [34]. Similarly, miR-743a-5p has been shown to facilitate myoblast differentiation by targeting Mob1b in skeletal muscle development and regeneration [35]. Notably, an increasing number of miRNAs have been found to exhibit dual roles in myogenesis. For instance, miR-100-5p promotes proliferation while inhibiting differentiation of C2C12 myoblasts through the Trib2/mTOR/S6K signaling pathway [36]. Conversely, miR-543 inhibits proliferation and promotes differentiation by targeting KLF6 in C2C12 myoblasts [37]. In another example, miR-21-5p stimulates the proliferation and differentiation of skeletal muscle satellite cells by targeting KLF3 in chickens [38]. Furthermore, miR-668-3p exerts inhibitory effects on myoblast proliferation and differentiation by targeting Appl1 [39]. Our investigation into miR-103-3p has revealed its role in promoting proliferation while inhibiting differentiation in myoblasts, akin to the function of miR-100-5p. These findings underscore the pivotal role played by miRNAs in the intricate process of skeletal muscle development.
miR-103-3p, a highly conserved miRNA, can participate in various physiological regulatory processes. For instance, in gastric cancer, miR-103 promotes proliferation and metastasis by targeting KLF4 [40], while in endothelial maladaptation, it ameliorates the condition by targeting lncWDR59. However, this dual role implies that miR-103-3p may also hasten atherosclerosis [41]. We previously found that SYISL could act as a molecular sponge for miR-103-3p, weakening the inhibition of miR-103-3p on MuRF1, thus expediting muscle atrophy [16]. Therefore, miR-103-3p had an inhibitory effect on muscle atrophy. However, we found that miR-103-3p can promote myoblast proliferation and inhibit differentiation, a function that appears contradictory to its role in muscle atrophy. Similarly, miR-23a and miR-186 have been reported to have similar functions. miR-23a, for instance, can suppress C2C12 myoblast differentiation through the downregulation of fast myosin heavy chain isoforms [42], yet it can simultaneously alleviate muscle atrophy caused by mice with chronic kidney disease (CKD) [43]. In C2C12 myoblasts, miR-186 inhibits the muscle cell differentiation through myogenin regulation [44], while the expression level of miR-186 was decreased in the in the vivo starvation induced muscular atrophy mouse model [45], which suggests that miR-186 could alleviate muscular atrophy. This phenomenon can be understood as a difference in the regulatory network between normal muscle growth and muscle atrophy.
miRNAs exert their regulatory influence on cellular functions by binding to the 3’UTR sequences of various target genes [46]. Therefore, through bioinformatics analysis, we identified BTG2, a member of the antiproliferative (APRO) gene family [47], as a potential target gene of miR-103-3p. This selection allowed us to delve into the molecular mechanism through which miR-103-3p regulates the proliferation and differentiation of C2C12 myoblast cells. BTG2 has been implicated in a wide range of physiological and pathological processes, including cell proliferation [48], differentiation [21], and apoptosis [49]. Furthermore, BTG2 has been found to be involved in skeletal muscle growth and development. Feng et al. reported that BTG2 may inhibit the proliferation of primary muscle fibers and play a role in the differentiation process of C2C12 myoblasts [50]. Additionally, studies have shown that the expression of BTG2 in Ziwuling black goats with low meat yield was higher than that in Liaoning cashmere goats with high meat yield [51]. miR-222-3p has also been demonstrated to regulate the proliferation and differentiation of C2C12 myoblasts by targeting BTG2 [38].
In summary, our results indicate that BTG2 possesses the capacity to inhibit proliferation and promote differentiation of C2C12 myoblasts. Thus, miR-103-3p, which plays a significant role in skeletal muscle growth and development, can promote proliferation and inhibit differentiation of C2C12 myoblasts by targeting BTG2. However, the specific pathway mechanism underlying the regulatory effects of BTG2, bound to miR-103-3p, on myoblast proliferation and differentiation, warrants further investigation.

4. Materials and Methods

4.1. Cell Culture

C2C12 myoblasts and HEK293T cells were cultured in a growth medium composed of high-glucose DMEM (DMEM Hyclone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) in a cell incubator maintained at 37 °C with 5% CO2 in a humidified environment. Differentiation of C2C12 cells was induced by switching to DMEM containing 2% horse serum (Gibco, Grand Island, NY, USA) when cell fusion reached 80%. Three independent repetitions of the entire experiment, along with three repetitions within a single experiment.

4.2. RNA Oligonucleotides and Cell Transfection

To explore the effects of miR-103-3p and its target gene on C2C12 myoblasts, we synthesized the miR-103-3p inhibitor, an inhibitor negative control (inhibitor NC), miR-103-3p mimic, negative control (mimic NC or siRNA NC) from GenePharma (GenePharma, Shanghai, China). we co-transfected C2C12 myoblasts with 50 nM miR-103-3 or mimics NC and 3 μg BTG2 plasmid or 3 μg pcDNA3.1 using 4 μL Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) in each well of a 6-well plate. For the proliferation experiments, C2C12 myoblast transfection was performed when cell density reached 40%. After 6 h of transfection, we changed the medium to a growth medium. After 24 h, the samples were received. For the differentiation experiments, transfection was performed when the cell density reached 80%. After 6 h of transfection, the medium was replaced with a differentiation medium. All RNA oligonucleotides are listed in Table 1.

