miR-486 Responds to Apoptosis and Autophagy by Repressing SRSF3 Expression in Ovarian Granulosa Cells of Dairy Goats
Abstract
:1. Introduction
2. Results
2.1. miR-486 Accelerated GC Apoptosis
2.2. miR-486 Specifically Targeted SRSF3
2.3. SRSF3 Inhibited Apoptosis of GCs
2.4. miR-486 Accelerated Apoptosis of GCs via SRSF3
2.5. miR-486 Inhibited GC Autophagy via SRSF3
3. Discussion
4. Materials and Methods
4.1. Primary GC Collection
4.2. Transfection of GCs
4.3. Luciferase Reporter Analysis
4.4. RT-PCR Analysis
4.5. Western Blot Analysis
4.6. Cell Proliferation Analysis
4.7. Cell Apoptosis Analysis
4.8. Monodansylcadaverine (MDC) Detection
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, S.; Wang, Y.; Liao, L.; Meng, L.; Li, J.; Shi, C.; Han, H.; Zheng, X.; Shen, H. Similar Repair Effects of Human Placenta, Bone Marrow Mesenchymal Stem Cells, and Their Exosomes for Damaged SVOG Ovarian Granulosa Cells. Stem Cells Int. 2020, 2020, 8861557. [Google Scholar] [CrossRef] [PubMed]
- Shen, M.; Jiang, Y.; Guan, Z.; Cao, Y.; Li, L.; Liu, H.; Sun, S.C. Protective mechanism of FSH against oxidative damage in mouse ovarian granulosa cells by repressing autophagy. Autophagy 2017, 13, 1364–1385. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Khawar, M.B.; Li, W. Essential role of autophagy in resource allocation during sexual reproduction. Autophagy 2020, 16, 18–27. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Peng, X.; Mei, S. Autophagy in Ovarian Follicular Development and Atresia. Int. J. Biol. Sci. 2019, 15, 726–737. [Google Scholar] [CrossRef] [PubMed]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Satyavarapu, E.M.; Das, R.; Mandal, C.; Mukhopadhyay, A.; Mandal, C. Autophagy-independent induction of LC3B through oxidative stress reveals its non-canonical role in anoikis of ovarian cancer cells. Cell Death Dis. 2018, 9, 934. [Google Scholar] [CrossRef]
- Cao, Q.H.; Liu, F.; Yang, Z.L.; Fu, X.H.; Yang, Z.H.; Liu, Q.; Wang, L.; Wan, X.B.; Fan, X.J. Prognostic value of autophagy related proteins ULK1, Beclin 1, ATG3, ATG5, ATG7, ATG9, ATG10, ATG12, LC3B and p62/SQSTM1 in gastric cancer. Am. J. Transl. Res. 2016, 8, 3831–3847. [Google Scholar]
- Martini-Stoica, H.; Xu, Y.; Ballabio, A.; Zheng, H. The Autophagy-Lysosomal Pathway in Neurodegeneration: A TFEB Perspective. Trends Neurosci. 2016, 39, 221–234. [Google Scholar] [CrossRef]
- Nowosad, A.; Jeannot, P.; Callot, C.; Creff, J.; Perchey, R.T.; Joffre, C.; Codogno, P.; Manenti, S.; Besson, A. p27 controls Ragulator and mTOR activity in amino acid-deprived cells to regulate the autophagy-lysosomal pathway and coordinate cell cycle and cell growth. Nat. Cell Biol. 2020, 22, 1076–1090. [Google Scholar] [CrossRef]
- Yadav, P.K.; Tiwari, M.; Gupta, A.; Sharma, A.; Prasad, S.; Pandey, A.N.; Chaube, S.K. Germ cell depletion from mammalian ovary: Possible involvement of apoptosis and autophagy. J. Biomed. Sci. 2018, 25, 36. [Google Scholar] [CrossRef]
