Therapeutic Effects of Insulin-Producing Human Umbilical Cord-Derived Mesenchymal Stem Cells in a Type 1 Diabetes Mouse Model
Abstract
:1. Introduction
2. Results
2.1. Characterization of hUC-MSCs and hAD-MSCs
2.2. Induction of IPCs from hUC-MSCs and hAD-MSCs
2.3. Functions and Characteristic Features of Insulin-Producing β-like Cells Derived from hUC-MSCs and hAD-MSCs
2.4. Therapeutic Effects of IPCs in the T1D Animal Model
3. Discussion
4. Materials and Methods
4.1. Tissues
4.2. Isolation and Culture of hUC-Derived MSCs
4.3. Culture of Human Adipose-Derived MSCs (hAD-MSCs)
4.4. Population Doubling Time
4.5. Characterization of hUC-MSCs and hAD-MSCs
4.6. Direct Trans-Differentiation of hUC-MSCs and hAD-MSCs into IPCs
4.7. Measurement and Calculation of Islet Equivalents
4.8. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCT)
4.9. Immunocytochemistry for Pancreatic Developmental Stage in IPCs
4.10. Glucose-Stimulated Insulin Secretion Assay
4.11. PKH26-Red Fluorescent Cell Linker
4.12. Cell Viability
4.13. Streptozotocin-Induced T1D Mouse Model
4.14. Transplantation of hUC-MSCs and Induction of Cultured hUC-IPCs
4.15. Evaluations of FBG, IP-GTT, C-peptide, Insulin, and HOMA-IR
4.16. Tissue Immunofluorescence Staining
4.17. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wan, X.X.; Zhang, D.Y.; Khan, A.; Zheng, S.Y.; Hu, X.M.; Zhang, Q.; Yang, R.H.; Xiong, K. Stem Cell Transplantation in the Treatment of Type 1 Diabetes Mellitus: From Insulin Replacement to Beta-Cell Replacement. Front. Endocrinol. 2022, 13. [Google Scholar] [CrossRef] [PubMed]
- Frommer, L.; Kahaly, G.J. Type 1 Diabetes and Autoimmune Thyroid Disease—The Genetic Link. Front. Endocrinol. 2021, 12. [Google Scholar] [CrossRef]
- Galicia-Garcia, U.; Benito-Vicente, A.; Jebari, S.; Larrea-Sebal, A.; Siddiqi, H.; Uribe, K.B.; Ostolaza, H.; Martín, C. Pathophysiology of Type 2 Diabetes Mellitus. Int. J. Mol. Sci. 2020, 21, 6275. [Google Scholar] [CrossRef] [PubMed]
- Gale, E.A. The Rise of Childhood Type 1 Diabetes in the 20th Century. Diabetes 2002, 51, 3353–3361. [Google Scholar] [CrossRef] [PubMed]
- Mobasseri, M.; Shirmohammadi, M.; Amiri, T.; Vahed, N.; Fard, H.H.; Ghojazadeh, M. Prevalence and incidence of type 1 diabetes in the world: A systematic review and meta-analysis. Heal. Promot. Perspect. 2020, 10, 98–115. [Google Scholar] [CrossRef]
- Patterson, C.C.; Karuranga, S.; Salpea, P.; Saeedi, P.; Dahlquist, G.; Soltesz, G.; Ogle, G.D. Worldwide estimates of incidence, prevalence and mortality of type 1 diabetes in children and adolescents: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res. Clin. Pract. 2019, 157, 107842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vantyghem, M.C.; de Koning, E.J.P.; Pattou, F.; Rickels, M. Advances in β-cell replacement therapy for the treatment of type 1 diabetes. Lancet 2019, 394, 1274–1285. [Google Scholar] [CrossRef]
- Lin, X.; Xu, Y.; Pan, X.; Xu, J.; Ding, Y.; Sun, X.; Song, X.; Ren, Y.; Shan, P.F. Global, regional, and national burden and trend of diabetes in 195 countries and territories: An analysis from 1990 to 2025. Sci. Rep. 2020, 10, 14790. [Google Scholar] [CrossRef] [PubMed]
