Transcriptomic Profiling of Rectus Abdominis Muscle in Women with Gestational Diabetes-Induced Myopathy: Characterization of Pathophysiology and Potential Muscle Biomarkers of Pregnancy-Specific Urinary Incontinence
Abstract
:1. Introduction
2. Results
2.1. Subject Clinical Characteristics
2.2. Gene Expression Profile of Groups
2.3. Transcriptome Profiling of Non-Diabetic Continent Women (ND-C) in Comparison with Gestational Diabetic and Incontinent Women (GDM-I)
2.4. Transcriptome Profiling of Non-Diabetic Incontinent Women (ND-I) in Comparison with Gestational Diabetic and Incontinent Women (GDM-I)
2.5. Transcriptome Profiling of Gestational Diabetic Continent Women (GDM-C) in Comparison with Gestational Diabetic Incontinent Women (GDM-I)
2.6. Screening for Muscle Biomarker Gene Candidates of Gestational Diabetic-Induced Myopathy (GDiM)
2.7. Validation of Common Potential Muscle Biomarker Genes by qRT-PCR
3. Discussion
4. Material and Methods
4.1. Study Population and Research Design
- Non-GDM continent women (no PSUI) (ND-C);
- Non-GDM and incontinent women (with PSUI) (ND-UI);
- GDM and continent women (no PSUI) (GDM-C);
- GDM and incontinent women (with PSUI) (GDM-I).
4.2. Sample Preparation
4.3. RNA Isolation
4.4. RNA-Seq
4.5. Bioinformatic and Data Analysis
4.6. Pathway Enrichment Analysis
4.7. Protein-Protein Interactions (PPI) Networks
4.8. Screening for Diabetic-Induced myopathy Biomarker Candidates
4.9. qRT-PCR Experiment for Technically Validating Detected DEGs from RNA-Seq Analysis and Validating Muscle Biomarkers Genes Candidates
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Forbes, J.M.; Cooper, M.E. Mechanisms of Diabetic Complications. Physiol. Rev. 2013, 93, 137–188. [Google Scholar] [CrossRef] [PubMed]
- Park, S.W.; Goodpaster, B.H.; Strotmeyer, E.S.; de Rekeneire, N.; Harris, T.B.; Schwartz, A.V.; Tylavsky, F.A.; Newman, A.B. Decreased Muscle Strength and Quality in Older Adults With Type 2 Diabetes. Diabetes 2006, 55, 1813–1818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rudge, M.V.C.; Souza, F.P.; Abbade, J.F.; Hallur, R.L.S.; Marcondes, J.P.C.; Piculo, F.; Marini, G.; Vesentini, G.; Thabane, L.; Witkin, S.S. Study Protocol to Investigate Biomolecular Muscle Profile as Predictors of Long-Term Urinary Incontinence in Women with Gestational Diabetes Mellitus. BMC Pregnancy Childbirth 2020, 20, 117. [Google Scholar] [CrossRef]
- Diaz-Santana, M.V.; O’Brien, K.M.; Park, Y.-M.M.; Sandler, D.P.; Weinberg, C.R. Persistence of Risk for Type 2 Diabetes After Gestational Diabetes Mellitus. Diabetes Care 2022, 45, 864–870. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Mayo, R.; Chatry, A.; Hu, G. Gestational Diabetes Mellitus: Its Epidemiology and Implication beyond Pregnancy. Curr. Epidemiol. Rep. 2016, 3, 1–11. [Google Scholar] [CrossRef]
- DeSisto, C.L.; Kim, S.Y.; Sharma, A.J. Prevalence Estimates of Gestational Diabetes Mellitus in the United States, Pregnancy Risk Assessment Monitoring System (PRAMS), 2007œ2010. Prev. Chronic Dis. 2014, 11, E104. [Google Scholar] [CrossRef] [Green Version]
- Howe, C.G.; Cox, B.; Fore, R.; Jungius, J.; Kvist, T.; Lent, S.; Miles, H.E.; Salas, L.A.; Rifas-Shiman, S.; Starling, A.P.; et al. Maternal Gestational Diabetes Mellitus and Newborn DNA Methylation: Findings From the Pregnancy and Childhood Epigenetics Consortium. Diabetes Care 2020, 43, 98–105. [Google Scholar] [CrossRef] [Green Version]
