Radiosensitization to γ-Ray by Functional Inhibition of APOBEC3G
Abstract
:1. Introduction
2. Results
2.1. Comprehensive Analysis to Identify Radiosensitization Targets
2.2. Radiosensitization Profiles in Cancer Cell Lines by A3G Knockdown
2.3. Enhanced S-Phase Arrest and Defect in DNA Damage Response by A3G Knockdown in MIAPaCa2 Cells
2.4. Effect of A3G Dysfunction in Lung Cancer A549 Cells
2.5. A3G Dysfunction Induces Radiosensitization in the Mouse Xenograft Model
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. γ-Irradiation and X-ray Irradiation
4.3. Negative Screening Using an shRNA Library
4.4. siRNA Transfection
4.5. Gene Expression Analysis (Quantitative RT-PCR)
4.6. Clonogenic Survival Assay
4.7. Cell Cycle Analysis
4.8. Western Blot Analysis
4.9. Animal Experiments
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
siRNA1 for A3G | GGAAUAAUCUGCCUAAAUAUUAUAT | AUAUAAUAUUUAGGCAGAUUAUUCCAA |
siRNA3 for A3G | AGAUCAUGAAUUAUGACGAAUUUCA | CUUCUAGUACUUAAUACUGCUUAAAGU |
Gene | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Primers set 1 for A3G | CCGTCTGGCTGTGCTACGAA | ACGATGCAGCTTCCTCCACT |
Primers set 2 for A3G | CCCTGACCATCTTTGTTGCC | CGAACTTGCTCCAACAGTGCT |
Antibody | Company | Catalog# | Species | Dilution | Purpose |
---|---|---|---|---|---|
PARP | CST | 9542 | H,M,R,Mk | 1/1000 | WB |
p-P53 (ser15) | CST | 9284 | H,M,R,Mk | 1/500 | WB |
P53 | CST | 9282 | H,Mk | 1/1000 | WB |
p-Chk2 (thr68) | CST | 2197 | H | 1/1000 | WB |
γ-H2AX (ser139) | CST | 9718 | H,M,R,Mk | 1/1000 | WB |
p-HistoneH3 (ser10) | GeneTex | 128116 | H | 1/1000 | WB |
p-mTOR (ser2448) | CST | 2971 | H,M,R,Mk | 1/1000 | WB |
p-Akt (ser473) | CST | 9271 | H,M,R,Mk,Dm | 1/1000 | WB |
Akt | CST | 4691 | H,M,R,Mk,Dm | 1/1000 | WB |
p-4E-BP1 (thr37/46) | CST | 2855 | H,M,R,Mk,Dm | 1/1000 | WB |
p-4E-BP1 (ser65) | CST | 9451 | H,M,R,Mk | 1/1000 | WB |
4E-BP1 | CST | 9644 | H,M,R,Mk | 1/1000 | WB |
β-Actin | Sigma-Aldrich | A2228 | H | 1/10,000 | WB |
References
- Freytag, S.O.; Rogulski, K.R.; Paielli, D.L.; Gilbert, J.D.; Kim, J.H. A novel three-pronged approach to kill cancer cells selectively: Concomitant viral, double suicide gene, and radiotherapy. Hum. Gene 1998, 9, 1323–1333. [Google Scholar] [CrossRef] [PubMed]
- Otto, K. Volumetric modulated arc therapy: Imrt in a single gantry arc. Med. Phys. 2008, 35, 310–317. [Google Scholar] [CrossRef] [PubMed]
- van de Water, T.A.; Bijl, H.P.; Schilstra, C.; Pijls-Johannesma, M.; Langendijk, J.A. The potential benefit of radiotherapy with protons in head and neck cancer with respect to normal tissue sparing: A systematic review of literature. Oncologist 2011, 16, 366–377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loeffler, J.S.; Durante, M. Charged particle therapy—Optimization, challenges and future directions. Nat. Rev. Clin. Oncol. 2013, 10, 411–424. [Google Scholar] [CrossRef]
- Maier, P.; Hartmann, L.; Wenz, F.; Herskind, C. Cellular pathways in response to ionizing radiation and their targetability for tumor radiosensitization. Int. J. Mol. Sci. 2016, 17, 102. [Google Scholar] [CrossRef] [Green Version]
- Glass, J.; Silverman, C.L.; Axelrod, R.; Corn, B.W.; Andrews, D.W. Fractionated stereotactic radiotherapy with cis-platinum radiosensitization in the treatment of recurrent, progressive, or persistent malignant astrocytoma. Am. J. Clin. Oncol. 1997, 20, 226–229. [Google Scholar] [CrossRef]
- Takahashi, M.; Valdes, G.; Hiraoka, K.; Inagaki, A.; Kamijima, S.; Micewicz, E.; Gruber, H.E.; Robbins, J.M.; Jolly, D.J.; McBride, W.H.; et al. Radiosensitization of gliomas by intracellular generation of 5-fluorouracil potentiates prodrug activator gene therapy with a retroviral replicating vector. Cancer Gene 2014, 21, 405–410. [Google Scholar] [CrossRef] [Green Version]
- Schlicker, A.; Peschke, P.; Burkle, A.; Hahn, E.W.; Kim, J.H. 4-amino-1,8-naphthalimide: A novel inhibitor of poly(adp-ribose) polymerase and radiation sensitizer. Int. J. Radiat. Biol. 1999, 75, 91–100. [Google Scholar] [CrossRef]
- Hirai, T.; Shirai, H.; Fujimori, H.; Okayasu, R.; Sasai, K.; Masutani, M. Radiosensitization effect of poly(adp-ribose) polymerase inhibition in cells exposed to low and high liner energy transfer radiation. Cancer Sci. 2012, 103, 1045–1050. [Google Scholar] [CrossRef]
- Shirai, H.; Fujimori, H.; Gunji, A.; Maeda, D.; Hirai, T.; Poetsch, A.R.; Harada, H.; Yoshida, T.; Sasai, K.; Okayasu, R.; et al. Parg deficiency confers radio-sensitization through enhanced cell death in mouse es cells exposed to various forms of ionizing radiation. Biochem. Biophys. Res. Commun. 2013, 435, 100–106. [Google Scholar] [CrossRef]
- Sorensen, C.S.; Hansen, L.T.; Dziegielewski, J.; Syljuasen, R.G.; Lundin, C.; Bartek, J.; Helleday, T. The cell-cycle checkpoint kinase chk1 is required for mammalian homologous recombination repair. Nat. Cell Biol. 2005, 7, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Noguchi, M.; Yu, D.; Hirayama, R.; Ninomiya, Y.; Sekine, E.; Kubota, N.; Ando, K.; Okayasu, R. Inhibition of homologous recombination repair in irradiated tumor cells pretreated with hsp90 inhibitor 17-allylamino-17-demethoxygeldanamycin. Biochem. Biophys. Res. Commun. 2006, 351, 658–663. [Google Scholar] [CrossRef] [PubMed]
- Andrs, M.; Korabecny, J.; Nepovimova, E.; Jun, D.; Hodny, Z.; Moravcova, S.; Hanzlikova, H.; Kuca, K. The development of ataxia telangiectasia mutated kinase inhibitors. Mini Rev. Med. Chem. 2014, 14, 805–811. [Google Scholar] [CrossRef] [PubMed]
- Hrabeta, J.; Stiborova, M.; Adam, V.; Kizek, R.; Eckschlager, T. Histone deacetylase inhibitors in cancer therapy: A review. Biomed. Pap. 2014, 158, 161–169. [Google Scholar] [CrossRef] [PubMed]
- Junttila, M.R.; de Sauvage, F.J. Influence of tumour micro-environment heterogeneity on therapeutic response. Nature 2013, 501, 346–354. [Google Scholar] [CrossRef] [PubMed]
- Fujimori, H.; Sato, A.; Kikuhara, S.; Wang, J.; Hirai, T.; Sasaki, Y.; Murakami, Y.; Okayasu, R.; Masutani, M. A comprehensive analysis of radiosensitization targets; functional inhibition of DNA methyltransferase 3b radiosensitizes by disrupting DNA damage regulation. Sci. Rep. 2015, 5, 18231. [Google Scholar] [CrossRef] [Green Version]
- Lakomy, D.S.; Urbauer, D.L.; Westin, S.N.; Lin, L.L. Phase i study of the parp inhibitor talazoparib with radiation therapy for locally recurrent gynecologic cancers. Clin. Transl. Radiat. Oncol. 2020, 21, 56–61. [Google Scholar] [CrossRef] [Green Version]
- Shi, W.; Lawrence, Y.R.; Choy, H.; Werner-Wasik, M.; Andrews, D.W.; Evans, J.J.; Judy, K.D.; Farrell, C.J.; Moshel, Y.; Berger, A.C.; et al. Vorinostat as a radiosensitizer for brain metastasis: A phase i clinical trial. J. Neurooncol. 2014, 118, 313–319. [Google Scholar] [CrossRef]
- Marusyk, A.; Polyak, K. Tumor heterogeneity: Causes and consequences. Biochim. Biophys. Acta 2010, 1805, 105–117. [Google Scholar] [CrossRef] [Green Version]
- Mangeat, B.; Turelli, P.; Caron, G.; Friedli, M.; Perrin, L.; Trono, D. Broad antiretroviral defence by human apobec3g through lethal editing of nascent reverse transcripts. Nature 2003, 424, 99–103. [Google Scholar] [CrossRef]
- Ding, Q.; Chang, C.J.; Xie, X.; Xia, W.; Yang, J.Y.; Wang, S.C.; Wang, Y.; Xia, J.; Chen, L.; Cai, C.; et al. Apobec3g promotes liver metastasis in an orthotopic mouse model of colorectal cancer and predicts human hepatic metastasis. J. Clin. Investig. 2011, 121, 4526–4536. [Google Scholar] [CrossRef] [PubMed]
- Lan, H.; Jin, K.; Gan, M.; Wen, S.; Bi, T.; Zhou, S.; Zhu, N.; Teng, L.; Yu, W. Apobec3g expression is correlated with poor prognosis in colon carcinoma patients with hepatic metastasis. Int. J. Clin. Exp. Med. 2014, 7, 665–672. [Google Scholar] [PubMed]
- Nowarski, R.; Wilner, O.I.; Cheshin, O.; Shahar, O.D.; Kenig, E.; Baraz, L.; Britan-Rosich, E.; Nagler, A.; Harris, R.S.; Goldberg, M.; et al. Apobec3g enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair. Blood 2012, 120, 366–375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Wu, S.; Zheng, S.; Wang, S.; Wali, A.; Ezhilarasan, R.; Sulman, E.P.; Koul, D.; Alfred Yung, W.K. Apobec3g acts as a therapeutic target in mesenchymal gliomas by sensitizing cells to radiation-induced cell death. Oncotarget 2017, 8, 54285–54296. [Google Scholar] [CrossRef] [Green Version]
Cell Line | ER10 | Disease | Species |
---|---|---|---|
A549 | 1.35 | Lung adenocarcinama | Human |
DU145 | 1.28 | Prostate carcinoma | Human |
MIAPaCa2 | 1.25 | Pancreatic ductal adenocarcinoma | Human |
SW480 | 1.23 | Colon adenocarcinoma | Human |
MDA-MB-231 | 1.2 | Breast adenocarcinoma | Human |
SAS | 1.17 | Tongue squamous cell carcinoma | Human |
SBC5 | 1.16 | Lung small cell carcinoma | Human |
A375 | 1.14 | Amelanotic melanoma | Human |
PC14 | 1.12 | Lung adenocarcinoma | Human |
HeLa | 1.1 | Human papillomavirus-related endocervical adenocarcinoma | Human |
U2OS | 1.01 | Osteosarcoma | Human |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, Y.; Kikuhara, S.; Onodera, T.; Chen, L.; Myat, A.B.; Imamichi, S.; Sasaki, Y.; Murakami, Y.; Nozaki, T.; Fujimori, H.; et al. Radiosensitization to γ-Ray by Functional Inhibition of APOBEC3G. Int. J. Mol. Sci. 2022, 23, 5069. https://doi.org/10.3390/ijms23095069
Tong Y, Kikuhara S, Onodera T, Chen L, Myat AB, Imamichi S, Sasaki Y, Murakami Y, Nozaki T, Fujimori H, et al. Radiosensitization to γ-Ray by Functional Inhibition of APOBEC3G. International Journal of Molecular Sciences. 2022; 23(9):5069. https://doi.org/10.3390/ijms23095069
Chicago/Turabian StyleTong, Ying, Sota Kikuhara, Takae Onodera, Lichao Chen, Aung Bhone Myat, Shoji Imamichi, Yuka Sasaki, Yasufumi Murakami, Tadashige Nozaki, Hiroaki Fujimori, and et al. 2022. "Radiosensitization to γ-Ray by Functional Inhibition of APOBEC3G" International Journal of Molecular Sciences 23, no. 9: 5069. https://doi.org/10.3390/ijms23095069