Yth m6A RNA-Binding Protein 1 Regulates Osteogenesis of MC3T3-E1 Cells under Hypoxia via Translational Control of Thrombospondin-1
Abstract
:1. Introduction
2. Results
2.1. Hypoxia Promotes YTHDF1 Expression and Inhibits Osteoblasts Differentiation
2.2. Hypoxia Promotes YTHDF1 Expression and Inhibits Osteoblasts Differentiation
2.3. Bioinformatics Analysis Identified THBS1 as a Downstream Factor of YTHDF1
2.4. THBS1 mRNA Regulated by YTHDF1 in a M6A-Dependent Way
2.5. THBS1 Promotes Osteogenic Differentiation of MC3T3-E1 Cells under Hypoxia
2.6. THBS1 as a Target Gene of YTHDF1 and a Mediator of the Osteogenic Differentiation under Hypoxia
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Hypoxia Treatment
4.2. Transient Transfection
4.3. Total RNA Extraction and Quantitative Real-Time PCR
4.4. mRNA Stability
4.5. Western Blotting
4.6. Immunofluorescence Assays
4.7. ALP Assay
4.8. Alizarin Red Staining
4.9. Bioinformatics Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Steiger-Ronay, V.; Merlini, A.; Wiedemeier, D.B.; Schmidlin, P.R.; Attin, T.; Sahrmann, P. Location of unaccessible implant surface areas during debridement in simulated peri-implantitis therapy. BMC Oral Health 2017, 17, 137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mombelli, A.; Müller, N.; Cionca, N. The epidemiology of peri-implantitis. Clin. Oral Implant. Res. 2012, 23 (Suppl. 6), 67–76. [Google Scholar] [CrossRef] [PubMed]
- Eltzschig, H.K.; Carmeliet, P. Hypoxia and inflammation. N. Engl. J. Med. 2011, 364, 656–665. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chai, M.; Gu, C.; Shen, Q.; Liu, J.; Zhou, Y.; Jin, Z.; Xiong, W.; Zhou, Y.; Tan, W. Hypoxia alleviates dexamethasone-induced inhibition of angiogenesis in cocultures of HUVECs and rBMSCs via HIF-1α. Stem Cell Res. Ther. 2020, 11, 343. [Google Scholar] [CrossRef] [PubMed]
- Cheng, R.; Liu, W.; Zhang, R.; Feng, Y.; Bhowmick, N.A.; Hu, T. Porphyromonas gingivalis-Derived Lipopolysaccharide Combines Hypoxia to Induce Caspase-1 Activation in Periodontitis. Front. Cell Infect. Microbiol. 2017, 7, 474. [Google Scholar] [CrossRef] [PubMed]
- Chang, X.; Zhou, F.; Bu, L.; Wang, N.; Deng, J.; Wang, S. Semaphorin 3A attenuates the hypoxia suppression of osteogenesis in periodontal ligament stem cells. J. Periodontal. Res. 2022, 57, 425–433. [Google Scholar] [CrossRef]
- Karatas, O.; Balci Yuce, H.; Taskan, M.M.; Gevrek, F.; Lafci, E.; Kasap, H. Histological evaluation of peri-implant mucosal and gingival tissues in peri-implantitis, peri-implant mucositis and periodontitis patients: A cross-sectional clinical study. Acta Odontol. Scand. 2020, 78, 241–249. [Google Scholar] [CrossRef] [PubMed]
- De Araújo, M.F.; Etchebehere, R.M.; De Melo, M.L.R.; Beghini, M.; Severino, V.O.; de Castro Côbo, E.; Rocha Rodrigues, D.B.; de Lima Pereira, S.A. Analysis of CD15, CD57 and HIF-1α in biopsies of patients with peri-implantitis. Pathol. Res. Pract. 2017, 213, 1097–1101. [Google Scholar] [CrossRef] [PubMed]
- Ivanovski, S.; Lee, R. Comparison of peri-implant and periodontal marginal soft tissues in health and disease. Periodontology 2000, 76, 116–130. [Google Scholar] [CrossRef] [PubMed]
- Carcuac, O.; Berglundh, T. Composition of human peri-implantitis and periodontitis lesions. J. Dent. Res. 2014, 93, 1083–1088. [Google Scholar] [CrossRef] [PubMed]
- Belibasakis, G.N.; Charalampakis, G.; Bostanci, N.; Stadlinger, B. Peri-implant infections of oral biofilm etiology. Adv. Exp. Med. Biol. 2015, 830, 69–84. [Google Scholar]
- Yang, S.; Wei, J.; Cui, Y.H.; Park, G.; Shah, P.; Deng, Y.; Aplin, A.E.; Lu, Z.; Hwang, S.; He, C.; et al. m(6)A mRNA demethylase FTO regulates melanoma tumorigenicity and response to anti-PD-1 blockade. Nat. Commun. 2019, 10, 2782. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, B.S.; Roundtree, I.A.; He, C. Post-transcriptional gene regulation by mRNA modifications. Nat. Rev. Mol Cell Biol. 2017, 18, 31–42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Selberg, S.; Blokhina, D.; Aatonen, M.; Koivisto, P.; Siltanen, A.; Mervaala, E.; Kankuri, E.; Karelson, M. Discovery of Small Molecules that Activate RNA Methylation through Cooperative Binding to the METTL3-14-WTAP Complex Active Site. Cell Rep. 2019, 26, 3762–3771. [Google Scholar] [CrossRef] [Green Version]
- Strick, A.; Von Hagen, F.; Gundert, L.; Klümper, N.; Tolkach, Y.; Schmidt, D.; Kristiansen, G.; Toma, M.; Ritter, M.; Ellinger, J. The N(6) -methyladenosine (m(6) A) erasers alkylation repair homologue 5 (ALKBH5) and fat mass and obesity-associated protein (FTO) are prognostic biomarkers in patients with clear cell renal carcinoma. BJU Int. 2020, 125, 617–624. [Google Scholar] [CrossRef]
- Gerstberger, S.; Hafner, M.; Tuschl, T. A census of human RNA-binding proteins. Nat. Rev. Genet. 2014, 15, 829–845. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhao, B.S.; Roundtree, I.A.; Lu, Z.; Han, D.; Ma, H.; Weng, X.; Chen, K.; Shi, H.; He, C. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell 2015, 161, 1388–1399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.; Ni, Y.; Zhang, L.; Jiang, R.; Xu, J.; Yang, H.; Hu, Y.; Qiu, J.; Pu, L.; Tang, J.; et al. HIF-1α-induced expression of m6A reader YTHDF1 drives hypoxia-induced autophagy and malignancy of hepatocellular carcinoma by promoting ATG2A and ATG14 translation. Signal Transduct. Target. Ther. 2021, 6, 76. [Google Scholar] [CrossRef]
- Yao, X.; Li, W.; Li, L.; Li, M.; Zhao, Y.; Fang, D.; Zeng, X.; Luo, Z. YTHDF1 upregulation mediates hypoxia-dependent breast cancer growth and metastasis through regulating PKM2 to affect glycolysis. Cell Death Dis. 2022, 13, 258. [Google Scholar] [CrossRef]
- Fang, J.; Chen, Z.; Lai, X.; Yin, W.; Guo, Y.; Zhang, W.; Ma, J.; Li, G.; Zhang, L. Mesenchymal stem cells-derived HIF-1α-overexpressed extracellular vesicles ameliorate hypoxia-induced pancreatic β cell apoptosis and senescence through activating YTHDF1-mediated protective autophagy. Bioorg. Chem. 2022, 129, 106194. [Google Scholar] [CrossRef]
- Zou, Z.; He, T.; Liu, Y.; Zheng, L.; Zhong, Y.; Mo, Y.; Peng, S.; Shuai, C. Emerging role of m6A modification in osteogenesis of stem cells. J. Bone Miner. Metab. 2022, 40, 177–188. [Google Scholar] [CrossRef]
- Liu, R.; Zhong, Y.; Chen, R.; Chu, C.; Liu, G.; Zhou, Y.; Huang, Y.; Fang, Z.; Liu, H. m(6)A reader hnRNPA2B1 drives multiple myeloma osteolytic bone disease. Theranostics 2022, 12, 7760–7774. [Google Scholar] [CrossRef]
- He, M.; Li, D.; Fang, C.; Xu, Q. YTHDF1 regulates endoplasmic reticulum stress, NF-κB, MAPK and PI3K-AKT signaling pathways in inflammatory osteoclastogenesis. Arch Biochem. Biophys. 2022, 732, 109464. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Wang, W.; Luo, P.; Wang, Y.; He, Z.; Dong, W.; Jia, M.; Yu, X.; Yang, B.; Wang, J. Mettl3 regulates hypertrophic differentiation of chondrocytes through modulating Dmp1 mRNA via YTHDF1-mediated m(6)A. modification. Bone 2022, 164, 116522. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zheng, X.; Wang, C.; Wang, C.; Jiang, S.; Li, B.; Chen, P.; Xu, W.; Zheng, H.; Yang, R.; et al. The m(6)A “reader” YTHDF1 promotes osteogenesis of bone marrow mesenchymal stem cells through translational control of ZNF839. Cell Death Dis. 2021, 12, 1078. [Google Scholar] [CrossRef]
- Derks, J.; Tomasi, C. Peri-implant health and disease. A systematic review of current epidemiology. J. Clin. Periodontol. 2015, 42 (Suppl. 16), S158–S171. [Google Scholar] [CrossRef] [PubMed]
- Gölz, L.; Memmert, S.; Rath-Deschner, B.; Jäger, A.; Appel, T.; Baumgarten, G.; Götz, W.; Frede, S. Hypoxia and P. gingivalis synergistically induce HIF-1 and NF-κB activation in PDL cells and periodontal diseases. Mediat. Inflamm. 2015, 2015, 438085. [Google Scholar] [CrossRef] [Green Version]
- Qin, Q.; Liu, Y.; Yang, Z.; Aimaijiang, M.; Ma, R.; Yang, Y.; Zhang, Y.; Zhou, Y. Hypoxia-Inducible Factors Signaling in Osteogenesis and Skeletal Repair. Int. J. Mol. Sci. 2022, 23, 11201. [Google Scholar] [CrossRef] [PubMed]
- Mingyuan, X.; Qianqian, P.; Shengquan, X.; Chenyi, Y.; Rui, L.; Yichen, S.; Jinghong, X. Hypoxia-inducible factor-1α activates transforming growth factor-β1/Smad signaling and increases collagen deposition in dermal fibroblasts. Oncotarget 2018, 9, 3188–3197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef] [Green Version]
- Zhang, K.; Zhang, T.; Yang, Y.; Tu, W.; Huang, H.; Wang, Y.; Chen, Y.; Pan, K.; Chen, Z. N(6)-methyladenosine-mediated LDHA induction potentiates chemoresistance of colorectal cancer cells through metabolic reprogramming. Theranostics 2022, 12, 4802–4817. [Google Scholar] [CrossRef]
- Liu, T.; Wei, Q.; Jin, J.; Luo, Q.; Liu, Y.; Yang, Y.; Cheng, C.; Li, L.; Pi, J.; Si, Y.; et al. The m6A reader YTHDF1 promotes ovarian cancer progression via augmenting EIF3C translation. Nucleic Acids Res. 2020, 48, 3816–3831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, D.; Liu, J.; Chen, C.; Dong, L.; Liu, Y.; Chang, R.; Huang, X.; Liu, Y.; Wang, J.; Dougherty, U.; et al. Anti-tumour immunity controlled through mRNA m(6)A methylation and YTHDF1 in dendritic cells. Nature 2019, 566, 270–274. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.H.; Tamura, K.; Khajuria, R.K.; Bhere, D.; Nesterenko, I.; Lawler, J.; Shah, K. Antiangiogenic variant of TSP-1 targets tumor cells in glioblastomas. Mol. Ther. 2015, 23, 235–243. [Google Scholar] [CrossRef] [Green Version]