- Sacks, D.A.; Hadden, D.R.; Maresh, M.; Deerochanawong, C.; Dyer, A.R.; Metzger, B.E.; Lowe, L.P.; Coustan, D.R.; Hod, M.; Oats, J.J.N.; et al. Frequency of Gestational Diabetes Mellitus at Collaborating Centers Based on IADPSG Consensus Panel–Recommended Criteria. Diabetes Care 2012, 35, 526–528. [Google Scholar] [CrossRef] [Green Version]
- American Diabetes Association. Introduction: Standards of Medical Care in Diabetes—2022. Diabetes Care 2022, 45, S1–S2. [Google Scholar] [CrossRef]
- Poon, L.C.; McIntyre, H.D.; Hyett, J.A.; da Fonseca, E.B.; Hod, M. The First-Trimester of Pregnancy–A Window of Opportunity for Prediction and Prevention of Pregnancy Complications and Future Life. Diabetes Res. Clin. Pract. 2018, 145, 20–30. [Google Scholar] [CrossRef]
- Barbosa, A.M.P.; Dias, A.; Marini, G.; Calderon, I.M.P.; Witkin, S.; Rudge, M.V.C. Urinary Incontinence and Vaginal Squeeze Pressure Two Years Post-Cesarean Delivery in Primiparous Women with Previous Gestational Diabetes Mellitus. Clinics 2011, 66, 1341–1345. [Google Scholar] [CrossRef] [PubMed]
- Catinelli, B.B.; Rossignoli, P.S.; Floriano, J.F.; Carr, A.M.; de Oliveira, R.G.; dos Santos, N.J.; Úbeda, L.C.C.; Spadella, M.A.; Hallur, R.L.S.; Sobrevia, L.; et al. Reversal of Diabetic-Induced Myopathy by Swimming Exercise in Pregnant Rats: A Translational Intervention Study. Sci. Rep. 2022, 12, 7375. [Google Scholar] [CrossRef] [PubMed]
- Vesentini, G.; Marini, G.; Piculo, F.; Damasceno, D.C.; Matheus, S.M.M.; Felisbino, S.L.; Calderon, I.M.P.; Hijaz, A.; Barbosa, A.M.P.; Rudge, M.V.C. Morphological Changes in Rat Rectus Abdominis Muscle Induced by Diabetes and Pregnancy. Braz. J. Med. Biol. Res. 2018, 51, e7035. [Google Scholar] [CrossRef] [Green Version]
- Vesentini, G.; Barbosa, A.M.P.; Floriano, J.F.; Felisbino, S.L.; Costa, S.M.B.; Piculo, F.; Marini, G.; Nunes, S.K.; Reyes, D.R.A.; Marcondes, J.P.C. Deleterious Effects of Gestational Diabetes Mellitus on the Characteristics of the Rectus Abdominis Muscle Associated with Pregnancy-Specific Urinary Incontinence. Diabetes Res. Clin. Pract. 2020, 166, 108315. [Google Scholar] [CrossRef]
- Vesentini, G.; Barbosa, A.M.P.; Damasceno, D.C.; Marini, G.; Piculo, F.; Matheus, S.M.M.; Hallur, R.L.S.; Nunes, S.K.; Catinelli, B.B.; Magalhães, C.G.; et al. Alterations in the Structural Characteristics of Rectus Abdominis Muscles Caused by Diabetes and Pregnancy: A Comparative Study of the Rat Model and Women. PLoS ONE 2020, 15, e0231096. [Google Scholar] [CrossRef] [Green Version]
- Chuang, C.-M.; Lin, I.-F.; Horng, H.-C.; Hsiao, Y.-H.; Shyu, I.-L.; Chou, P. The Impact of Gestational Diabetes Mellitus on Postpartum Urinary Incontinence: A Longitudinal Cohort Study on Singleton Pregnancies. BJOG Int. J. Obstet. Gynaecol. 2012, 119, 1334–1343. [Google Scholar] [CrossRef] [PubMed]
- Bassi-Dibai, D.; Santos-de-Araújo, A.D.; Dibai-Filho, A.V.; de Azevedo, L.F.S.; Goulart, C.d.L.; Luz, G.C.P.; Burke, P.R.; Garcia-Araújo, A.S.; Borghi-Silva, A. Rehabilitation of Individuals With Diabetes Mellitus: Focus on Diabetic Myopathy. Front. Endocrinol. 2022, 13, 869921. [Google Scholar] [CrossRef]
- Piculo, F.; Marini, G.; Barbosa, A.M.P.; Damasceno, D.C.; Matheus, S.M.M.; Felisbino, S.L.; Daneshgari, F.; Rudge, M.V.C. Urethral Striated Muscle and Extracellular Matrix Morphological Characteristics among Mildly Diabetic Pregnant Rats: Translational Approach. Int. Urogynecol. J. 2014, 25, 403–415. [Google Scholar] [CrossRef]