4.3. RNA Extraction and Real-Time Quantitative PCR (RT-qPCR)

Total RNA was extracted from C2C12 myoblast using TRIzol reagent (Takara Bio, Otsu, Japan) according to the manufacturer’s instructions. RNA was reverse-transcribed to cDNA using the PrimeScript RT Reagent Kit (Takara Bio, Otsu, Japan). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using SYBR premixed Ex Taq kit (Vazyme Biotech, Nanjing, China). We used the 2−ΔΔCt method to quantify the target genes relative to mRNA expression level. mRNA expression was normalized relative to GAPDH, and U6 was used to normalize miR-103-3p expression. The sequence information of primers is listed in Table 2.

4.4. Western Blot

Proteins were extracted from cells using radioimmunoprecipitation assay (RIPA) buffer with 1% (v/v) reverse transcription kits (Cwbio, Taizhou, Zhejiang, China). The total protein sample was separated in the SDS-polyacrylamide gel. Then, it was transferred into a PVDF membrane (Millipore, Bedford, MA, USA). Next, the membrane was blocked in 5% defatted milk for 2 h. The primary antibody 4 was incubated overnight. The antibodies used included Ki67 (1:1000; Abcam, Cambridge, UK), CyclinD (1:1000; ProteinTech, Wuhan, China), CyclinE (1:1000; ProteinTech, Wuhan, China), MyHC (1:1000; ProteinTech, Wuhan, China), MyoD (1:1000; ProteinTech, Wuhan, China), MyoG (1:1000; ProteinTech, Wuhan, China), and GAPDH (1:2000; ProteinTech, Wuhan, China). After incubation, the membrane was washed three times with TBST solution, and secondary antibodies (Goat Anti-Mouse IgG, Boster, BA1038; Goat Anti-Rabbit IgG, Boster, BA1039; Boster Biological Technology, Pleasanton, CA, USA) were added. Finally, Western blots were exposed to the Bio-Rad imaging system. All protein levels were normalized to that of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and densitometric quantification of the Western blotting bands was performed using ImageJ (2.6.1.0) software.

4.5. Immunofluorescence Staining

The differentiated C2C12 myoblasts were fixed with 4% paraformaldehyde at room temperature for 30 min and then permeated with 0.5% Triton-100 for 30 min. Cells washed with PBS were blocked with 5% bovine serum albumin (BSA) (Biofroxx, Berlin, Germany) at room temperature for 1 h. Subsequently, the cells were incubated overnight with primary antibodies against MyHC (1:100; R&D, Minneapolis, MN, USA) at 4 °C. Following three washes with PBS, the cells were incubated with the appropriate fluorescent secondary antibody at room temperature for 1 h. Finally, the nucleus was stained with DAPI for 10 min. Then, the cells were photographed and counted under a fluorescence microscope.

4.6. 5-Ethynyl-20-Deoxyuridine (EdU) Assay

C2C12 myoblasts were seeded into 96-well cell culture plates, and transfections were carried out once the cell density reached 30–40%. After 24 h of transfection, the cells were processed following the instructions of the Cell-LightTM EdU Apollo567 In Vitro Kit (RiboBio, Guangzhou, China). Subsequently, the cells were captured under a fluorescence microscope.

4.7. CCK-8 Assay

C2C12 myoblasts were plated in 96-well cell culture plates, with each well receiving 2 × 103 cells. Transfection was conducted when the cell density reached 30–40%. After 24 h, 10 μL of Cell-Counting Kit-8 (CCK-8) reagents (Solarbio, Beijing, China) were added to the cells for a 2 h incubation period. Subsequently, the absorbance of the cells at 450 nm was measured using an enzyme-labeled instrument, and the data were subjected to statistical analysis.

4.8. Dual-Luciferase Reporter Assay

The BTG2 3’-UTR was custom-synthesized by General Biology Systems Ltd. (Chuzhou, Anhui, China). Human embryonic kidney 293T cells (obtained from the Stem Cell Bank of the Chinese Academy of Sciences) were seeded into 48-well culture plates at a density of 8000 cells per well. Subsequently, psiCHECK2-BTG2-WT and psiCHECK2-BTG2-MUT plasmids were co-transfected with either 50 nM of miR-103-3p mimics or mimics nc when the cells reached a confluence of 70%. After 48 h of transfection, we measured the relative luciferase activities of Renilla compared to those of firefly using a Dual-Luciferase reporter assay system (Promega, E1910; Madison, WI, USA), following the manufacturer’s protocol.

4.9. Bioinformation Analysis

The potential target genes of miR-103-3p were predicted using multiple platforms, including TargetScan 7.1 for the mouse (http://www.targetscan.org, accessed on 23 April 2023), miRDB (http://www.miRdb.org/miRDB/, accessed on 23 April 2023), and ENCORI (https://rnasysu.com/encori/index.php, accessed on 23 April 2023). Subsequently, these target genes were subjected to Gene Ontology (GO) enrichment analysis (https://biit.cs.ut.ee/gprofiler/convert, accessed on 23 April 2023). The significance threshold for enrichment was established at a corrected p-value of <0.05.

4.10. Statistical Analysis

All statistical analyses were conducted using GraphPad Prism 8.02. The data are presented as the mean ± standard deviation. Significance levels were determined using Student’s t-test or one-way and two-way analysis as appropriate (*, p < 0.05; **, p < 0.01), indicating the significance of differences between the groups.