- Meng, L.; Jan, S.Z.; Hamer, G.; van Pelt, A.M.; van der Stelt, I.; Keijer, J.; Teerds, K.J. Preantral follicular atresia occurs mainly through autophagy, while antral follicles degenerate mostly through apoptosis. Biol. Reprod. 2018, 99, 853–863. [Google Scholar] [CrossRef] [PubMed]
- Maalouf, S.W.; Liu, W.S.; Pate, J.L. MicroRNA in ovarian function. Cell Tissue Res. 2016, 363, 7–18. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.H.L.; Yue, C.; Du, K.Y.; Salem, M.; O’Brien, J.; Peng, C. The Role of microRNAs in Epithelial Ovarian Cancer Metastasis. Int. J. Mol. Sci. 2020, 21, 7093. [Google Scholar] [CrossRef] [PubMed]
- Stavast, C.J.; Erkeland, S.J. The Non-Canonical Aspects of MicroRNAs: Many Roads to Gene Regulation. Cells 2019, 8, 1465. [Google Scholar] [CrossRef]
- Zhang, J.; Xu, Y.; Liu, H.; Pan, Z. MicroRNAs in ovarian follicular atresia and granulosa cell apoptosis. Reprod. Biol. Endocrinol. 2019, 17, 9. [Google Scholar] [CrossRef]
- Ilisso, C.P.; Delle Cave, D.; Mosca, L.; Pagano, M.; Coppola, A.; Mele, L.; Caraglia, M.; Cacciapuoti, G.; Porcelli, M. S-Adenosylmethionine regulates apoptosis and autophagy in MCF-7 breast cancer cells through the modulation of specific microRNAs. Cancer Cell Int. 2018, 18, 197. [Google Scholar] [CrossRef]
- Jin, J.; Shi, Y.; Gong, J.; Zhao, L.; Li, Y.; He, Q.; Huang, H. Exosome secreted from adipose-derived stem cells attenuates diabetic nephropathy by promoting autophagy flux and inhibiting apoptosis in podocyte. Stem Cell Res. Ther. 2019, 10, 95. [Google Scholar] [CrossRef]
- Li, J.; Zhou, Q.; Liang, Y.; Pan, W.; Bei, Y.; Zhang, Y.; Wang, J.; Jiao, Z. miR-486 inhibits PM2.5-induced apoptosis and oxidative stress in human lung alveolar epithelial A549 cells. Ann. Transl. Med. 2018, 6, 209. [Google Scholar] [CrossRef]
- Liu, H.; Ni, Z.; Shi, L.; Ma, L.; Zhao, J. MiR-486-5p inhibits the proliferation of leukemia cells and induces apoptosis through targeting FOXO1. Mol. Cell. Probes 2019, 44, 37–43. [Google Scholar] [CrossRef]
- Chang, Q.; Ji, M.; Li, C.; Geng, R. Downregulation of miR-486-5p alleviates LPS-induced inflammatory injury, oxidative stress and apoptosis in Chondrogenic cell ATDC5 by targeting NRF1. Mol. Med. Rep. 2020, 22, 2123–2131. [Google Scholar] [CrossRef]
- Sun, Y.; Su, Q.; Li, L.; Wang, X.; Lu, Y.; Liang, J. MiR-486 regulates cardiomyocyte apoptosis by p53-mediated BCL-2 associated mitochondrial apoptotic pathway. BMC Cardiovasc. Disord. 2017, 17, 119. [Google Scholar] [CrossRef] [PubMed]
- An, X.; Song, Y.; Hou, J.; Li, G.; Zhao, H.; Wang, J.; Cao, B. Identification and profiling of microRNAs in the ovaries of polytocous and monotocous goats during estrus. Theriogenology 2016, 85, 769–780. [Google Scholar] [CrossRef] [PubMed]