- Marini, G.; Piculo, F.; Vesentini, G.; Barbosa, A.M.P.; Damasceno, D.C.; Matheus, S.M.M.; Hijaz, A.; Daneshgari, F.; Rudge, M.V.C. Effects of Short-Term Severe and Long-Term Mild STZ-Induced Diabetes in Urethral Tissue of Female Rats. Neurourol. Urodyn. 2017, 36, 574–579. [Google Scholar] [CrossRef]
- Prudencio, C.B.; Rudge, M.V.C.; Pinheiro, F.A.; Sartorão Filho, C.I.; Nunes, S.K.; Pedroni, C.R.; Junginger, B.; Barbosa, A.M.P. Negative Impact of Gestational Diabetes Mellitus on Progress of Pelvic Floor Muscle Electromyography Activity: Cohort Study. PLoS ONE 2019, 14, e0223261. [Google Scholar] [CrossRef]
- Sartorão Filho, C.I.; Pinheiro, F.A.; Prudencio, C.B.; Nunes, S.K.; Takano, L.; Enriquez, E.M.A.; Orlandi, M.I.G.; Junginger, B.; Hallur, R.L.S.; Rudge, M.V.C.; et al. Impact of Gestational Diabetes on Pelvic Floor: A Prospective Cohort Study with Three-dimensional Ultrasound during Two-time Points in Pregnancy. Neurourol. Urodyn. 2020, 39, 2329–2337. [Google Scholar] [CrossRef] [PubMed]
- Piculo, F.; Marini, G.; Vesentini, G.; Morceli, G.; Damasceno, D.C.; Sobrevia, L.; Barbosa, A.M.P.; Rudge, M.V.C. Pregnancy-Specific Urinary Incontinence in Women with Gestational Hyperglycaemia Worsens the Occurrence and Severity of Urinary Incontinence and Quality of Life over the First Year Post Partum. Eur. J. Obstet. Gynecol. Reprod. Biol. 2020, 252, 336–343. [Google Scholar] [CrossRef] [PubMed]
- Floriano, J.F.; Willis, G.; Catapano, F.; de Lima, P.R.; Reis, F.V.D.S.; Barbosa, A.M.P.; Rudge, M.V.C.; Emanueli, C. Exosomes Could Offer New Options to Combat the Long-Term Complications Inflicted by Gestational Diabetes Mellitus. Cells 2020, 9, 675. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woodley, S.J.; Lawrenson, P.; Boyle, R.; Cody, J.D.; Mørkved, S.; Kernohan, A.; Hay-Smith, E.J.C. Pelvic Floor Muscle Training for Preventing and Treating Urinary and Faecal Incontinence in Antenatal and Postnatal Women. Cochrane Database Syst. Rev. 2020, 2021, CD007471. [Google Scholar] [CrossRef]
- Brown, S.J.; Donath, S.; MacArthur, C.; McDonald, E.A.; Krastev, A.H. Urinary Incontinence in Nulliparous Women before and during Pregnancy: Prevalence, Incidence, and Associated Risk Factors. Int. Urogynecol. J. 2010, 21, 193–202. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.-R.; Lin, W.-A.; Chang, T.-C.; Lin, H.-H.; Lee, C.-N.; Lin, M.-I. Risk Factors for Stress and Urge Urinary Incontinence during Pregnancy and the First Year Postpartum: A Prospective Longitudinal Study. Int. Urogynecol. J. 2021, 32, 2455–2464. [Google Scholar] [CrossRef]
- Daly, D.; Clarke, M.; Begley, C. Urinary Incontinence in Nulliparous Women before and during Pregnancy: Prevalence, Incidence, Type, and Risk Factors. Int. Urogynecol. J. 2018, 29, 353–362. [Google Scholar] [CrossRef] [PubMed]
- Hage-Fransen, M.A.H.; Wiezer, M.; Otto, A.; Wieffer-Platvoet, M.S.; Slotman, M.H.; Nijhuis-van der Sanden, M.W.G.; Pool-Goudzwaard, A.L. Pregnancy- and Obstetric-related Risk Factors for Urinary Incontinence, Fecal Incontinence, or Pelvic Organ Prolapse Later in Life: A Systematic Review and Meta-analysis. Acta Obstet. Gynecol. Scand. 2021, 100, 373–382. [Google Scholar] [CrossRef]