5. Conclusions

In summary, our findings suggest that miR-103-3p enhances the proliferation of C2C12 myoblasts while simultaneously inhibiting their differentiation by targeting BTG2, as illustrated in Figure 7.

Author Contributions

Conceptualization, T.Y. (Taiyong Yu) and J.J.; methodology, Y.H. and P.Y.; software, P.Y. and T.Y. (Tiantian Yuan); validation, Y.H. and L.Z.; formal analysis, Y.H.; data curation, Y.H.; writing—original draft preparation, Y.H. and T.Y. (Tiantian Yuan); writing—review and editing, P.Y. and T.Y. (Tiantian Yuan); visualization, Y.H. and L.Z.; funding acquisition, T.Y. (Taiyong Yu); project administration, G.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by National Key R&D Program of China (2021YFD1301200), and Shaanxi Livestock and Poultry Breeding Double-chain Fusion Key Project (2022GD-TSLD-46).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data from this study are included in the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ohlendieck, K.; Swandulla, D. Complexity of skeletal muscle degeneration: Multi-systems pathophysiology and organ crosstalk in dystrophinopathy. Pflügers Arch. Eur. J. Physiol. 2021, 473, 1813–1839. [Google Scholar] [CrossRef] [PubMed]
  2. Grefte, S.; Kuijpers-Jagtman, A.M.; Torensma, R.; Von den Hoff, J.W. Skeletal muscle development and regeneration. Stem Cells Dev. 2007, 16, 857–868. [Google Scholar] [CrossRef] [PubMed]
  3. Zhao, Y.; Chen, M.; Lian, D.; Li, Y.; Li, Y.; Wang, J.; Deng, S.; Yu, K.; Lian, Z.J.C. Non-coding RNA regulates the myogenesis of skeletal muscle satellite cells, injury repair and diseases. Cells 2019, 8, 988. [Google Scholar] [CrossRef] [PubMed]
  4. Sanchez, A.M.; Candau, R.B.; Bernardi, H.J.C.; Sciences, M.L. FoxO transcription factors: Their roles in the maintenance of skeletal muscle homeostasis. Cell. Mol. Life Sci. 2014, 71, 1657–1671. [Google Scholar] [CrossRef] [PubMed]
  5. Kawano, F.J.A.S. Histone modification: A mechanism for regulating skeletal muscle characteristics and adaptive changes. Appl. Sci. 2021, 11, 3905. [Google Scholar] [CrossRef]
  6. Wang, J.; Yang, L.; Zhang, J.; Gong, J.; Wang, Y.; Zhang, C.; Chen, H.; Fang, X.J.G. Effects of microRNAs on skeletal muscle development. Gene 2018, 668, 107–113. [Google Scholar] [CrossRef] [PubMed]
  7. Mattick, J.S.; Makunin, I.V.J.H. Non-coding RNA. Hum. Mol. Genet. 2006, 15 (Suppl. 1), R17–R29. [Google Scholar] [CrossRef] [PubMed]
  8. Luo, D.; Renault, V.M.; Rando, T.A. The Regulation of Notch Signaling in Muscle Stem Cell Activation and Postnatal Myogenesis. Semin. Cell Dev. Biol. 2005, 16, 612–622. [Google Scholar] [CrossRef]
  9. Zhang, G.; He, M.; Wu, P.; Zhang, X.; Zhou, K.; Li, T.; Zhang, T.; Xie, K.; Dai, G.; Wang, J.J.C. MicroRNA-27b-3p targets the myostatin gene to regulate myoblast proliferation and is involved in myoblast differentiation. Cells 2021, 10, 423. [Google Scholar] [CrossRef]
  10. Bai, L.; Liang, R.; Yang, Y.; Hou, X.; Wang, Z.; Zhu, S.; Wang, C.; Tang, Z.; Li, K.J.P. MicroRNA-21 regulates PI3K/Akt/mTOR signaling by targeting TGFβI during skeletal muscle development in pigs. PLoS ONE 2015, 10, e0119396. [Google Scholar] [CrossRef]
  11. Cheng, N.; Liu, C.; Li, Y.; Gao, S.; Han, Y.-C.; Wang, X.; Du, J.; Zhang, C.J.J. MicroRNA-223-3p promotes skeletal muscle regeneration by regulating inflammation in mice. J. Biol. Chem. 2020, 295, 10212–10223. [Google Scholar] [CrossRef] [PubMed]
  12. Geng, H.; Song, Q.; Cheng, Y.; Li, H.; Yang, R.; Liu, S.; Hao, L.J.I.J. MicroRNA 322 aggravates dexamethasone-induced muscle atrophy by targeting IGF1R and INSR. Int. J. Mol. Sci. 2020, 21, 1111. [Google Scholar] [CrossRef] [PubMed]
  13. Ding, J.; Xia, C.; Cen, P.; Li, S.; Yu, L.; Zhu, J.; Jin, J. miR-103-3p promotes hepatic steatosis to aggravate nonalcoholic fatty liver disease by targeting of ACOX1. Mol. Biol. Rep. 2022, 49, 7297–7305. [Google Scholar] [CrossRef] [PubMed]
  14. Sun, Z.; Wang, H.; Wang, Y.; Yuan, G.; Yu, X.; Jiang, H.; Wu, Q.; Yang, B.; Hu, Z.; Shi, F.J.A. miR-103-3p targets the m6A methyltransferase METTL14 to inhibit osteoblastic bone formation. Aging Cell 2021, 20, e13298. [Google Scholar] [CrossRef] [PubMed]