- Woo, I.; Christenson, L.K.; Gunewardena, S.; Ingles, S.A.; Thomas, S.; Ahmady, A.; Chung, K.; Bendikson, K.; Paulson, R.; McGinnis, L.K. Micro-RNAs involved in cellular proliferation have altered expression profiles in granulosa of young women with diminished ovarian reserve. J. Assist. Reprod. Genet. 2018, 35, 1777–1786. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Gong, Q.; Lin, Z.; Wang, Y.; Li, M.; Wang, L.; Ding, H.; Li, P. Emerging Roles of SRSF3 as a Therapeutic Target for Cancer. Front. Oncol. 2020, 10, 577636. [Google Scholar] [CrossRef] [PubMed]
- Long, Y.; Sou, W.H.; Yung, K.W.Y.; Liu, H.; Wan, S.W.C.; Li, Q.; Zeng, C.; Law, C.O.K.; Chan, G.H.C.; Lau, T.C.K.; et al. Distinct mechanisms govern the phosphorylation of different SR protein splicing factors. J. Biol. Chem. 2019, 294, 1312–1327. [Google Scholar] [CrossRef]
- Do, D.V.; Strauss, B.; Cukuroglu, E.; Macaulay, I.; Wee, K.B.; Hu, T.X.; Igor, R.L.M.; Lee, C.; Harrison, A.; Butler, R.; et al. SRSF3 maintains transcriptome integrity in oocytes by regulation of alternative splicing and transposable elements. Cell Discov. 2018, 4, 33. [Google Scholar] [CrossRef] [PubMed]
- Park, S.K.; Jeong, S. SRSF3 represses the expression of PDCD4 protein by coordinated regulation of alternative splicing, export and translation. Biochem. Biophys. Res. Commun. 2016, 470, 431–438. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Guo, J.; Jia, R. Oncogene SRSF3 suppresses autophagy via inhibiting BECN1 expression. Biochem. Biophys. Res. Commun. 2019, 509, 966–972. [Google Scholar] [CrossRef]
- Fuentes-Fayos, A.C.; Vázquez-Borrego, M.C.; Jiménez-Vacas, J.M.; Bejarano, L.; Pedraza-Arévalo, S.; Lopez, F.; Blanco-Acevedo, C.; Sánchez-Sánchez, R.; Reyes, O.; Ventura, S.; et al. Splicing machinery dysregulation drives glioblastoma development/aggressiveness: Oncogenic role of SRSF3. Brain J. Neurol. 2020, 143, 3273–3293. [Google Scholar] [CrossRef]
- He, X.; Arslan, A.D.; Pool, M.D.; Ho, T.T.; Darcy, K.M.; Coon, J.S.; Beck, W.T. Knockdown of splicing factor SRp20 causes apoptosis in ovarian cancer cells and its expression is associated with malignancy of epithelial ovarian cancer. Oncogene 2011, 30, 356–365. [Google Scholar] [CrossRef]
- Kurokawa, K.; Akaike, Y.; Masuda, K.; Kuwano, Y.; Nishida, K.; Yamagishi, N.; Kajita, K.; Tanahashi, T.; Rokutan, K. Downregulation of serine/arginine-rich splicing factor 3 induces G1 cell cycle arrest and apoptosis in colon cancer cells. Oncogene 2014, 33, 1407–1417. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Itoyama, T.; Chaganti, R.S. Splicing factor SRP20 is a novel partner of BCL6 in a t(3;6)(q27;p21) translocation in transformed follicular lymphoma. Genes Chromosom. Cancer 2001, 32, 281–284. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Horikawa, I.; Ajiro, M.; Robles, A.I.; Fujita, K.; Mondal, A.M.; Stauffer, J.K.; Zheng, Z.M.; Harris, C.C. Downregulation of splicing factor SRSF3 induces p53β, an alternatively spliced isoform of p53 that promotes cellular senescence. Oncogene 2013, 32, 2792–2798. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Ye, H.; Hao, L.; Sun, Y.; Li, R.; Li, Y.; Yang, Z. SRSFs mediate the function of AR in the ovarian granulosa cells of patients with PCOS. Genes Dis. 2021, 8, 94–109. [Google Scholar] [CrossRef] [PubMed]