- Maroyi, R.; Mwambali, N.; Moureau, M.K.; Keyser, L.E.; McKinney, J.L.; Brown, H.W.; Mukwege, D.M. Prevalence of Urinary Incontinence in Pregnant and Postpartum Women in the Democratic Republic of Congo. Int. Urogynecol. J. 2021, 32, 1883–1888. [Google Scholar] [CrossRef]
- Wesnes, S.L.; Rortveit, G.; Bø, K.; Hunskaar, S. Urinary Incontinence During Pregnancy. Obstet. Gynecol. 2007, 109, 922–928. [Google Scholar] [CrossRef]
- Salzer, L.; Tenenbaum-Gavish, K.; Hod, M. Metabolic Disorder of Pregnancy (Understanding Pathophysiology of Diabetes and Preeclampsia). Best Pract. Res. Clin. Obstet. Gynaecol. 2015, 29, 328–338. [Google Scholar] [CrossRef] [PubMed]
- Shashikadze, B.; Flenkenthaler, F.; Stöckl, J.B.; Valla, L.; Renner, S.; Kemter, E.; Wolf, E.; Fröhlich, T. Developmental Effects of (Pre-)Gestational Diabetes on Offspring: Systematic Screening Using Omics Approaches. Genes 2021, 12, 1991. [Google Scholar] [CrossRef] [PubMed]
- Rodrigo, N.; Glastras, S. The Emerging Role of Biomarkers in the Diagnosis of Gestational Diabetes Mellitus. J. Clin. Med. 2018, 7, 120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, Y.; Zhang, C.; Weisskopf, M.G.; Williams, P.L.; Claus Henn, B.; Parsons, P.J.; Palmer, C.D.; Buck Louis, G.M.; James-Todd, T. Evaluating Associations between Early Pregnancy Trace Elements Mixture and 2nd Trimester Gestational Glucose Levels: A Comparison of Three Statistical Approaches. Int. J. Hyg. Environ. Health 2020, 224, 113446. [Google Scholar] [CrossRef]
- Melé, M.; Ferreira, P.G.; Reverter, F.; DeLuca, D.S.; Monlong, J.; Sammeth, M.; Young, T.R.; Goldmann, J.M.; Pervouchine, D.D.; Sullivan, T.J.; et al. The Human Transcriptome across Tissues and Individuals. Science 2015, 348, 660–665. [Google Scholar] [CrossRef] [Green Version]
- Calimlioglu, B.; Karagoz, K.; Sevimoglu, T.; Kilic, E.; Gov, E.; Arga, K.Y. Tissue-Specific Molecular Biomarker Signatures of Type 2 Diabetes: An Integrative Analysis of Transcriptomics and Protein–Protein Interaction Data. Omi. A J. Integr. Biol. 2015, 19, 563–573. [Google Scholar] [CrossRef]
- Jervis, P.J. Hydrogels in Regenerative Medicine and Other Biomedical Applications. Int. J. Mol. Sci. 2022, 23, 3270. [Google Scholar] [CrossRef]
- de Castro, R.; Antunes, R.; Mendes, D.; Szumilewicz, A.; Santos-Rocha, R. Can Group Exercise Programs Improve Health Outcomes in Pregnant Women? An Updated Systematic Review. Int. J. Environ. Res. Public Health 2022, 19, 4875. [Google Scholar] [CrossRef]
- Talmadge, R.J.; Paalani, M. Sarco(Endo)Plasmic Reticulum Calcium Pump Isoforms in Paralyzed Rat Slow Muscle. Biochim. Biophys. Acta Gen. Subj. 2007, 1770, 1187–1193. [Google Scholar] [CrossRef]
- Schiaffino, S.; Reggiani, C. Fiber Types in Mammalian Skeletal Muscles. Physiol. Rev. 2011, 91, 1447–1531. [Google Scholar] [CrossRef]
- Morley, S.C.; Sung, J.; Sun, G.-P.; Martelli, M.P.; Bunnell, S.C.; Bierer, B.E. Gelsolin Overexpression Alters Actin Dynamics and Tyrosine Phosphorylation of Lipid Raft-Associated Proteins in Jurkat T Cells. Mol. Immunol. 2007, 44, 2469–2480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, J.; Klein, J.D.; Du, J.; Wang, X.H. Cardiac Muscle Protein Catabolism in Diabetes Mellitus: Activation of the Ubiquitin-Proteasome System by Insulin Deficiency. Endocrinology 2008, 149, 5384–5390. [Google Scholar] [CrossRef] [PubMed]
- Bouchi, R.; Fukuda, T.; Takeuchi, T.; Nakano, Y.; Murakami, M.; Minami, I.; Izumiyama, H.; Hashimoto, K.; Yoshimoto, T.; Ogawa, Y. Insulin Treatment Attenuates Decline of Muscle Mass in Japanese Patients with Type 2 Diabetes. Calcif. Tissue Int. 2017, 101, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugimoto, K.; Ikegami, H.; Takata, Y.; Katsuya, T.; Fukuda, M.; Akasaka, H.; Tabara, Y.; Osawa, H.; Hiromine, Y.; Rakugi, H. Glycemic Control and Insulin Improve Muscle Mass and Gait Speed in Type 2 Diabetes: The MUSCLES-DM Study. J. Am. Med. Dir. Assoc. 2021, 22, 834–838.e1. [Google Scholar] [CrossRef] [PubMed]
- Sitia, R.; Braakman, I. Quality Control in the Endoplasmic Reticulum Protein Factory. Nature 2003, 426, 891–894. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rinehart, R.W.; Roberson, J.; Beattie, D.S. The Effect of Diabetes on Protein Synthesis and the Respiratory Chain of Rat Skeletal Muscle and Kidney Mitochondria. Arch. Biochem. Biophys. 1982, 213, 341–352. [Google Scholar] [CrossRef]
- Hussey, S.E.; Sharoff, C.G.; Garnham, A.; YI, Z.; Bowen, B.P.; Mandarino, L.J.; Hargreaves, M. Effect of Exercise on the Skeletal Muscle Proteome in Patients with Type 2 Diabetes. Med. Sci. Sport. Exerc. 2013, 45, 1069–1076. [Google Scholar] [CrossRef] [Green Version]
- Kusakabe, T.; Motoki, K.; Hori, K. Mode of Interactions of Human Aldolase Isozymes with Cytoskeletons. Arch. Biochem. Biophys. 1997, 344, 184–193. [Google Scholar] [CrossRef]
- Kao, A.W.; Noda, Y.; Johnson, J.H.; Pessin, J.E.; Saltiel, A.R. Aldolase Mediates the Association of F-Actin with the Insulin-Responsive Glucose Transporter GLUT4. J. Biol. Chem. 1999, 274, 17742–17747. [Google Scholar] [CrossRef] [Green Version]
- Petersen, K.F.; Shulman, G.I. Pathogenesis of Skeletal Muscle Insulin Resistance in Type 2 Diabetes Mellitus. Am. J. Cardiol. 2002, 90, 11–18. [Google Scholar] [CrossRef]
- Bradshaw, A.D.; Sage, E.H. SPARC, a Matricellular Protein That Functions in Cellular Differentiation and Tissue Response to Injury. J. Clin. Investig. 2001, 107, 1049–1054. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghanemi, A.; Melouane, A.; Yoshioka, M.; St-Amand, J. Secreted Protein Acidic and Rich in Cysteine and Bioenergetics: Extracellular Matrix, Adipocytes Remodeling and Skeletal Muscle Metabolism. Int. J. Biochem. Cell Biol. 2019, 117, 105627. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, K.; Nakano, S.-I.; Miyoshi, T.; Yamanouchi, K.; Nishihara, M. Loss of Sparc in Mouse Skeletal Muscle Causes Myofiber Atrophy. Muscle Nerve 2013, 48, 791–799. [Google Scholar] [CrossRef]
- Marini, G.; Piculo, F.; Vesentini, G.; Damasceno, D.C.; Delella, F.K.; Calderon, I.M.P.; Daneshgari, F.; Felisbino, S.L.; Barbosa, A.M.P.; Rudge, M.V.C. The Influence of Hyperglycemia on the Remodeling of Urethral Connective Tissue in Pregnant Rats. Eur. J. Obstet. Gynecol. Reprod. Biol. 2018, 221, 81–88. [Google Scholar] [CrossRef] [Green Version]
- D’Souza, D.M.; Al-Sajee, D.; Hawke, T.J. Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells. Front. Physiol. 2013, 4, 379. [Google Scholar] [CrossRef] [Green Version]
- Hu, Z.; Wang, H.; Lee, I.H.; Modi, S.; Wang, X.; Du, J.; Mitch, W.E. PTEN Inhibition Improves Muscle Regeneration in Mice Fed a High-Fat Diet. Diabetes 2010, 59, 1312–1320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aguiari, P.; Leo, S.; Zavan, B.; Vindigni, V.; Rimessi, A.; Bianchi, K.; Franzin, C.; Cortivo, R.; Rossato, M.; Vettor, R.; et al. High Glucose Induces Adipogenic Differentiation of Muscle-Derived Stem Cells. Proc. Natl. Acad. Sci. USA 2008, 105, 1226–1231. [Google Scholar] [CrossRef] [Green Version]
- Kee, A.J.; Yang, L.; Lucas, C.A.; Greenberg, M.J.; Martel, N.; Leong, G.M.; Hughes, W.E.; Cooney, G.J.; James, D.E.; Ostap, E.M. An Actin Filament Population Defined by the Tropomyosin Tpm3. 1 Regulates Glucose Uptake. Traffic 2015, 16, 691–711. [Google Scholar] [CrossRef]
- Dong, Y.; Yan, S.; Li, G.-Y.; Wang, M.-N.; Leng, L.; Li, Q. Identification of Key Candidate Genes and Pathways Revealing the Protective Effect of Liraglutide on Diabetic Cardiac Muscle by Integrated Bioinformatics Analysis. Ann. Transl. Med. 2020, 8, 181. [Google Scholar] [CrossRef]
- SERRANO, A.L.; PÉREZ, M.; LUCÍA, A.; CHICHARRO, J.L.; QUIROZ-ROTHE, E.; RIVERO, J.L.L. Immunolabelling, Histochemistry and in Situ Hybridisation in Human Skeletal Muscle Fibres to Detect Myosin Heavy Chain Expression at the Protein and MRNA Level. J. Anat. 2001, 199, 329–337. [Google Scholar] [CrossRef]
- Stuart, C.A.; McCurry, M.P.; Marino, A.; South, M.A.; Howell, M.E.A.; Layne, A.S.; Ramsey, M.W.; Stone, M.H. Slow-Twitch Fiber Proportion in Skeletal Muscle Correlates With Insulin Responsiveness. J. Clin. Endocrinol. Metab. 2013, 98, 2027–2036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coen, P.M.; Dubé, J.J.; Amati, F.; Stefanovic-Racic, M.; Ferrell, R.E.; Toledo, F.G.S.; Goodpaster, B.H. Insulin Resistance Is Associated With Higher Intramyocellular Triglycerides in Type I but Not Type II Myocytes Concomitant With Higher Ceramide Content. Diabetes 2010, 59, 80–88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, M.; Feng, H.-Z.; Gupta, D.; Kelleher, J.; Dickerson, K.E.; Wang, J.; Hunt, D.; Jou, W.; Gavrilova, O.; Jin, J.-P.; et al. G s α Deficiency in Skeletal Muscle Leads to Reduced Muscle Mass, Fiber-Type Switching, and Glucose Intolerance without Insulin Resistance or Deficiency. Am. J. Physiol. Physiol. 2009, 296, C930–C940. [Google Scholar] [CrossRef] [Green Version]
- Gaber, E.M.; Jayaprakash, P.; Qureshi, M.A.; Parekh, K.; Oz, M.; Adrian, T.E.; Howarth, F.C. Effects of a Sucrose-Enriched Diet on the Pattern of Gene Expression, Contraction and Ca2+ Transport in Goto-Kakizaki Type 2 Diabetic Rat Heart. Exp. Physiol. 2014, 99, 881–893. [Google Scholar] [CrossRef]
- Oberbach, A.; Bossenz, Y.; Lehmann, S.; Niebauer, J.; Adams, V.; Paschke, R.; Schön, M.R.; Blüher, M.; Punkt, K. Altered Fiber Distribution and Fiber-Specific Glycolytic and Oxidative Enzyme Activity in Skeletal Muscle of Patients With Type 2 Diabetes. Diabetes Care 2006, 29, 895–900. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gunning, P.W.; Hardeman, E.C.; Lappalainen, P.; Mulvihill, D.P. Tropomyosin–Master Regulator of Actin Filament Function in the Cytoskeleton. J. Cell Sci. 2015, 128, 2965–2974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frontera, W.R.; Ochala, J. Skeletal Muscle: A Brief Review of Structure and Function. Calcif. Tissue Int. 2015, 96, 183–195. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Yang, X.; Liu, J. Differential Control of ATGL-Mediated Lipid Droplet Degradation by CGI-58 and G0S2. Cell Cycle 2010, 9, 2791–2797. [Google Scholar] [CrossRef] [Green Version]
- Laurens, C.; Badin, P.M.; Louche, K.; Mairal, A.; Tavernier, G.; Marette, A.; Tremblay, A.; Weisnagel, S.J.; Joanisse, D.R.; Langin, D.; et al. G0/G1 Switch Gene 2 Controls Adipose Triglyceride Lipase Activity and Lipid Metabolism in Skeletal Muscle. Mol. Metab. 2016, 5, 527–537. [Google Scholar] [CrossRef]
- Badin, P.-M.; Louche, K.; Mairal, A.; Liebisch, G.; Schmitz, G.; Rustan, A.C.; Smith, S.R.; Langin, D.; Moro, C. Altered Skeletal Muscle Lipase Expression and Activity Contribute to Insulin Resistance in Humans. Diabetes 2011, 60, 1734–1742. [Google Scholar] [CrossRef]
- Hromadnikova, I.; Kotlabova, K.; Dvorakova, L.; Krofta, L. Diabetes Mellitus and Cardiovascular Risk Assessment in Mothers with a History of Gestational Diabetes Mellitus Based on Postpartal Expression Profile of MicroRNAs Associated with Diabetes Mellitus and Cardiovascular and Cerebrovascular Diseases. Int. J. Mol. Sci. 2020, 21, 2437. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fall, M.; Abrams, P.; Griffiths, D.; Victor, A. The Standardisation of Terminology of Lower Urinary Tract Function: Report from the Standardisation Sub-Committe. Neurourol. Urodyn. 2002, 21, 167–178. [Google Scholar]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Green Version]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python Framework to Work with High-Throughput Sequencing Data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Consortium, G.O. Gene Ontology Consortium: Going Forward. Nucleic Acids Res. 2015, 43, D1049–D1056. [Google Scholar] [CrossRef]
- Snel, B.; Lehmann, G.; Bork, P.; Huynen, M.A. STRING: A Web-Server to Retrieve and Display the Repeatedly Occurring Neighbourhood of a Gene. Nucleic Acids Res. 2000, 28, 3442–3444. [Google Scholar] [CrossRef] [Green Version]
- Szklarczyk, D.; Morris, J.H.; Cook, H.; Kuhn, M.; Wyder, S.; Simonovic, M.; Santos, A.; Doncheva, N.T.; Roth, A.; Bork, P. The STRING Database in 2017: Quality-Controlled Protein–Protein Association Networks, Made Broadly Accessible. Nucleic Acids Res. 2016, 45, D1 gkw937. [Google Scholar] [CrossRef]
- Heberle, H.; Meirelles, G.V.; da Silva, F.R.; Telles, G.P.; Minghim, R. InteractiVenn: A Web-Based Tool for the Analysis of Sets through Venn Diagrams. BMC Bioinform. 2015, 16, 169. [Google Scholar] [CrossRef] [Green Version]
- Kaushal, A.; Zhang, H.; Karmaus, W.J.J.; Everson, T.M.; Marsit, C.J.; Karagas, M.R.; Tsai, S.-F.; Wen, H.-J.; Wang, S.-L. Genome-Wide DNA Methylation at Birth in Relation to in Utero Arsenic Exposure and the Associated Health in Later Life. Environ. Health 2017, 16, 50. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Mahoney, D.J.; Carey, K.; Fu, M.-H.; Snow, R.; Cameron-Smith, D.; Parise, G.; Tarnopolsky, M.A. Real-Time RT-PCR Analysis of Housekeeping Genes in Human Skeletal Muscle Following Acute Exercise. Physiol. Genom. 2004, 18, 226–231. [Google Scholar] [CrossRef]
- Yüzbaşıoğlu, A.; Onbaşılar, İ.; Kocaefe, Ç.; Özgüç, M. Assessment of Housekeeping Genes for Use in Normalization of Real Time PCR in Skeletal Muscle with Chronic Degenerative Changes. Exp. Mol. Pathol. 2010, 88, 326–329. [Google Scholar] [CrossRef]
ND-C (n = 6) | ND-I (n = 6) | GDM-C (n = 6) | GDM-I (n = 6) | |
---|---|---|---|---|
Age (years) | 29.6 ± 6.40 | 27 ± 5.49 | 31 ± 4.49 | 28 ± 6.16 |
Previous C-section | 0.6 ± 0.48 | 0.16 ± 0.4 | 0.8 ± 0.4 | 0.16 ± 0.37 |
Previous fetal or neonatal death | 0.2 ± 0.4 | 0.33 ± 0.48 | 0 | 0.16 ± 0.37 |
BMI pre-pregnancy (kg/m2) | 30.16 ± 9.79 | 29.56 ± 8.07 | 31.75 ± 3.15 | 29.03 ± 3.08 |
BMI delivery (kg/m2) | 34.29 ± 9.99 | 34.19 ± 6.64 | 35.78 ± 4.04 | 33.11 ± 3.17 |
Fasting glucose (mg/dL) | 66 ± 9.35 | 76 ± 9.31 | 94.2 ± 3.69 * | 97 ± 11.07 *# |
Oral test tolerence—1 h (mg/dL) | 108 ± 13.47 | 129 ± 12.96 | 166 ± 34.30 | 169 ± 21.11 |
Oral test tolerence—2 h (mg/dL) | 82 ± 22.20 | 115 ± 8.95 | 165 ± 42.23 | 179 ±38 |
Birth weight (g) | 2864 ± 222 | 3304 ± 592 | 3862 ± 464 * | 3750 ± 356 * |
Gene | Name | Biological Process | Molecular Function | Cellular Component |
---|---|---|---|---|
G0S2 | G0/G1 switch protein 2 | Regulation of lipid metabolic process | Glycoprotein binding | Intracellular non-membrane organelle |
MYH7 | Myosin-7 | Muscle filament sliding | Actin binding | Muscle myosin complex |
NACA | Nascent polypeptide-associated complex subunit alpha, muscle-specific form | Negative regulation of muscle cell apoptotic process | Nucleic acid binding | Nascent polypeptide-associated complex |
TPM3 | Tropomyosin alpha-3 chain | Muscle filament sliding | Actin binding | Muscle thin filament |
Target mRNA | Primer Sequence | Final [ ] (nM) | |
---|---|---|---|
MYH7 | F | TCGGAGATGGCAGTCTTTGG | 200 |
MYH7 | R | TGAGGTCAAAAGGCCTGGTC | 200 |
TPM3 | F | GCACATTGCAGAAGAGGCAG | 200 |
TPM3 | R | TCTGTGCGTTCCAAGTCTCC | 200 |
G0S2 | F | GCCGTGCCACTAAGGTCATT | 200 |
G0S2 | R | GATCAGCTCCTGGACCGTTT | 200 |
NACA | F | TCCAACTGTACAAGAGGAGAGTG | 200 |
NACA | R | GCTTGTGACATGACCAATTCAATG | 200 |
ATP2A2 | F | AATTGCTGTTGGTGACAAAGTTCC | 300 |
ATP2A2 | R | AGTGTGCTTGATGACAGAGACAG | 300 |
UBC | F | GGGATTTGGGTCGCAGTTCT | 200 |
UBC | R | CTTACCAGTCAGAGTCTTCACGA | 200 |
EEF1A1 | F | TGCCAGTTCCTCGTAGAGATTG | 200 |
EEF1A1 | R | GCCACAAGCACTTAAAACCCA | 200 |
EIF1 | F | TGCCAGTTCCTCGTAGAGATTG | 300 |
EIF1 | R | GCCACAAGCACTTAAAACCCA | 300 |
GAPDH | F | TCACCATCTTCCAGGAGCGA | 400 |
GAPDH | R | AGCATCGCCCCACTTGATTT | 400 |
ACTB | F | ATTGCCGACAGGATGCAGAA | 200 |
ACTB | R | CGCTCAGGAGGAGCAATGAT | 200 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alves, F.C.B.; Oliveira, R.G.d.; Reyes, D.R.A.; Garcia, G.A.; Floriano, J.F.; Shetty, R.H.L.; Mareco, E.A.; Dal-Pai-Silva, M.; Payão, S.L.M.; Souza, F.P.d.; et al. Transcriptomic Profiling of Rectus Abdominis Muscle in Women with Gestational Diabetes-Induced Myopathy: Characterization of Pathophysiology and Potential Muscle Biomarkers of Pregnancy-Specific Urinary Incontinence. Int. J. Mol. Sci. 2022, 23, 12864. https://doi.org/10.3390/ijms232112864
Alves FCB, Oliveira RGd, Reyes DRA, Garcia GA, Floriano JF, Shetty RHL, Mareco EA, Dal-Pai-Silva M, Payão SLM, Souza FPd, et al. Transcriptomic Profiling of Rectus Abdominis Muscle in Women with Gestational Diabetes-Induced Myopathy: Characterization of Pathophysiology and Potential Muscle Biomarkers of Pregnancy-Specific Urinary Incontinence. International Journal of Molecular Sciences. 2022; 23(21):12864. https://doi.org/10.3390/ijms232112864
Chicago/Turabian StyleAlves, Fernanda Cristina Bergamo, Rafael Guilen de Oliveira, David Rafael Abreu Reyes, Gabriela Azevedo Garcia, Juliana Ferreira Floriano, Raghavendra Hallur Lakshmana Shetty, Edson Assunção Mareco, Maeli Dal-Pai-Silva, Spencer Luiz Marques Payão, Fátima Pereira de Souza, and et al. 2022. "Transcriptomic Profiling of Rectus Abdominis Muscle in Women with Gestational Diabetes-Induced Myopathy: Characterization of Pathophysiology and Potential Muscle Biomarkers of Pregnancy-Specific Urinary Incontinence" International Journal of Molecular Sciences 23, no. 21: 12864. https://doi.org/10.3390/ijms232112864