  15. Li, W.; Wang, S.-S.; Shan, B.-Q.; Qin, J.-B.; Zhao, H.-Y.; Tian, M.-L.; He, H.; Cheng, X.; Zhang, X.-H.; Jin, G.-H.J.N. miR-103-3p targets Ndel1 to regulate neural stem cell proliferation and differentiation. Neural Regen. Res. 2022, 17, 401. [Google Scholar] [PubMed]
  16. Jin, J.; Du, M.; Wang, J.; Guo, Y.; Zhang, J.; Zuo, H.; Hou, Y.; Wang, S.; Lv, W.; Bai, W.J.J. Conservative analysis of Synaptopodin-2 intron sense-overlapping lncRNA reveals its novel function in promoting muscle atrophy. J. Cachexia Sarcopenia Muscle 2022, 13, 2017–2030. [Google Scholar] [CrossRef] [PubMed]
  17. Duriez, C.; Moyret-Lalle, C.; Falette, N.; Fatiha, E.-G.; Puisieux, A.J.B. BTG2, its family and its tutor. Bull. Cancer 2004, 91, 10242–10253. [Google Scholar]
  18. Mauxion, F.; Faux, C.; Séraphin, B.J.T.E. The BTG2 protein is a general activator of mRNA deadenylation. EMBO J. 2008, 27, 1039–1048. [Google Scholar] [CrossRef]
  19. Zhang, Z.; Chen, C.; Wang, G.; Yang, Z.; San, J.; Zheng, J.; Li, Q.; Luo, X.; Hu, Q.; Li, Z.J.C. Aberrant expression of the p53-inducible antiproliferative gene BTG2 in hepatocellular carcinoma is associated with overexpression of the cell cycle-related proteins. Cell Biochem. Biophys. 2011, 61, 83–91. [Google Scholar] [CrossRef]
  20. Wheaton, K.; Muir, J.; Ma, W.; Benchimol, S.J.A. BTG2 antagonizes Pin1 in response to mitogens and telomere disruption during replicative senescence. Aging Cell 2010, 9, 747–760. [Google Scholar] [CrossRef]
  21. Passeri, D.; Marcucci, A.; Rizzo, G.; Billi, M.; Panigada, M.; Leonardi, L.; Tirone, F.; Grignani, F.J.M. Btg2 enhances retinoic acid-induced differentiation by modulating histone H4 methylation and acetylation. Mol. Cell. Biol. 2006, 26, 5023–5032. [Google Scholar] [CrossRef] [PubMed]
  22. Zhu, C.; Zhang, S.; Xue, A.; Feng, G.; Fan, S.J.T.C. Elevated BTG2 improves the radiosensitivity of non-small cell lung cancer (NSCLC) through apoptosis. DNA Damage Repair 2022, 13, 1441–1448. [Google Scholar] [CrossRef] [PubMed]
  23. Peng, B.; Chen, Y.; Wang, Y.; Fu, Y.; Zeng, X.; Zhou, H.; Abulaiti, Z.; Wang, S.; Zhang, H.J.B.; Communications, B.R. BTG2 acts as an inducer of muscle stem cell senescence. Biochem. Biophys. Res. Commun. 2023, 669, 113–119. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, D.; Gan, M.; Tan, Y.; Ge, G.; Li, Q.; Jiang, Y.; Tang, G.; Li, M.; Wang, J.; Li, X.J.M.B. miR-222-3p Regulates the Proliferation and Differentiation of C2C12 Myoblasts by Targeting BTG2. Mol. Biol. 2019, 53, 44–52. [Google Scholar] [CrossRef]
  25. Ren, K.; Wang, L.; Wang, L.; Du, Q.; Cao, J.; Jin, Q.; An, G.; Li, N.; Dang, L.; Tian, Y.J.F. Investigating transcriptional dynamics changes and time-dependent marker gene expression in the early period after skeletal muscle injury in rats. Front. Genet. 2021, 12, 650874. [Google Scholar] [CrossRef] [PubMed]
  26. Yaffe, D.; Saxel, O.J.N. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 1977, 270, 725–727. [Google Scholar] [CrossRef] [PubMed]
  27. Jiang, L.; Li, D.; Wang, C.; Liao, J.; Liu, J.; Wei, Q.; Wang, Y.J.P.; Research, O. Decreased expression of karyopherin-α 1 is related to the malignant degree of cervical cancer and is critical for the proliferation of Hela cells. Pathol. Oncol. Res. 2022, 28, 1610518. [Google Scholar] [CrossRef] [PubMed]
  28. Cheng, B.-B.; Qu, M.-J.; Wu, L.-L.; Shen, Y.; Yan, Z.-Q.; Zhang, P.; Qi, Y.-X.; Jiang, Z.-L. MicroRNA-34a targets Forkhead box j2 to modulate differentiation of endothelial progenitor cells in response to shear stress. J. Mol. Cell. Cardiol. 2014, 74, 4–12. [Google Scholar] [CrossRef]
  29. Cirera-Salinas, D.; Yu, J.; Bodak, M.; Ngondo, R.P.; Herbert, K.M.; Ciaudo, C.J.J. Noncanonical function of DGCR8 controls mESC exit from pluripotency. J. Cell Biol. 2017, 216, 355–366. [Google Scholar] [CrossRef]
  30. Stupfler, B.; Birck, C.; Séraphin, B.; Mauxion, F.J.N. BTG2 bridges PABPC1 RNA-binding domains and CAF1 deadenylase to control cell proliferation. Nat. Commun. 2016, 7, 10811. [Google Scholar] [CrossRef]
  31. Ma, X.; Zhang, X.; Luo, J.; Liang, B.; Peng, J.; Chen, C.; Guo, H.; Wang, Q.; Xing, X.; Deng, Q.J.T. miR-486-5p-directed MAGI1/Rap1/RASSF5 signaling pathway contributes to hydroquinone-induced inhibition of erythroid differentiation in K562 cells. Toxicol. In Vitro 2020, 66, 104830. [Google Scholar] [CrossRef] [PubMed]