- Sharma, K.; Chanana, N.; Mohammad, G.; Thinlas, T.; Gupta, M.; Syed, M.A.; Das, R.S.; Pasha, Q.; Mishra, A. Hypertensive Patients Exhibit Enhanced Thrombospondin-1 Levels at High-Altitude. Life 2021, 11, 893. [Google Scholar] [CrossRef] [PubMed]
- Hu, H.; Wang, B.; Jiang, C.; Li, R.; Zhao, J. Endothelial progenitor cell-derived exosomes facilitate vascular endothelial cell repair through shuttling miR-21-5p to modulate Thrombospondin-1 expression. Clin. Sci. 2019, 133, 1629–1644. [Google Scholar] [CrossRef]
- Zhou, Z.; Zhao, D.; Zhang, P.; Zhang, M.; Leng, X.; Yao, B. The enzymatic hydrolysates from deer sinew promote MC3T3-E1 cell proliferation and extracellular matrix synthesis by regulating multiple functional genes. BMC Complement Med. Ther. 2021, 21, 59. [Google Scholar] [CrossRef] [PubMed]
- Liao, F.; Liao, Z.; Zhang, T.; Jiang, W.; Zhu, P.; Zhao, Z.; Shi, H.; Zhao, D.; Zhou, N.; Huang, X. ECFC-derived exosomal THBS1 mediates angiogenesis and osteogenesis in distraction osteogenesis via the PI3K/AKT/ERK pathway. J. Orthop. Translat. 2022, 37, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.; Xuan, B.; Yan, T.; Ma, Y.; Xu, P.; Tian, X.; Zhang, X.; Cao, Y.; Ma, D.; Zhu, X.; et al. m(6)A-dependent glycolysis enhances colorectal cancer progression. Mol. Cancer 2020, 19, 72. [Google Scholar] [CrossRef] [PubMed]
siRNA | Sequences (5′→3′) |
---|---|
YTHDF1 siRNA no. 1 | GCACTGACTGGTGTCCTTT |
YTHDF1 siRNA no. 2 | GGAAATGCCCAACCTACTT |
YTHDF1 siRNA no. 3 | GCACACAACCTCTATCTTT |
THBS1 siRNA | S: UCAUCUGGUAUACCAUUGCTT AS: GCAAUGGUAUACCAGAUGAUA |
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|
Hif-1α (NM_001313919.1) | GAATGAAGTGCACCCTAACAAG | GAGGAATGGGTTCACAAATCAG |
Ythdf1 (NM_173761.3) | CCCTGTCCTGGAGAAACTGAAAGC | GTACTTGATGGAGCGGTGGATGTC |
Runx2 (NM_001145920.2) | TCACCTTGACCATAACAGTCTTCAC | TCTGTCTGTGCCTTCTTGGTTC |
Alpl (NM_001287172.1) | GAACTGATGTGGAATACGAACTGG | TAGTGGGAATGCTTGTGTCTGG |
Col1a1 (NM_007742.4) | GCATGGCCAAGAAGACATCC | CCTCGGGTTTCCACGTCTC |
Thbs1 (NM_001313914.1) | GAAAGACGCCTGCCCAATTAAT | ACTTGATTTTCTGTCACATCGC |
β-actin (NM_007393.5) | GCCAACCGTGAAAAGATGAC | ACCAGAGGCATACAGGGACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, D.; Liu, X.; Li, X.; Li, T.; Liu, J.; Wu, L. Yth m6A RNA-Binding Protein 1 Regulates Osteogenesis of MC3T3-E1 Cells under Hypoxia via Translational Control of Thrombospondin-1. Int. J. Mol. Sci. 2023, 24, 1741. https://doi.org/10.3390/ijms24021741
Shi D, Liu X, Li X, Li T, Liu J, Wu L. Yth m6A RNA-Binding Protein 1 Regulates Osteogenesis of MC3T3-E1 Cells under Hypoxia via Translational Control of Thrombospondin-1. International Journal of Molecular Sciences. 2023; 24(2):1741. https://doi.org/10.3390/ijms24021741
Chicago/Turabian StyleShi, Diwen, Xiaohan Liu, Xinyun Li, Tian Li, Jie Liu, and Lin Wu. 2023. "Yth m6A RNA-Binding Protein 1 Regulates Osteogenesis of MC3T3-E1 Cells under Hypoxia via Translational Control of Thrombospondin-1" International Journal of Molecular Sciences 24, no. 2: 1741. https://doi.org/10.3390/ijms24021741