- Wegmeyer, H.; Bröske, A.M.; Leddin, M.; Kuentzer, K.; Nisslbeck, A.K.; Hupfeld, J.; Wiechmann, K.; Kuhlen, J.; Von Schwerin, C.; Stein, C.; et al. Mesenchymal Stromal Cell Characteristics Vary Depending on Their Origin. Stem Cells Dev. 2013, 22, 2606–2618. [Google Scholar] [CrossRef] [Green Version]
- Kurtz, A. Mesenchymal Stem Cell Delivery Routes and Fate. Int. J. Stem Cells 2008, 1, 1–7. [Google Scholar] [CrossRef]
- Liu, L.; Liu, H.; Chen, M.; Ren, S.; Cheng, P.; Zhang, H. miR-301b~miR-130b—PPARγ axis underlies the adipogenic capacity of mesenchymal stem cells with different tissue origins. Sci. Rep. 2017, 7, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Jin, H.J.; Bae, Y.K.; Kim, M.; Kwon, S.J.; Jeon, H.B.; Choi, S.J.; Kim, S.W.; Yang, Y.S.; Oh, W.; Chang, J.W. Comparative Analysis of Human Mesenchymal Stem Cells from Bone Marrow, Adipose Tissue, and Umbilical Cord Blood as Sources of Cell Therapy. Int. J. Mol. Sci. 2013, 14, 17986–18001. [Google Scholar] [CrossRef]
- Hass, R.; Kasper, C.; Böhm, S.; Jacobs, R. Different populations and sources of human mesenchymal stem cells (MSC): A comparison of adult and neonatal tissue-derived MSC. Cell Commun. Signal. 2011, 9, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maleki, M.; Ghanbarvand, F.; Behvarz, M.R.; Ejtemaei, M.; Ghadirkhomi, E. Comparison of Mesenchymal Stem Cell Markers in Multiple Human Adult Stem Cells. Int. J. Stem Cells 2014, 7, 118–126. [Google Scholar] [CrossRef] [Green Version]
- Aramata, S.; Han, S.I.; Kataoka, K. Roles and Regulation of Transcription Factor MafA in Islet β-cells. Endocr. J. 2007, 54, 659–666. [Google Scholar] [CrossRef] [Green Version]
- Seno, M.; Nostro, M.C. Proceedings of the Annual Plenary Session on Regenerative Medicine (PAPRM)-2020. J. Stem Cells Regen. Med. 2020, 16, 90–91. [Google Scholar] [CrossRef] [PubMed]
- Ikemoto, T.; Tokuda, K.; Wada, Y.; Gao, L.; Miyazaki, K.; Yamada, S.; Saito, Y.; Imura, S.; Morine, Y.; Shimada, M. Adipose Tissue from Type 1 Diabetes Mellitus Patients Can Be Used to Generate Insulin-Producing Cells. Pancreas 2020, 49, 1225–1231. [Google Scholar] [CrossRef] [PubMed]
- Kiyokawa, Y.; Sato, M.; Noguchi, H.; Inada, E.; Iwase, Y.; Kubota, N.; Sawami, T.; Terunuma, M.; Maeda, T.; Hayasaki, H.; et al. Drug-Induced Naïve iPS Cells Exhibit Better Performance than Primed iPS Cells with Respect to the Ability to Differentiate into Pancreatic β-Cell Lineage. J. Clin. Med. 2020, 9, 2838. [Google Scholar] [CrossRef]
- Kim, M.J.; Lee, E.Y.; You, Y.H.; Yang, H.K.; Yoon, K.H.; Kim, J.W. Generation of iPSC-derived insulin-producing cells from patients with type 1 and type 2 diabetes compared with healthy control. Stem Cell Res. 2020, 48, 101958. [Google Scholar] [CrossRef] [PubMed]
- Rao, P.; Deo, D.; Marchioni, M. Differentiation of Human Deceased Donor, Adipose-Derived, Mesenchymal Stem Cells into Functional Beta Cells. J. Stem Cells Regen. Med. 2020, 16, 63–72. [Google Scholar] [CrossRef]