  32. Liu, B.; Yu, H.-M.I.; Hsu, W.J.D. Craniosynostosis caused by Axin2 deficiency is mediated through distinct functions of β-catenin in proliferation and differentiation. Dev. Biol. 2007, 301, 298–308. [Google Scholar] [CrossRef] [PubMed]
  33. Ballarino, M.; Morlando, M.; Fatica, A.; Bozzoni, I.J.T.J. Non-coding RNAs in muscle differentiation and musculoskeletal disease. J. Clin. Investig. 2016, 126, 2021–2030. [Google Scholar] [CrossRef] [PubMed]
  34. Li, X.; Qiu, J.; Liu, H.; Deng, Y.; Hu, S.; Hu, J.; Wang, Y.; Wang, J.J.B. MicroRNA-33a negatively regulates myoblast proliferation by targeting IGF1, follistatin and cyclin D1. Biosci. Rep. 2020, 40, BSR20191327. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, Y.; Yao, Y.; Wang, Z.; Lu, D.; Zhang, Y.; Adetula, A.A.; Liu, S.; Zhu, M.; Yang, Y.; Fan, X.J.G. miR-743a-5p regulates differentiation of myoblast by targeting Mob1b in skeletal muscle development and regeneration. Genes Dis. 2022, 9, 1038–1048. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, K.; Liufu, S.; Yu, Z.; Xu, X.; Ai, N.; Li, X.; Liu, X.; Chen, B.; Zhang, Y.; Ma, H.J.I.J. miR-100-5p Regulates Skeletal Muscle Myogenesis through the Trib2/mTOR/S6K Signaling Pathway. Int. J. Mol. Sci. 2023, 24, 8906. [Google Scholar] [CrossRef]
  37. Kang, T.; Xing, W.; Xi, Y.; Chen, K.; Zhan, M.; Tang, X.; Wang, Y.; Zhang, R.; Lei, M.J.J. miR-543 regulates myoblast proliferation and differentiation of C2C12 cells by targeting KLF6. Ournal Cell. Biochem. 2020, 121, 4827–4837. [Google Scholar] [CrossRef] [PubMed]
  38. Zhang, D.; Ran, J.; Li, J.; Yu, C.; Cui, Z.; Amevor, F.K.; Wang, Y.; Jiang, X.; Qiu, M.; Du, H.J.G. miR-21-5p regulates the proliferation and differentiation of skeletal muscle satellite cells by targeting KLF3 in chicken. Genes 2021, 12, 814. [Google Scholar] [CrossRef]
  39. Cao, H.; Du, T.; Li, C.; Wu, L.; Liu, J.; Guo, Y.; Li, X.; Yang, G.; Jin, J.; Shi, X. MicroRNA-668-3p inhibits myoblast proliferation and differentiation by targeting Appl1. BMC Genom. 2023, 24, 415. [Google Scholar] [CrossRef]
  40. Zheng, J.; Liu, Y.; Qiao, Y.; Zhang, L.; Lu, S.J.I. miR-103 promotes proliferation and metastasis by targeting KLF4 in gastric cancer. Int. J. Mol. Sci. 2017, 18, 910. [Google Scholar] [CrossRef]
  41. Natarelli, L.; Geißler, C.; Csaba, G.; Wei, Y.; Zhu, M.; di Francesco, A.; Hartmann, P.; Zimmer, R.; Schober, A.J.N. miR-103 promotes endothelial maladaptation by targeting lncWDR59. Nat. Commun. 2018, 9, 2645. [Google Scholar] [CrossRef]
  42. Wang, L.; Chen, X.; Zheng, Y.; Li, F.; Lu, Z.; Chen, C.; Liu, J.; Wang, Y.; Peng, Y.; Shen, Z.J.E. miR-23a inhibits myogenic differentiation through down regulation of fast myosin heavy chain isoforms. Exp. Cell Res. 2012, 318, 2324–2334. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, B.; Zhang, C.; Zhang, A.; Cai, H.; Price, S.R.; Wang, X.H.J.J. MicroRNA-23a and microRNA-27a mimic exercise by ameliorating CKD-induced muscle atrophy. J. Am. Soc. Nephrol. JASN 2017, 28, 2631. [Google Scholar] [CrossRef] [PubMed]
  44. Antoniou, A.; Mastroyiannopoulos, N.P.; Uney, J.B.; Phylactou, L.A. miR-186 inhibits muscle cell differentiation through myogenin regulation. J. Biol. Chem. 2014, 289, 3923–3935. [Google Scholar] [CrossRef] [PubMed]
  45. Lei, S.; She, Y.; Zeng, J.; Chen, R.; Zhou, S.; Shi, H.J.M. Expression patterns of regulatory lncRNAs and miRNAs in muscular atrophy models induced by starvation in vitro and in vivo. Mol. Med. Rep. 2019, 20, 4175–4185. [Google Scholar] [CrossRef] [PubMed]
  46. Rouleau, S.; Glouzon, J.-P.S.; Brumwell, A.; Bisaillon, M.; Perreault, J.-P.J.R. 3’UTR G-quadruplexes regulate miRNA binding. RNA 2017, 23, 1172–1179. [Google Scholar] [CrossRef]
  47. Kim, S.H.; Jung, I.R.; Hwang, S.S.J.B. Emerging role of antiproliferative protein BTG1 and BTG2. BMB Rep. 2022, 55, 380. [Google Scholar] [CrossRef] [PubMed]
  48. Konrad, M.A.; Zúñiga-Pflücker, J.C.J.E. The BTG/TOB family protein TIS21 regulates stage-specific proliferation of developing thymocytes. Eur. J. Immunol. 2005, 35, 3030–3042. [Google Scholar] [CrossRef]
  49. Rouault, J.-P.; Falette, N.; Guéhenneux, F.; Guillot, C.; Rimokh, R.; Wang, Q.; Berthet, C.; Moyret-Lalle, C.; Savatier, P.; Pain, B.J.N. Identification of BTG2, an antiproliferative p53–dependent component of the DNA damage cellular response pathway. Nat. Genet. 1996, 14, 482–486. [Google Scholar] [CrossRef]