- Tu, J.; Cheung, A.H.; Chan, C.L.; Chan, W.Y. The Role of microRNAs in Ovarian Granulosa Cells in Health and Disease. Front. Endocrinol. 2019, 10, 174. [Google Scholar] [CrossRef] [PubMed]
- Uyar, A.; Torrealday, S.; Seli, E. Cumulus and granulosa cell markers of oocyte and embryo quality. Fertil. Steril. 2013, 99, 979–997. [Google Scholar] [CrossRef]
- Thomas, F.H.; Vanderhyden, B.C. Oocyte-granulosa cell interactions during mouse follicular development: Regulation of kit ligand expression and its role in oocyte growth. Reprod. Biol. Endocrinol. 2006, 4, 19. [Google Scholar] [CrossRef]
- Regan, S.L.P.; Knight, P.G.; Yovich, J.L.; Leung, Y.; Arfuso, F.; Dharmarajan, A. Granulosa Cell Apoptosis in the Ovarian Follicle-A Changing View. Front. Endocrinol. 2018, 9, 61. [Google Scholar] [CrossRef]
- Zi, X.D.; Hu, L.; Lu, J.Y.; Liu, S.; Zheng, Y.C. Comparison of the sequences and expression levels of genes related to follicular development and atresia between prolific and nonprolific goat breeds. Vet. Med. Sci. 2020, 6, 187–195. [Google Scholar] [CrossRef]
- Ortega-Camarillo, C.; González-González, A.; Vergara-Onofre, M.; González-Padilla, E.; Avalos-Rodríguez, A.; Gutiérrez-Rodríguez, M.E.; Arriaga-Pizano, L.; Cruz, M.; Baiza-Gutman, L.A.; Díaz-Flores, M. Changes in the glucose-6-phosphate dehydrogenase activity in granulosa cells during follicular atresia in ewes. Reproduction 2009, 137, 979–986. [Google Scholar] [CrossRef]
- Li, Y.; Fang, Y.; Liu, Y.; Yang, X. MicroRNAs in ovarian function and disorders. J. Ovarian Res. 2015, 8, 51. [Google Scholar] [CrossRef] [PubMed]
- Cao, R.; Wu, W.; Zhou, X.; Liu, K.; Li, B.; Huang, X.; Zhang, Y.; Liu, H. Let-7g induces granulosa cell apoptosis by targeting MAP3K1 in the porcine ovary. Int. J. Biochem. Cell Biol. 2015, 68, 148–157. [Google Scholar] [CrossRef] [PubMed]
- Peng, J.Y.; An, X.P.; Fang, F.; Gao, K.X.; Xin, H.Y.; Han, P.; Bao, L.J.; Ma, H.D.; Cao, B.Y. MicroRNA-10b suppresses goat granulosa cell proliferation by targeting brain-derived neurotropic factor. Domest. Anim. Endocrinol. 2016, 54, 60–67. [Google Scholar] [CrossRef] [PubMed]
- Sirotkin, A.V.; Kisová, G.; Brenaut, P.; Ovcharenko, D.; Grossmann, R.; Mlyncek, M. Involvement of microRNA Mir15a in control of human ovarian granulosa cell proliferation, apoptosis, steroidogenesis, and response to FSH. MicroRNA 2014, 3, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Nie, M.; Yu, S.; Peng, S.; Fang, Y.; Wang, H.; Yang, X. miR-23a and miR-27a promote human granulosa cell apoptosis by targeting SMAD5. Biol. Reprod. 2015, 93, 98. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Tu, F.; Yao, W.; Li, X.; Xie, Z.; Liu, H.; Li, Q.; Pan, Z. Conserved miR-26b enhances ovarian granulosa cell apoptosis through HAS2-HA-CD44-Caspase-3 pathway by targeting HAS2. Sci. Rep. 2016, 6, 21197. [Google Scholar] [CrossRef]
- Oh, H.K.; Tan, A.L.; Das, K.; Ooi, C.H.; Deng, N.T.; Tan, I.B.; Beillard, E.; Lee, J.; Ramnarayanan, K.; Rha, S.Y.; et al. Genomic loss of miR-486 regulates tumor progression and the OLFM4 antiapoptotic factor in gastric cancer. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2011, 17, 2657–2667. [Google Scholar] [CrossRef]
- Shi, Y.; Wang, L.; Yu, P.; Liu, Y.; Chen, W. MicroRNA-486-5p inhibits the growth of human hypertrophic scar fibroblasts by regulating Smad2 expression. Mol. Med. Rep. 2019, 19, 5203–5210. [Google Scholar] [CrossRef]
- Li, C.; Wang, Y.; Wang, H.; Wang, B.; Wang, Y.; Li, N.; Qin, Y.; Wang, Y. miR-486 Promotes the Invasion and Cell Cycle Progression of Ovarian Cancer Cells by Targeting CADM1. Anal. Cell. Pathol. 2021, 2021, 7407086. [Google Scholar] [CrossRef]
- Zhang, M.; Zhao, X.; Cai, X.; Wang, P.; Yu, M.; Wei, Z. Knockdown of long non-coding RNA plasmacytoma variant translocation 1 inhibits cell proliferation while promotes cell apoptosis via regulating miR-486-mediated CDK4 and BCAS2 in multiple myeloma. Ir. J. Med. Sci. 2020, 189, 825–834. [Google Scholar] [CrossRef]
- Ju, J.K.; Han, W.N.; Shi, C.L. Long non-coding RNA (lncRNA) plasmacytoma variant translocation 1 gene (PVT1) modulates the proliferation and apoptosis of acute lymphoblastic leukemia cells by sponging miR-486-5p. Bioengineered 2022, 13, 4587–4597. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Liu, J.; Wang, Y.; Zhu, X.; Fan, Z.; Li, C.; Yin, H.; Liu, Y. Role of miR-486-5p in regulating renal cell carcinoma cell proliferation and apoptosis via TGF-β-activated kinase 1. J. Cell. Biochem. 2019, 120, 2954–2963. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.; Wei, F.; Hu, X. Long noncoding RNA DLGAP1-AS1 promotes cell proliferation in hepatocellular carcinoma via sequestering miR-486-5p. J. Cell. Biochem. 2020, 121, 1953–1962. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Jiang, J.; Liu, W.; Wang, H.; Zhao, L.; Liu, S.; Li, P.; Zhang, S.; Sun, C.; Wu, Y.; et al. microRNA-378 promotes autophagy and inhibits apoptosis in skeletal muscle. Proc. Natl. Acad. Sci. USA 2018, 115, E10849–E10858. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, Y.; Zhang, J.; Du, X.; Li, Q.; Pan, Z. circSLC41A1 Resists Porcine Granulosa Cell Apoptosis and Follicular Atresia by Promoting SRSF1 through miR-9820-5p Sponging. Int. J. Mol. Sci. 2022, 23, 1509. [Google Scholar] [CrossRef]
- Zhang, X.; Yang, S.; Kang, Z.; Ru, W.; Shen, X.; Li, M.; Lan, X.; Chen, H. circMEF2D Negatively Regulated by HNRNPA1 Inhibits Proliferation and Differentiation of Myoblasts via miR-486-PI3K/AKT Axis. J. Agric. Food Chem. 2022, 70, 8145–8163. [Google Scholar] [CrossRef]
- Si, Z.; Yu, L.; Jing, H.; Wu, L.; Wang, X. Oncogenic lncRNA ZNF561-AS1 is essential for colorectal cancer proliferation and survival through regulation of miR-26a-3p/miR-128-5p-SRSF6 axis. J. Exp. Clin. Cancer Res. 2021, 40, 78. [Google Scholar] [CrossRef]
- Livesey, K.M.; Kang, R.; Vernon, P.; Buchser, W.; Loughran, P.; Watkins, S.C.; Zhang, L.; Manfredi, J.J.; Zeh, H.J., 3rd; Li, L.; et al. p53/HMGB1 complexes regulate autophagy and apoptosis. Cancer Res. 2012, 72, 1996–2005. [Google Scholar] [CrossRef]
- Mariño, G.; Niso-Santano, M.; Baehrecke, E.H.; Kroemer, G. Self-consumption: The interplay of autophagy and apoptosis. Nat. Rev. Mol. Cell Biol. 2014, 15, 81–94. [Google Scholar] [CrossRef]
- An, X.; Cao, H.; Liu, S.; Cao, B. Effects of TG interaction factor 1 on synthesis of estradiol and progesterone in granulosa cells of goats through SMAD2/3-SP1 signaling pathway. Anim. Reprod. Sci. 2021, 229, 106750. [Google Scholar] [CrossRef]
Gene Name | Primer | Primer Sequences (5′-3′) | Product Size (bp) |
---|---|---|---|
miR-486 | RT primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCGGGG | |
FORWARD | GCGCGTCCTGTACTGAGCTG | ||
REVERSE | AGTGCAGGGTCCGAGGTATT | ||
Negative control (NC) | FORWARD | UUCUCCGAACGUGUCACGUTT | |
REVERSE | ACGUGACACGUUCGGAGAATT | ||
U6 | FORWARD | GTGCTCGCTTCGGCA GCACAT | |
REVERSE | ATCCAGTGCAGGGTCCGAGG | ||
BCL2 | FORWARD | AGAGCGTCAACCGGGAGATG | 167 |
REVERSE | CAGCCAGGAGAAATCAAACAGG | ||
BAX | FORWARD | CATCAACTGCCTTGGACTTT | 130 |
REVERSE | GACCACTCCTCCCTACCCT | ||
Caspase-3 | FORWARD | ATACCAGTTGAGGCAGAC | 161 |
REVERSE | TTAACCCGAGTAAGAATGT | ||
P53 | FORWARD | CCCCTTCCCTCAACAAGC | 144 |
REVERSE | GCCTCACAACCTCCGTCA | ||
β-Actin | FORWARD | CACGGTGCCCATCTACGA | 158 |
REVERSE | CCTTGATGTCACGGACGATTT |
Antibody | Manufacturer | Product ID |
---|---|---|
Anti-p53 | BBI Life Science | D120082 |
Anti-CASP3 | BBI Life Science | D160009 |
Anti-β-Actin | BBI Life Science | D190606 |
SRSF3 | ABCAM | AB198291 |
BCL2 | ABclonal | A16776 |
BAX | ABclonal | A15633 |
LC3II | Abways | CY5528 |
SQSTM1 | Abways | CY5546 |
ATG5 | Abways | CY5766 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, S.; Bu, Q.; Tong, J.; Wang, Z.; Cui, J.; Cao, H.; Ma, H.; Cao, B.; An, X.; Song, Y. miR-486 Responds to Apoptosis and Autophagy by Repressing SRSF3 Expression in Ovarian Granulosa Cells of Dairy Goats. Int. J. Mol. Sci. 2023, 24, 8751. https://doi.org/10.3390/ijms24108751
Liu S, Bu Q, Tong J, Wang Z, Cui J, Cao H, Ma H, Cao B, An X, Song Y. miR-486 Responds to Apoptosis and Autophagy by Repressing SRSF3 Expression in Ovarian Granulosa Cells of Dairy Goats. International Journal of Molecular Sciences. 2023; 24(10):8751. https://doi.org/10.3390/ijms24108751
Chicago/Turabian StyleLiu, Shujuan, Qiqi Bu, Jiashun Tong, Zhanhang Wang, Jiuzeng Cui, Heran Cao, Haidong Ma, Binyun Cao, Xiaopeng An, and Yuxuan Song. 2023. "miR-486 Responds to Apoptosis and Autophagy by Repressing SRSF3 Expression in Ovarian Granulosa Cells of Dairy Goats" International Journal of Molecular Sciences 24, no. 10: 8751. https://doi.org/10.3390/ijms24108751