- Le Blanc, K.; Rasmusson, I.; Sundberg, B.; Götherström, C.; Hassan, M.; Uzunel, M.; Ringdén, O. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004, 363, 1439–1441. [Google Scholar] [CrossRef]
- Sordi, V.; Malosio, M.L.; Marchesi, F.; Mercalli, A.; Melzi, R.; Giordano, T.; Belmonte, N.; Ferrari, G.; Leone, B.E.; Bertuzzi, F.; et al. Bone marrow mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets. Blood 2005, 106, 419–427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, H.; Mahato, R.I. Mesenchymal stem cell-based therapy for type 1 diabetes. Discov. Med. 2014, 17, 139–143. [Google Scholar]
- Zhang, S.; Wang, Q.; Ji, H.; Lu, H.; Yang, Q.; Yin, J.; Guan, W. Porcine pancreas mesenchymal cell characterization and functional differentiation into insulin-producing cells in vitro. Mol. Med. Rep. 2021, 24, 1–9. [Google Scholar] [CrossRef]
- Ezquer, F.E.; Ezquer, M.E.; Parrau, D.B.; Carpio, D.; Yañez, A.J.; Conget, P.A. Systemic Administration of Multipotent Mesenchymal Stromal Cells Reverts Hyperglycemia and Prevents Nephropathy in Type 1 Diabetic Mice. Biol. Blood Marrow Transplant. 2008, 14, 631–640. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sato, K.; Ozaki, K.; Mori, M.; Muroi, K.; Ozawa, K. Mesenchymal Stromal Cells for Graft-Versus-Host Disease: Basic Aspects and Clinical Outcomes. J. Clin. Exp. Hematop. 2010, 50, 79–89. [Google Scholar] [CrossRef] [Green Version]
- Liesveld, J.L.; Sharma, N.; Aljitawi, O.S. Stem cell homing: From physiology to therapeutics. Stem Cells 2020, 38, 1241–1253. [Google Scholar] [CrossRef]
- Kusuma, G.D.; Carthew, J.; Lim, R.; Frith, J.E. Effect of the Microenvironment on Mesenchymal Stem Cell Paracrine Signaling: Opportunities to Engineer the Therapeutic Effect. Stem Cells Dev. 2017, 26, 617–631. [Google Scholar] [CrossRef]
- Konala, V.B.R.; Mamidi, M.K.; Bhonde, R.; Das, A.K.; Pochampally, R.; Pal, R. The current landscape of the mesenchymal stromal cell secretome: A new paradigm for cell-free regeneration. Cytotherapy 2015, 18, 13–24. [Google Scholar] [CrossRef] [Green Version]
- Gao, F.; Chiu, S.M.; Motan, D.A.L.; Zhang, Z.; Chen, L.; Ji, H.L.; Tse, H.F.; Fu, Q.L.; Lian, Q. Mesenchymal stem cells and immunomodulation: Current status and future prospects. Cell Death Dis. 2016, 7, e2062. [Google Scholar] [CrossRef] [Green Version]
- Morgner, J.; Ghatak, S.; Jakobi, T.; Dieterich, C.; Aumailley, M.; Wickström, S.A. Integrin-linked kinase regulates the niche of quiescent epidermal stem cells. Nat. Commun. 2015, 6, 8198. [Google Scholar] [CrossRef] [Green Version]
- Gaur, M.; Dobke, M.; Lunyak, V.V. Mesenchymal Stem Cells from Adipose Tissue in Clinical Applications for Dermatological Indications and Skin Aging. Int. J. Mol. Sci. 2017, 18, 208. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Tredget, E.E.; Wu, P.Y.G.; Wu, Y. Paracrine Factors of Mesenchymal Stem Cells Recruit Macrophages and Endothelial Lineage Cells and Enhance Wound Healing. PLoS ONE 2008, 3, e1886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vizoso, F.J.; Eiro, N.; Cid, S.; Schneider, J.; Perez-Fernandez, R. Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. Int. J. Mol. Sci. 2017, 18, 1852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gucciardo, L.; Lories, R.; Done, E.; Zwijsen, A.; Deprest, J.; Ochsenbein-Kölble, N. Fetal mesenchymal stem cells: Isolation, properties and potential use in perinatology and regenerative medicine. BJOG Int. J. Obstet. Gynaecol. 2008, 116, 166–172. [Google Scholar] [CrossRef] [PubMed]
- Manini, I.; Gulino, L.; Gava, B.; Pierantozzi, E.; Curina, C.; Rossi, D.; Brafa, A.; D’Aniello, C.; Sorrentino, V. Multi-potent progenitors in freshly isolated and cultured human mesenchymal stem cells: A comparison between adipose and dermal tissue. Cell Tissue Res. 2011, 344, 85–95. [Google Scholar] [CrossRef]
- Yaochite, J.N.U.; Caliari-Oliveira, C.; de Souza, L.E.B.; Neto, L.S.; Palma, P.V.B.; Covas, D.T.; Malmegrim, K.C.R.; Voltarelli, J.C.; Donadi, E.A. Therapeutic efficacy and biodistribution of allogeneic mesenchymal stem cells delivered by intrasplenic and intrapancreatic routes in streptozotocin-induced diabetic mice. Stem Cell Res. Ther. 2015, 6, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Jurewicz, M.; Yang, S.; Augello, A.; Godwin, J.G.; Moore, R.F.; Azzi, J.; Fiorina, P.; Atkinson, M.; Sayegh, M.H.; Abdi, R. Congenic Mesenchymal Stem Cell Therapy Reverses Hyperglycemia in Experimental Type 1 Diabetes. Diabetes 2010, 59, 3139–3147. [Google Scholar] [CrossRef] [Green Version]
- Madec, A.M.; Mallone, R.; Afonso, G.; Abou Mrad, E.; Mesnier, A.; Eljaafari, A.; Thivolet, C. Mesenchymal stem cells protect NOD mice from diabetes by inducing regulatory T cells. Diabetologia 2009, 52, 1391–1399. [Google Scholar] [CrossRef] [Green Version]
- Fiorina, P.; Jurewicz, M.; Augello, A.; Vergani, A.; Dada, S.; La Rosa, S.; Selig, M.; Godwin, J.; Law, K.; Placidi, C.; et al. Immunomodulatory Function of Bone Marrow-Derived Mesenchymal Stem Cells in Experimental Autoimmune Type 1 Diabetes. J. Immunol. 2009, 183, 993–1004. [Google Scholar] [CrossRef] [Green Version]
- Lebreton, F.; Lavallard, V.; Bellofatto, K.; Bonnet, R.; Wassmer, C.H.; Perez, L.; Kalandadze, V.; Follenzi, A.; Boulvain, M.; Kerr-Conte, J.; et al. Insulin-producing organoids engineered from islet and amniotic epithelial cells to treat diabetes. Nat. Commun. 2019, 10, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elayat, A.A.; El-Naggar, M.M.; Tahir, M. An immunocytochemical and morphometric study of the rat pancreatic islets. J. Anat. 1995, 186, 629–637. [Google Scholar] [PubMed]
- Wright, A.; Arthaud-Day, M.L.; Weiss, M.L. Therapeutic Use of Mesenchymal Stromal Cells: The Need for Inclusive Characterization Guidelines to Accommodate All Tissue Sources and Species. Front. Cell Dev. Biol. 2021, 9. [Google Scholar] [CrossRef] [PubMed]
- Lehmann, R.; Zuellig, R.A.; Kugelmeier, P.; Baenninger, P.B.; Moritz, W.; Perren, A.; Clavien, P.-A.; Weber, M.; Spinas, G.A. Superiority of Small Islets in Human Islet Transplantation. Diabetes 2007, 56, 594–603. [Google Scholar] [CrossRef] [Green Version]
- Vakhshiteh, F.; Allaudin, Z.N.; Lila, M.A.B.M.; Hani, H. Size-related assessment on viability and insulin secretion of caprine islets in vitro. Xenotransplantation 2013, 20, 82–88. [Google Scholar] [CrossRef]
- MacGregor, R.R.; Williams, S.J.; Tong, P.Y.; Kover, K.; Moore, W.V.; Stehno-Bittel, L. Small rat islets are superior to large islets in in vitro function and in transplantation outcomes. Am. J. Physiol. Metab. 2006, 290, E771–E779. [Google Scholar] [CrossRef]
- Li, W.; Zhao, R.; Liu, J.; Tian, M.; Lu, Y.; He, T.; Cheng, M.; Liang, K.; Li, X.; Wang, X.; et al. Small Islets Transplantation Superiority to Large Ones: Implications from Islet Microcirculation and Revascularization. J. Diabetes Res. 2014, 2014, 1–11. [Google Scholar] [CrossRef]
- Guan, Y.; Xie, Y.; Li, D.; Zhu, Y.; Zhang, X.; Feng, Y.; Chen, Y.; Xu, L.; Liao, P.; Wang, G. Comparison of biological characteristics of mesenchymal stem cells derived from the human umbilical cord and decidua parietalis. Mol. Med. Rep. 2019, 20, 633–639. [Google Scholar] [CrossRef] [Green Version]
- Palmer, J.P.; Fleming, G.A.; Greenbaum, C.J.; Herold, K.C.; Jansa, L.D.; Kolb, H.; Lachin, J.M.; Polonsky, K.S.; Pozzilli, P.; Skyler, J.S.; et al. C-Peptide Is the Appropriate Outcome Measure for Type 1 Diabetes Clinical Trials to Preserve β-Cell Function. Diabetes 2004, 53, 250–264. [Google Scholar] [CrossRef] [Green Version]
- Sima, A.A.F.; Zhang, W.; Sugimoto, K.; Henry, D.; Li, Z.; Wahren, J.; Grunberger, G. C-peptide prevents and improves chronic Type I diabetic polyneuropathy in the BB/Wor rat. Diabetologia 2001, 44, 889–897. [Google Scholar] [CrossRef] [PubMed]
- Brunskill, N.J. C-peptide and diabetic kidney disease. J. Intern. Med. 2016, 281, 41–51. [Google Scholar] [CrossRef] [Green Version]
- Shaw, J.A.; Shetty, P.; Burns, K.D.; Fergusson, D.; Knoll, G.A. C-peptide as a Therapy for Kidney Disease: A Systematic Review and Meta-Analysis. PLoS ONE 2015, 10, e0127439. [Google Scholar] [CrossRef] [Green Version]
- Clark, P.M. Assays for Insulin, Proinsulin(S) and C-Peptide. Ann. Clin. Biochem. Int. J. Lab. Med. 1999, 36, 541–564. [Google Scholar] [CrossRef] [Green Version]
- Leighton, E.; Sainsbury, C.A.; Jones, G.C. A Practical Review of C-Peptide Testing in Diabetes. Diabetes Ther. 2017, 8, 475–487. [Google Scholar] [CrossRef] [Green Version]
- Lavallard, V.; Berney, T.; Morel, P.; Rouget, C.; Bosco, D.; Parnaud, G. Impact of Immunosuppressive Drugs on Rat Beta Cell Proliferation. CellR4 2014, 2, e1109. [Google Scholar]
- Krautz, C.; Wolk, S.; Steffen, A.; Knoch, K.-P.; Ceglarek, U.; Thiery, J.; Bornstein, S.; Saeger, H.-D.; Solimena, M.; Kersting, S. Effects of immunosuppression on alpha and beta cell renewal in transplanted mouse islets. Diabetologia 2013, 56, 1596–1604. [Google Scholar] [CrossRef]
- Shapiro, A.J.; Lakey, J.R.; Ryan, E.A.; Korbutt, G.S.; Toth, E.; Warnock, G.L.; Kneteman, N.M.; Rajotte, R.V. Islet Transplantation in Seven Patients with Type 1 Diabetes Mellitus Using a Glucocorticoid-Free Immunosuppressive Regimen. N. Engl. J. Med. 2000, 343, 230–238. [Google Scholar] [CrossRef]
- Inoue, R.; Nishiyama, K.; Li, J.; Miyashita, D.; Ono, M.; Terauchi, Y.; Shirakawa, J. The Feasibility and Applicability of Stem Cell Therapy for the Cure of Type 1 Diabetes. Cells 2021, 10, 1589. [Google Scholar] [CrossRef]
- Wang, X.; Maxwell, K.G.; Wang, K.; Bowers, D.T.; Flanders, J.A.; Liu, W.; Wang, L.-H.; Liu, Q.; Liu, C.; Naji, A.; et al. A nanofibrous encapsulation device for safe delivery of insulin-producing cells to treat type 1 diabetes. Sci. Transl. Med. 2021, 13, eabb4601. [Google Scholar] [CrossRef]
- Montanucci, P.; Pescara, T.; Greco, A.; Leonardi, G.; Marini, L.; Basta, G.; Calafiore, R. Co-microencapsulation of human umbilical cord-derived mesenchymal stem and pancreatic islet-derived insulin producing cells in experimental type 1 diabetes. Diabetes/Metab. Res. Rev. 2020, 37, e3372. [Google Scholar] [CrossRef]
- Ernst, A.U.; Bowers, D.T.; Wang, L.-H.; Shariati, K.; Plesser, M.D.; Brown, N.K.; Mehrabyan, T.; Ma, M. Nanotechnology in cell replacement therapies for type 1 diabetes. Adv. Drug Deliv. Rev. 2019, 139, 116–138. [Google Scholar] [CrossRef]
- Lee, S.H.; Kim, H.O.; Kang, J.T. Optimization of Nano-encapsulation on Neonatal Porcine Islet-like Cell Clusters Using Polymersomes. Nanoscale Res. Lett. 2021, 16, 1–11. [Google Scholar] [CrossRef]
- Chen, S.; Du, K.; Zou, C. Current progress in stem cell therapy for type 1 diabetes mellitus. Stem Cell Res. Ther. 2020, 11, 1–13. [Google Scholar] [CrossRef]
- Park, Y.M.; Lee, M.; Jeon, S.; Hrůzová, D. In vitro effects of conditioned medium from bioreactor cultured human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) on skin-derived cell lines. Regen. Ther. 2021, 18, 281–291. [Google Scholar] [CrossRef]
- Tomar, G.B.; Srivastava, R.K.; Gupta, N.; Barhanpurkar, A.P.; Pote, S.T.; Jhaveri, H.M.; Mishra, G.C.; Wani, M.R. Human gingiva-derived mesenchymal stem cells are superior to bone marrow-derived mesenchymal stem cells for cell therapy in regenerative medicine. Biochem. Biophys. Res. Commun. 2010, 393, 377–383. [Google Scholar] [CrossRef]
- Kim, S.-Y.; Kim, Y.-R.; Park, W.-J.; Kim, H.S.; Jung, S.-C.; Woo, S.-Y.; Jo, I.; Ryu, K.-H.; Park, J.-W. Characterisation of insulin-producing cells differentiated from tonsil derived mesenchymal stem cells. Differentiation 2015, 90, 27–39. [Google Scholar] [CrossRef]
- NIH CIT Consortium Chemistry Manufacturing Controls Monitoring Committee; NIH CIT Consortium. Purified Human Pancreatic Islet: Qualitative and Quantitative Assessment of Islets Using Dithizone (DTZ): Standard Operating Procedure of the NIH Clinical Islet Transplantation Consortium. CellR4 Repair Replace Regen Reprogram 2015, 3, e1369. [Google Scholar] [CrossRef]
- Ricordi, C. Pancreatic Islet Cell Transplantation; R.G. Landes Company: Austin, TX, USA, 1992; pp. 137–138. [Google Scholar]
- Yaochite, J.N.U.; de Lima, K.W.A.; Caliari-Oliveira, C.; Palma, P.V.B.; Couri, C.E.B.; Simões, B.P.; Covas, D.T.; Voltarelli, J.C.; Oliveira, M.C.; Donadi, E.A.; et al. Multipotent mesenchymal stromal cells from patients with newly diagnosed type 1 diabetes mellitus exhibit preserved in vitro and in vivo immunomodulatory properties. Stem Cell Res. Ther. 2016, 7, 1–16. [Google Scholar] [CrossRef] [Green Version]
- King, A.J. The use of animal models in diabetes research. J. Cereb. Blood Flow Metab. 2012, 166, 877–894. [Google Scholar] [CrossRef] [Green Version]
- Zhu, F.; Sun, B.; Wen, Y.; Wang, Z.; Pera, R.R.; Chen, B. A Modified Method for Implantation of Pluripotent Stem Cells Under the Rodent Kidney Capsule. Stem Cells Dev. 2014, 23, 2119–2125. [Google Scholar] [CrossRef] [Green Version]
- Yin, Y.; Hao, H.; Cheng, Y.; Zang, L.; Liu, J.; Gao, J.; Xue, J.; Xie, Z.; Zhang, Q.; Han, W.; et al. Human umbilical cord-derived mesenchymal stem cells direct macrophage polarization to alleviate pancreatic islets dysfunction in type 2 diabetic mice. Cell Death Dis. 2018, 9, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Gao, J.; Cheng, Y.; Hao, H.; Yin, Y.; Xue, J.; Zhang, Q.; Li, L.; Liu, J.; Xie, Z.; Yu, S.; et al. Decitabine assists umbilical cord-derived mesenchymal stem cells in improving glucose homeostasis by modulating macrophage polarization in type 2 diabetic mice. Stem Cell Res. Ther. 2019, 10, 1–15. [Google Scholar] [CrossRef] [Green Version]
Islet Diameter Range (μm) | Islet Particle Number (AI) | IEQ Conversion Factor | IEQ Range |
---|---|---|---|
50–100 | ×0.167 | Islet Diameter Range × AI × IEQ Conversion Factor | |
>100–150 | ×0.667 | ||
>150–200 | ×1.685 | ||
>200–250 | ×3.500 | ||
>250–300 | ×6.315 | ||
>300–350 | ×10.352 | ||
>350 | ×15.833 | ||
ΣAI | ΣIEQ | ||
Total AI = ΣAI × Dilution Factor | |||
Total IEQ = ΣIEQ (AI in each diameter) × Dilution Factor x |
Gene | Primer Sequence (Forward) | Primer Sequence (Reverse) | bp |
---|---|---|---|
NGN3 | CGTGAACTCCTTGAACTGAGCAG | TGGCACTCCTGGGACAGATTTC | 211 |
NEUROD | GAAAGCCCTCTGACTGAT | AAACTGGCGTGCCTCTAA | 314 |
INS | CAGCCGCAGCCTTTGTGAAC | CAGGCTGCCTGCACCAGGG | 170 |
MAFA | CTTCAGCAAGGAGGAGGTCATC | CTCGTATTTCTCCTTGTACAGGTCC | 208 |
GLUT2 | GCTACCGACAGCCTATTCTA | CAAGTCCCACTGACATGAAG | 267 |
SST | CGTCAGTTTCTGCAGAAGTCC | CCATAGCCGGGTTTGAGTTA | 196 |
GAPDH | AGCCACATCGCTCAGACACC | GTACTCAGCGGCCAGCATCG | 303 |
Component | Final Concentration (mM) |
---|---|
NaCl | 119 |
KCl | 474 |
CaCl2 | 2.54 |
MgCl2 | 1.19 |
KH2PO4 | 1.19 |
NaHCO3 | 25 |
HEPES | 10 |
Groups | |
---|---|
G1 | Normal control |
G2 | T1D (STZ induction) |
G3 | T1D (STZ induction) with hUC-MSCs (1 × 106) |
G4 | T1D (STZ induction) with hUC-IPCs (5000 IEQ) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, Y.M.; Yang, C.M.; Cho, H.Y. Therapeutic Effects of Insulin-Producing Human Umbilical Cord-Derived Mesenchymal Stem Cells in a Type 1 Diabetes Mouse Model. Int. J. Mol. Sci. 2022, 23, 6877. https://doi.org/10.3390/ijms23136877
Park YM, Yang CM, Cho HY. Therapeutic Effects of Insulin-Producing Human Umbilical Cord-Derived Mesenchymal Stem Cells in a Type 1 Diabetes Mouse Model. International Journal of Molecular Sciences. 2022; 23(13):6877. https://doi.org/10.3390/ijms23136877
Chicago/Turabian StylePark, Yu Mi, Chang Mo Yang, and Hee Yeon Cho. 2022. "Therapeutic Effects of Insulin-Producing Human Umbilical Cord-Derived Mesenchymal Stem Cells in a Type 1 Diabetes Mouse Model" International Journal of Molecular Sciences 23, no. 13: 6877. https://doi.org/10.3390/ijms23136877