  50. Feng, Z.; Tang, Z.-L.; Li, K.; Liu, B.; Yu, M.; Zhao, S.-H.J.G. Molecular characterization of the BTG2 and BTG3 genes in fetal muscle development of pigs. Gene 2007, 403, 170–177. [Google Scholar] [CrossRef]
  51. Shen, J.; Hao, Z.; Wang, J.; Hu, J.; Liu, X.; Li, S.; Ke, N.; Song, Y.; Lu, Y.; Hu, L.J.F. Comparative transcriptome profile analysis of longissimus dorsi muscle tissues from two goat breeds with different meat production performance using RNA-Seq. Front. Genet. 2021, 11, 619399. [Google Scholar] [CrossRef]
Ijms 24 15318 g001
Figure 1. miR-103-3p promotes the proliferation of C2C12 myoblasts. (A) Relative expression level of miR-103-3p in 5-month-old mouse tissues. (B) The mRNA expression of miR-103-3p in the C2C12 myoblasts proliferation and differentiation. (C,F) The mRNA expression of miR-10o3-3p, Ki67, CDK4 and CDK6 after miR-103-3p mimics or inhibitor transfection were measured by RT-qPCR. (D,E,G,H) Protein expression of Ki67, CyclinE and CyclinD after miR-103-3p mimics or inhibitor transfection were measured by Western blot, and grayscale analysis were performed by Image J (2.6.1.0). (I–K) The proliferation of C2C12 myoblasts after miR-103-3p transfection was detected by EDU staining. S-phase myoblasts were stained with EdU (red) and nuclei with Hoechst (blue) and counted with Image J. The scale bar represents 200 μm. (L,M) CCK-8 analysis after treatment with miR-103-3p mimics and inhibitor during C2C12 myoblasts proliferation. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Figure 1. miR-103-3p promotes the proliferation of C2C12 myoblasts. (A) Relative expression level of miR-103-3p in 5-month-old mouse tissues. (B) The mRNA expression of miR-103-3p in the C2C12 myoblasts proliferation and differentiation. (C,F) The mRNA expression of miR-10o3-3p, Ki67, CDK4 and CDK6 after miR-103-3p mimics or inhibitor transfection were measured by RT-qPCR. (D,E,G,H) Protein expression of Ki67, CyclinE and CyclinD after miR-103-3p mimics or inhibitor transfection were measured by Western blot, and grayscale analysis were performed by Image J (2.6.1.0). (I–K) The proliferation of C2C12 myoblasts after miR-103-3p transfection was detected by EDU staining. S-phase myoblasts were stained with EdU (red) and nuclei with Hoechst (blue) and counted with Image J. The scale bar represents 200 μm. (L,M) CCK-8 analysis after treatment with miR-103-3p mimics and inhibitor during C2C12 myoblasts proliferation. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Ijms 24 15318 g001
Ijms 24 15318 g002
Figure 2. miR-103-3p inhibited the differentiation of C2C12 myoblasts. (A,D) The mRNA expression of miR-103-3p, MyHC, MyoD and MyoG after miR-103-3p mimics or inhibitor transfection were measured by RT-qPCR. (B,C,E,F) Differentiation marker genes protein expression of MyHC, MyoD and MyoG after miR-103-3p mimics or inhibitor transfection were measured by Western blot, and grayscale analysis were performed by ImageJ. (G–J) MyHC immunofluorescence staining and differentiation index after miR-103-3p overexpression and knockdown. The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 2. miR-103-3p inhibited the differentiation of C2C12 myoblasts. (A,D) The mRNA expression of miR-103-3p, MyHC, MyoD and MyoG after miR-103-3p mimics or inhibitor transfection were measured by RT-qPCR. (B,C,E,F) Differentiation marker genes protein expression of MyHC, MyoD and MyoG after miR-103-3p mimics or inhibitor transfection were measured by Western blot, and grayscale analysis were performed by ImageJ. (G–J) MyHC immunofluorescence staining and differentiation index after miR-103-3p overexpression and knockdown. The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001.
Ijms 24 15318 g002
Ijms 24 15318 g003aIjms 24 15318 g003b
Figure 3. miR-103-3p directly targeted BTG2. (A) V The Venn diagram showed that miRDB, Targetsan and ENCORI predicted the target genes of miR-103-3p. (B) GO enrichment analysis revealed the enrichment pathway of miR-103-3p target genes. (C,D) Relative expression of BTG2 mRNA at proliferation stage after treatment with miR-103-3p mimics and inhibitors. (E,F) Relative expression of BTG2 mRNA at differentiation stage after treatment with miR-103-3p mimics and inhibitors. (G) Relative expression level of BTG2 in 5-month-old mouse tissues. (H–J) mRNA and Western blotting analysis of BTG2 protein expression in the myoblasts during proliferation and differentiation. (K,L) Schematic diagram and prediction of the binding site of miR-103-3p in the BTG2 3′UTR. The red font in figure (L) represents the binding site (M) Dual-luciferase reporter assays were performed after cotransfection of miR-103-3p mimics or mimics NC and psiCHECK2-BTG2-WT and psiCHECK2-BTG2-MUT vectors. The relative luciferase activity was presented as Renilla luciferase/firefly luciferase. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Figure 3. miR-103-3p directly targeted BTG2. (A) V The Venn diagram showed that miRDB, Targetsan and ENCORI predicted the target genes of miR-103-3p. (B) GO enrichment analysis revealed the enrichment pathway of miR-103-3p target genes. (C,D) Relative expression of BTG2 mRNA at proliferation stage after treatment with miR-103-3p mimics and inhibitors. (E,F) Relative expression of BTG2 mRNA at differentiation stage after treatment with miR-103-3p mimics and inhibitors. (G) Relative expression level of BTG2 in 5-month-old mouse tissues. (H–J) mRNA and Western blotting analysis of BTG2 protein expression in the myoblasts during proliferation and differentiation. (K,L) Schematic diagram and prediction of the binding site of miR-103-3p in the BTG2 3′UTR. The red font in figure (L) represents the binding site (M) Dual-luciferase reporter assays were performed after cotransfection of miR-103-3p mimics or mimics NC and psiCHECK2-BTG2-WT and psiCHECK2-BTG2-MUT vectors. The relative luciferase activity was presented as Renilla luciferase/firefly luciferase. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Ijms 24 15318 g003aIjms 24 15318 g003b
Ijms 24 15318 g004
Figure 4. BTG2 inhibits the proliferation and promotes the differentiation of C2C12 myoblasts. (A,D) The mRNA expression of Ki67, CDK4, CDK6, MyHC, MyoD and MyoG after pc-BTG2 or pcDNA3.1 transfection were measured by RT-qPCR. (B,C,E,F) Protein expression of BTG2, Ki67, CyclinE, CyclinD MyHC, MyoD and MyoG after pc-BTG2 or pcDNA3.1 transfection were measured by Western blot, and grayscale analysis were performed by ImageJ. (G,H) The proliferation of C2C12 myoblasts after BTG2 transfection wree detected by EDU staining. S-phase myoblasts were stained with EdU (green) and nuclei with Hoechst (blue) and counted with ImageJ. The scale bar represents 50 μm. (I,J) MyHC immunofluorescence staining and differentiation index after BTG2 overexpression. MyHC myotube (red) and nuclei with DAPI (blue). The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Figure 4. BTG2 inhibits the proliferation and promotes the differentiation of C2C12 myoblasts. (A,D) The mRNA expression of Ki67, CDK4, CDK6, MyHC, MyoD and MyoG after pc-BTG2 or pcDNA3.1 transfection were measured by RT-qPCR. (B,C,E,F) Protein expression of BTG2, Ki67, CyclinE, CyclinD MyHC, MyoD and MyoG after pc-BTG2 or pcDNA3.1 transfection were measured by Western blot, and grayscale analysis were performed by ImageJ. (G,H) The proliferation of C2C12 myoblasts after BTG2 transfection wree detected by EDU staining. S-phase myoblasts were stained with EdU (green) and nuclei with Hoechst (blue) and counted with ImageJ. The scale bar represents 50 μm. (I,J) MyHC immunofluorescence staining and differentiation index after BTG2 overexpression. MyHC myotube (red) and nuclei with DAPI (blue). The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Ijms 24 15318 g004
Ijms 24 15318 g005
Figure 5. miR-103-3p promotes C2C12 myoblasts proliferation by targeting BTG2. (A) The mRNA expression levels of miR-103-3p, BTG2, Ki67, CDK4 and CDK6 after miR-103-3p and BTG2 contransfection were measured by RT-qPCR. (B,C) The protein expression levels of the proliferation maker genes Ki67, CyclinE and CyclinD after contransfection of miR-103-3p and BTG2, and the grayscale analysis were performed by ImageJ. (D,E) The proliferation of C2C12 myoblasts after miR-103-3p and BTG2 contransfection were detected by EdU staining. S-phase myoblasts were stained with EdU (green) and nuclei with Hoechst (blue) and counted with Image J. The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Figure 5. miR-103-3p promotes C2C12 myoblasts proliferation by targeting BTG2. (A) The mRNA expression levels of miR-103-3p, BTG2, Ki67, CDK4 and CDK6 after miR-103-3p and BTG2 contransfection were measured by RT-qPCR. (B,C) The protein expression levels of the proliferation maker genes Ki67, CyclinE and CyclinD after contransfection of miR-103-3p and BTG2, and the grayscale analysis were performed by ImageJ. (D,E) The proliferation of C2C12 myoblasts after miR-103-3p and BTG2 contransfection were detected by EdU staining. S-phase myoblasts were stained with EdU (green) and nuclei with Hoechst (blue) and counted with Image J. The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Ijms 24 15318 g005
Ijms 24 15318 g006
Figure 6. miR-103-3p inhibits C2C12 myoblasts differentiation by targeting BTG2. (A) The mRNA expression levels of miR-103-3p, BTG2, MyHC, MyoD and MyoG after miR-103-3p and BTG2 contransfection were measured by RT-qPCR. (B,C) The protein expression levels of the differentiation maker genes MyHC, MyoD and MyoG after contransfection of miR-103-3p and BTG2, and the grayscale analysis were performed by ImageJ. (D,E) MyHC immunofluorescence staining and differentiation index after miR-103-3p and BTG2 contransfection. MyHC myotube (red) and nuclei with DAPI (blue). The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Figure 6. miR-103-3p inhibits C2C12 myoblasts differentiation by targeting BTG2. (A) The mRNA expression levels of miR-103-3p, BTG2, MyHC, MyoD and MyoG after miR-103-3p and BTG2 contransfection were measured by RT-qPCR. (B,C) The protein expression levels of the differentiation maker genes MyHC, MyoD and MyoG after contransfection of miR-103-3p and BTG2, and the grayscale analysis were performed by ImageJ. (D,E) MyHC immunofluorescence staining and differentiation index after miR-103-3p and BTG2 contransfection. MyHC myotube (red) and nuclei with DAPI (blue). The scale bar represents 50 μm. Data are means ± SD (n = 3). * p < 0.05, ** p < 0.01.
Ijms 24 15318 g006
Ijms 24 15318 g007
Figure 7. miR-103-3p promotes proliferation and inhibits differentiation of C2C12 myoblasts by targeting BTG2.
Figure 7. miR-103-3p promotes proliferation and inhibits differentiation of C2C12 myoblasts by targeting BTG2.
Ijms 24 15318 g007
Table 1. RNA oligonucleotides used in this study.
Table 1. RNA oligonucleotides used in this study.
GenePrimer Sequences
Forward PrimerReverse Primer
GAPDHAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
Ki67ATCATTGACCGCTCCTTTAGGTGCTCGCCTTGATGGTTCCT
CDK4AGTTTCTAAGCGGCCTGGATAACTTCAGGAGCTCGGTACC
CDK6GGCGTACCCACAGAAACCATAAGGTAAGGGCCATCTGAAAACT
MyHCACGATGGACGTAAGGGAGTGCAGATTGTCGTACTTGGGCGGGTTC
MyODCGAGCACTACAGTGGCGACTCAGATGCTCCACTATGCTGGACAGGCAGT
MyOGCCATCCAGTACATTGAGCGCCTACAACGATGGACGTAAGGGAGTGCAGAT
miR-103-3pAACACGCAGCAGCATTGTACGTCGTATCCAGTGCAGGGT
U6GTGCTCGCTTCGGCAGCACATATAAAATATGGAACGCTTCACGAA
BTG2GGTTGGAGAAAATTGGGAAACGCTTCTAAGAAGCCCTCATC
Table 2. Primer information for miRNA and mRNA quantitative reverse transcription.
Table 2. Primer information for miRNA and mRNA quantitative reverse transcription.
NameSequence (5′ to 3′)
miR-103-3p mimicAGCAGCAUUGUACAGGGCUAUGA
AUAGCCCUGUACAAUGCUGCUUU
mimics NCUUCUCCGAACGUGUCACGUTT
ACGUGACACGUUCGGAGAATT
miR-103-3p inhibitorUCAUAGCCCUGUACAAUGCUGCU
inhibitor NCCAGUACUUUUGUGUAGUACAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

He, Y.; Yang, P.; Yuan, T.; Zhang, L.; Yang, G.; Jin, J.; Yu, T. miR-103-3p Regulates the Proliferation and Differentiation of C2C12 Myoblasts by Targeting BTG2. Int. J. Mol. Sci. 2023, 24, 15318. https://doi.org/10.3390/ijms242015318

AMA Style

He Y, Yang P, Yuan T, Zhang L, Yang G, Jin J, Yu T. miR-103-3p Regulates the Proliferation and Differentiation of C2C12 Myoblasts by Targeting BTG2. International Journal of Molecular Sciences. 2023; 24(20):15318. https://doi.org/10.3390/ijms242015318

Chicago/Turabian Style

He, Yulin, Peiyu Yang, Tiantian Yuan, Lin Zhang, Gongshe Yang, Jianjun Jin, and Taiyong Yu. 2023. "miR-103-3p Regulates the Proliferation and Differentiation of C2C12 Myoblasts by Targeting BTG2" International Journal of Molecular Sciences 24, no. 20: 15318. https://doi.org/10.3390/ijms242015318

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop