A Novel PTP1B Inhibitor-Phosphate of Polymannuronic Acid Ameliorates Insulin Resistance by Regulating IRS-1/Akt Signaling
Abstract
:1. Introduction
2. Results and Discussion
2.1. Chemical Profile of LPMP
2.2. Binding of LPMP in the Active Site of PTP1B
2.3. Effect of Cell Permeability and Intracellular Enzyme Activity
2.4. Effect of Sodium Palmitate (PA) and LPMP on the Viability of HepG2 Cells
2.5. LPMP Increases Insulin Sensitivity in HepG2 Cells
2.6. LPMP Alleviates Insulin Resistance by Activating Insulin Signaling Pathways
2.7. LPMP Improves Cellular Oxidative Stress Levels
2.8. LPMP Alleviates Endoplasmic Reticulum (ER) Stress Levels
2.9. Effect of LPMP on Blood Glucose and Insulin Sensitivity in T2DM Mice
2.10. Protective Effect of LPMP on the Liver of T2DM Mice
3. Conclusions
4. Materials and Methods
4.1. Preparation of LPMP Labeled with FITC
4.2. Analytical Methods of LPMP
4.3. Enzyme Activity Inhibition and Kinetics Assay In Vitro
4.4. Surface Plasmon Resonance Assay
4.5. Molecular Docking of LPMP at the PTP1B Binding Site
4.6. Cell Culture and Insulin Resistance Model Construction
4.7. Cell Permeability Assay
4.8. Cell Viability Assessment
4.9. Glucose Consumption Assay and Insulin Sensitivity Assays
4.10. Measurement of Intracellular Reactive Oxygen Species Levels
4.11. Determination of Triglycerides (TG), Superoxide Dismutase (SOD), and Malonaldehyde (MDA) Content in HepG2 Cells
4.12. Protein Preparation and Western Blot Assay
4.13. Total RNA Isolation and Quantitative Real-Time RT-PCR Assay
4.14. Animal Experiments
4.15. Biochemical Assays
4.16. Histopathological Analysis
4.17. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cho, N.; Shaw, J.E.; Karuranga, S.; Huang, Y.D.; da Rocha Fernandes, J.D.; Ohlrogge, A.W.; Malanda, B. IDF Diabetes Atlas: Global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res. Clin. Pract. 2018, 138, 271–281. [Google Scholar] [CrossRef] [PubMed]
- Kahn, S.; Hull, R.; Utzschneider, K. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 2006, 444, 840–846. [Google Scholar] [CrossRef]
- Sun, X.J.; Miralpeix, M.; Myers, M.G.; Glasheen, E.M.; Backer, J.M.; Kahn, C.R.; White, M.F. Expression and function of IRS-1 in insulin signal transmission. J. Biol. Chem. 1992, 267, 22662–22672. [Google Scholar] [CrossRef]
- Honma, M.; Sawada, S.; Ueno, Y.; Murakami, K.; Yamada, T.; Gao, J.; Kodama, S.; Izumi, T.; Takahashi, K.; Tsukita, S.; et al. Selective insulin resistance with differential expressions of IRS-1 and IRS-2 in human NAFLD livers. Int. J. Obes. 2018, 42, 1544–1555. [Google Scholar] [CrossRef] [Green Version]
- Molinaro, A.; Becattini, B.; Mazzoli, A.; Bleve, A.; Radici, L.; Maxvall, I.; Sopasakis, V.R.; Molinaro, A.; Backhed, F.; Solinas, G. Insulin-Driven PI3K-AKT Signaling in the Hepatocyte Is Mediated by Redundant PI3Kalpha and PI3Kbeta Activities and Is Promoted by RAS. Cell Metab. 2019, 29, 1400–1409.e5. [Google Scholar] [CrossRef] [PubMed]
- Johnson, T.O.; Ermolieff, J.; Jirousek, M.R. Protein tyrosine phosphatase 1B inhibitors for diabetes. Nat. Rev. Drug Discov. 2002, 1, 696–709. [Google Scholar] [CrossRef] [PubMed]
- Yaribeygi, H.; Sathyapalan, T.; Atkin, S.L.; Sahebkar, A. Molecular Mechanisms Linking Oxidative Stress and Diabetes Mellitus. Oxid. Med. Cell. Longev. 2020, 2020, 8609213. [Google Scholar] [CrossRef] [Green Version]
- Cang, X.; Wang, X.; Liu, P.; Wu, X.; Yan, J.; Chen, J.; Wu, G.; Jin, Y.; Xu, F.; Su, J.; et al. PINK1 alleviates palmitate induced insulin resistance in HepG2 cells by suppressing ROS mediated MAPK pathways. Biochem. Biophys. Res. Commun. 2016, 478, 431–438. [Google Scholar] [CrossRef]
- Găman, M.A.; Epîngeac, M.E.; Diaconu, C.C.; Găman, A.M. Evaluation of oxidative stress levels in obesity and diabetes by the free oxygen radical test and free oxygen radical defence assays and correlations with anthropometric and laboratory parameters. World J. Diabetes 2020, 11, 193–201. [Google Scholar] [CrossRef]
- Sarvani, C.; Sireesh, D.; Ramkumar, K.M. Unraveling the role of ER stress inhibitors in the context of metabolic diseases. Pharm. Res. 2017, 119, 412–421. [Google Scholar] [CrossRef]
- Ajoolabady, A.; Wang, S.; Kroemer, G.; Klionsky, D.J.; Uversky, V.N.; Sowers, J.R.; Aslkhodapasandhokmabad, H.; Bi, Y.; Ge, J.; Ren, J. ER stress in Cardiometabolic Diseases: From Molecular Mechanisms to Therapeutics. Endocr. Rev. 2021, 42, 839–871. [Google Scholar] [CrossRef] [PubMed]
- Özcan, U.; Cao, Q.; Yilmaz, E.; Lee, A.H.; Iwakoshi, N.N.; Özdelen, E.; Tuncman, G.; Görgün, C.; Glimcher, L.H.; Hotamisligil, G.S. Endoplasmic Reticulum Stress Links Obesity, Insulin Action, and Type 2 Diabetes. Science 2004, 306, 457–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dube, N.; Tremblay, M.L. Involvement of the small protein tyrosine phosphatases TC-PTP and PTP1B in signal transduction and diseases: From diabetes, obesity to cell cycle, and cancer. Biochim. Biophys. Acta 2005, 1754, 108–117. [Google Scholar] [CrossRef] [PubMed]
- Stuible, M.; Tremblay, M.L. In control at the ER: PTP1B and the down-regulation of RTKs by dephosphorylation and endocytosis. Trends Cell Biol. 2010, 20, 672–679. [Google Scholar] [CrossRef] [PubMed]
- Yudushkin, I.A.; Schleifenbaum, A.; Kinkhabwala, A.; Neel, B.G.; Schultz, C.; Bastiaens, P.I. Live-Cell Imaging of Enzyme-Substrate Interaction Reveals Spatial Regulation of PTP1B. Science 2007, 315, 115–119. [Google Scholar] [CrossRef]
- Haj, F.; Verveer, P.; Squire, A.; Neel, B.; Bastiaens, P. Imaging Sites of Receptor Dephosphorylation by PTP1B on the Surface of the Endoplasmic Reticulum. Science 2002, 295, 1708–1711. [Google Scholar] [CrossRef]
- Salmeen, A.; Andersen, J.N.; Myers, M.P.; Tonks, N.K.; Barford, D. Molecular Basis for the Dephosphorylation of the Activation Segment of the Insulin Receptor by Protein Tyrosine Phosphatase 1B. Mol. Cell 2000, 6, 1401–1412. [Google Scholar] [CrossRef]
- Elchebly, M.; Payette, P.; Michaliszyn, E.; Cromlish, W.; Collins, S.; Loy, A.L.; Normandin, D.; Cheng, A.; Himms-Hagen, J.; Chan, C.C.; et al. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 1999, 283, 1544–1548. [Google Scholar] [CrossRef]
- Van Huijsduijnen, R.H.; Bombrun, A.; Swinnen, D. Selecting protein tyrosine phosphatases as drug targets. Drug Discov. Today 2002, 7, 1013–1019. [Google Scholar] [CrossRef]
- Park, H.; Bhattarai, B.R.; Ham, S.W.; Cho, H. Structure-based virtual screening approach to identify novel classes of PTP1B inhibitors. Eur. J. Med. Chem. 2009, 44, 3280–3284. [Google Scholar] [CrossRef]
- Combs, A.P. Recent advances in the discovery of competitive protein tyrosine phosphatase 1B inhibitors for the treatment of diabetes, obesity, and cancer. J. Med. Chem. 2010, 53, 2333–2344. [Google Scholar] [CrossRef]
- Panikkar, R.; Brasch, D.J. Composition and block structure of alginates from New Zealand brown seaweeds. Carbohydr. Res. 1996, 293, 119–132. [Google Scholar] [CrossRef]
- Haug, A.; Larsen, B.; Smidsrod, O.; Møller, J.; Brunvoll, J.; Bunnenberg, E.; Djerassi, C.; Records, R. A Study of the Constitution of Alginic Acid by Partial Acid Hydrolysis. Acta Chem. Scand. 1996, 20, 183–190. [Google Scholar] [CrossRef]
- Heyraud, A.; Gey, C.; Leonard, C.; Rochas, C.; Girond, S.; Kloareg, B. NMR spectroscopy analysis of oligoguluronates and oligomannuronates prepared by acid or enzymatic hydrolysis of homopolymeric blocks of alginic acid. Application to the determination of the substrate specificity of Haliotis tuberculata alginate lyase. Carbohydr. Res. 1996, 289, 11–23. [Google Scholar] [CrossRef]
- Fan, Y.; Li, Y.; Zhang, J.; Ding, X.; Cui, J.; Wang, G.; Wang, Z.; Wang, L. Alginate Enhances Memory Properties of Antitumor CD8+ T Cells by Promoting Cellular Antioxidation. ACS Biomater. Sci. Eng. 2019, 5, 4717–4725. [Google Scholar] [CrossRef]
- Son, E.W.; Rhee, D.K.; Pyo, S. Antiviral and tumoricidal activities of alginate-stimulated macrophages are mediated by different mechanisms. Arch. Pharm. Res. 2003, 26, 960–966. [Google Scholar] [CrossRef]
- Meng, X.; Li, T.; Song, T.; Chen, C.; Venkitasamy, C.; Pan, Z.; Zhang, H. Solubility, structural properties, and immunomodulatory activities of rice dreg protein modified with sodium alginate under microwave heating. Food Sci. Nutr. 2019, 7, 2556–2564. [Google Scholar] [CrossRef] [Green Version]
- Xing, M.; Cao, Q.; Wang, Y.; Xiao, H.; Zhao, J.; Zhang, Q.; Ji, A.; Song, S. Advances in Research on the Bioactivity of Alginate Oligosaccharides. Mar. Drugs 2020, 18, 144. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.H.; Bang, M.A.; Jang, C.H.; Jo, G.H.; Jung, S.K.; Ki, S.H. Alginate oligosaccharide enhances LDL uptake via regulation of LDLR and PCSK9 expression. J. Nutr. Biochem. 2015, 26, 1393–1400. [Google Scholar] [CrossRef]
- Zheng, J.; Li, H.; Zhang, X.; Jiang, M.; Luo, C.; Lu, Z.; Xu, Z.; Shi, J. Prebiotic Mannan-Oligosaccharides Augment the Hypoglycemic Effects of Metformin in Correlation with Modulating Gut Microbiota. J. Agric. Food Chem. 2018, 66, 5821–5831. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, X.; Wang, S.; Li, H.; Lu, Z.; Shi, J.; Xu, Z. Mannan-oligosaccharide modulates the obesity and gut microbiota in high-fat diet-fed mice. Food Funct. 2018, 9, 3916–3929. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, L.; Ye, C.; Yuan, J.; Qin, S. Alginate oligosaccharide improves lipid metabolism and inflammation by modulating gut microbiota in high-fat diet fed mice. Appl. Microbiol. Biotechnol. 2020, 104, 3541–3554. [Google Scholar] [CrossRef] [PubMed]
- Bi, D.; Xiao, S.; Lin, Z.; Yao, L.; Fang, W.; Wu, Y.; Xu, H.; Lu, J.; Xu, X. Alginate-Derived Mannuronate Oligosaccharide Attenuates Tauopathy through Enhancing Autophagy. J. Agric. Food Chem. 2021, 69, 4438–4445. [Google Scholar] [CrossRef] [PubMed]
- Shafiq, S. Genetic, structural and pharmacological characterization of polymannuronate synthesized by algG mutant indigenous soil bacterium Pseudomonas aeruginosa CMG1421. J. Appl. Microbiol. 2019, 126, 113–126. [Google Scholar] [CrossRef]
- Li, Q.; Zeng, Y.; Wang, L.; Guan, H.; Li, C.; Zhang, L. The heparin-like activities of negatively charged derivatives of low-molecular-weight polymannuronate and polyguluronate. Carbohydr. Polym. 2017, 155, 313–320. [Google Scholar] [CrossRef]
- Coleman, R.J.; Lawrie, G.; Lambert, L.K.; Whittaker, M.; Jack, K.S.; Grondahl, L. Phosphorylation of alginate: Synthesis, characterization, and evaluation of in vitro mineralization capacity. Biomacromolecules 2011, 12, 889–897. [Google Scholar] [CrossRef]
- Liu, G.X.; Tan, J.Z.; Niu, C.Y.; Shen, J.H.; Luo, X.M.; Shen, X.; Chen, K.X.; Jiang, H.L. Molecular dynamics simulations of interaction between protein-tyrosine phosphatase 1B and a bidentate inhibitor. Acta Pharm. Sin. 2006, 27, 100–110. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Liu, X.; Gan, Q.; Feng, C.; Zhang, Q. Molecular Dynamics Simulations of A27S and K120A Mutated PTP1B Reveals Selective Binding of the Bidentate Inhibitor. Biomed. Res. Int. 2019, 2019, 9852897. [Google Scholar] [CrossRef]
- Peters, G.H.; Iversen, L.F.; Andersen, H.S.; Møller, N.P.H.; Olsen, O.H. Residue 259 in protein-tyrosine phosphatase PTP1B and PTPalpha determines the flexibility of glutamine 262. Biochemistry 2004, 43, 8418–8428. [Google Scholar] [CrossRef]
- Stuible, M.; Doody, K.M.; Tremblay, M.L. PTP1B and TC-PTP: Regulators of transformation and tumorigenesis. Cancer Metastasis Rev. 2008, 27, 215–230. [Google Scholar] [CrossRef]
- Li, X.; Wang, L.; Shi, D. The design strategy of selective PTP1B inhibitors over TCPTP. Bioorg. Med. Chem. 2016, 24, 3343–3352. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Luo, J.; Wu, N.; Zhang, R.; Shi, D. BPN, a marine-derived PTP1B inhibitor, activates insulin signaling and improves insulin resistance in C2C12 myotubes. Int. J. Biol. Macromol. 2018, 106, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Jiang, H.; Zhang, N.; Cai, C.; Li, G.; Hao, J.; Yu, G. Anti-diabetic activities of agaropectin-derived oligosaccharides from Gloiopeltis furcata via regulation of mitochondrial function. Carbohydr. Polym. 2020, 229, 115482. [Google Scholar] [CrossRef] [PubMed]
- Arner, P.; Rydén, M. Fatty Acids, Obesity and Insulin Resistance. Obes. Facts 2015, 8, 147–155. [Google Scholar] [CrossRef]
- Boden, G.; Shulman, G.I. Free fatty acids in obesity and type 2 diabetes: Defining their role in the development of insulin resistance and beta-cell dysfunction. Eur. J. Clin. Investig. 2002, 32, 14–23. [Google Scholar] [CrossRef]
- Bakhtiyari, S.; Meshkani, R.; Taghikhani, M.; Larijani, B.; Adeli, K. Protein tyrosine phosphatase-1B (PTP-1B) knockdown improves palmitate-induced insulin resistance in C2C12 skeletal muscle cells. Lipids 2010, 45, 237–244. [Google Scholar] [CrossRef]
- Khamzina, L.; Gruppuso, P.A.; Wands, J.R. Insulin signaling through insulin receptor substrate 1 and 2 in normal liver development. Gastroenterology 2003, 125, 572–585. [Google Scholar] [CrossRef]
- Matsuda, M.; Shimomura, I. Increased oxidative stress in obesity: Implications for metabolic syndrome, diabetes, hypertension, dyslipidemia, atherosclerosis, and cancer. Obes. Res. Clin. Pract. 2013, 7, e330–e341. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Branicky, R.; Noe, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef]
- Bacanlı, M.; Anlar, H.G.; Aydın, S.; Çal, T.; Arı, N.; Bucurgat, Ü.Ü.; Başaran, A.A.; Başaran, N. D-limonene ameliorates diabetes and its complications in streptozotocin-induced diabetic rats. Food Chem. Toxicol. 2017, 110, 434–442. [Google Scholar] [CrossRef]
- Hirosumi, J.; Tuncman, G.; Chang, L.; Görgün, C.Z.; Uysal, K.T.; Maeda, K.; Hotamisligil, G.S. A central role for JNK in obesity and insulin resistance. Nature 2002, 420, 333–336. [Google Scholar] [CrossRef] [PubMed]
- Ha, S.Y.; Qiu, X.M.; Lai, Z.Z.; Yang, H.L.; Wang, Y.; Ruan, L.Y.; Shi, J.W.; Zhu, X.Y.; Li, D.J.; Li, M.Q. Excess palmitate induces decidual stromal cell apoptosis via the TLR4/JNK/NF-kB pathways and possibly through glutamine oxidation. Mol. Hum. Reprod. 2020, 26, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Sadeghi, A.; Rostamirad, A.; Seyyedebrahimi, S.; Meshkani, R. Curcumin ameliorates palmitate-induced inflammation in skeletal muscle cells by regulating JNK/NF-kB pathway and ROS production. Inflammopharmacology 2018, 26, 1265–1272. [Google Scholar] [CrossRef]
- Nakatani, Y.; Kaneto, H.; Kawamori, D.; Hatazaki, M.; Miyatsuka, T.; Matsuoka, T.A.; Kajimoto, Y.; Matsuhisa, M.; Yamasaki, Y.; Hori, M. Modulation of the JNK pathway in liver affects insulin resistance status. J. Biol. Chem. 2004, 279, 45803–45809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, S.; Messina, J.L. Role of inhibitory kappaB kinase and c-Jun NH2-terminal kinase in the development of hepatic insulin resistance in critical illness diabetes. Am. J. Physiol.-Gastrointest. Liver Physiol. 2011, 301, 454–463. [Google Scholar] [CrossRef] [Green Version]
- Cai, D.; Yuan, M.; Frantz, D.F.; Melendez, P.A.; Hansen, L.; Lee, J.; Shoelson, S.E. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat. Med. 2005, 11, 183–190. [Google Scholar] [CrossRef]
- Barma, P.; Bhattacharya, S.; Bhattacharya, A.; Kundu, R.; Dasgupta, S.; Biswas, A.; Bhattacharya, S.; Roy, S.S.; Bhattacharya, S. Lipid induced overexpression of NF-kappaB in skeletal muscle cells is linked to insulin resistance. Biochim. Biophys. Acta 2009, 1792, 190–200. [Google Scholar] [CrossRef] [Green Version]
- Cao, J.; Dai, D.L.; Yao, L.; Yu, H.H.; Ning, B.; Zhang, Q.; Chen, J.; Cheng, W.H.; Shen, W.; Yang, Z.X. Saturated fatty acid induction of endoplasmic reticulum stress and apoptosis in human liver cells via the PERK/ATF4/CHOP signaling pathway. Mol. Cell Biochem. 2012, 364, 115–129. [Google Scholar] [CrossRef]
- Kim, D.S.; Jeong, S.K.; Kim, H.R.; Kim, D.S.; Chae, S.W.; Chae, H.J. Metformin regulates palmitate-induced apoptosis and ER stress response in HepG2 liver cells. Immunopharmacol. Immunotoxicol. 2010, 32, 251–257. [Google Scholar] [CrossRef]
- Wang, Y.; Liang, K.; Kong, W. Intestinal Trefoil Factor 3 Alleviates the Intestinal Barrier Function Through Reducing the Expression of TLR4 in Rats with Nonalcoholic Steatohepatitis. Arch. Med. Res. 2019, 50, 2–9. [Google Scholar] [CrossRef]
- Egbuna, C.; Awuchi, C.G.; Kushwaha, G.; Rudrapal, M.; Patrick-Iwuanyanwu, K.C.; Singh, O.; Odoh, U.E.; Khan, J.; Jeevanandam, J.; Kumarasamy, S.; et al. Bioactive Compounds Effective Against Type 2 Diabetes Mellitus: A Systematic Review. Curr. Top. Med. Chem. 2021, 21, 1067–1095. [Google Scholar] [CrossRef]
- Li, Q.; Li, C.; Yang, C.; Liu, C.; Yu, G.; Guan, H. Preparation, characterization and antioxidant activities of polymannuronic acid phosphate, H-phosphonate and sulfate. Int. J. Biol. Macromol. 2013, 62, 281–286. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Zhao, X.; Li, J.; Jiang, H.; Shan, X.; Wang, Y.; Ma, W.; Hao, J.; Yu, G. A beta-glucan from Durvillaea Antarctica has immunomodulatory effects on RAW264.7 macrophages via toll-like receptor 4. Carbohydr. Polym. 2018, 191, 255–265. [Google Scholar] [CrossRef] [PubMed]
- Harris, W.D.; Popat, P. Determination of the phosphorus content of lipids. J. Am. Oil Chem. Soc. 1954, 31, 124–127. [Google Scholar] [CrossRef]
- Lee, J.Y.; Cho, H.K.; Kwon, Y.H. Palmitate induces insulin resistance without significant intracellular triglyceride accumulation in HepG2 cells. Metabolism 2010, 59, 927–934. [Google Scholar] [CrossRef]
- Ishii, M.; Maeda, A.; Tani, S.; Akagawa, M. Palmitate induces insulin resistance in human HepG2 hepatocytes by enhancing ubiquitination and proteasomal degradation of key insulin signaling molecules. Arch. Biochem. Biophys. 2015, 566, 26–35. [Google Scholar] [CrossRef]
- Trinder, P. Determination of blood glucose using an oxidase-peroxidase system with a non-carcinogenic chromogen. J. Clin. Pathol. 1969, 22, 158–161. [Google Scholar] [CrossRef] [Green Version]
- Barham, D.; Trinder, P. An improved colour reagent for the determination of blood glucose by the oxidase system. Analyst 1972, 97, 142–145. [Google Scholar] [CrossRef]
- Lu, X.; Geng, J.; Zhang, J.; Miao, J.; Liu, M. Xanthohumol, a Prenylated Flavonoid from Hops, Induces Caspase-Dependent Degradation of Oncoprotein BCR-ABL in K562 Cells. Antioxidants 2019, 8, 402. [Google Scholar] [CrossRef] [Green Version]
- Du, J.; Zhao, Y.T.; Wang, H.; Zhang, L.X.; Qin, G.; Zhuang, S.; Kadin, M.; Chin, Y.E.; Liu, P.Y.; Zhao, T.C. The Essential Role of PRAK in Preserving Cardiac Function and Insulin Resistance in High-Fat Diet-Induced Diabetes. Int. J. Mol. Sci. 2021, 22, 7995. [Google Scholar] [CrossRef]
Sample | NMR Data (ppm) | |||||||
---|---|---|---|---|---|---|---|---|
C1 | C2 | C3 | C4 | C5 | C6 | C3-P | C2-P | |
LPM | 99.91 | 69.92 | 71.30 | 77.76 | 75.77 | 175.15 | / | / |
LPMP | 100.05 | 69.94 | 71.15 | 77.63 | 75.84 | 175.18 173.00 | 73.76 | 74.83 |
Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
CHOP | GGAAACAGAGTGGTCATTCCC | CTGCTTGAGCCGTTCATTCTC |
ATF4 | TCCCATCTCCAGGTGTTCTC | CAGCTCTTTGCACTCACCAG |
PTPN1 | AGCCAGTGACTTCCCATGTAG | TGTTGAGCATGACGACACCC |
Xbp1s | CTGAGTCCGCAGCAGGTG | GTCCAGAATGCCCAACAGGA |
Xbp1u | CGGAAGCCAAGGGGAATGAA | TGTTCTGGAGGGGTGACAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, D.; Zhang, S.; Yang, C.; Li, Q.; Wang, S.; Xu, X.; Hao, J.; Li, C. A Novel PTP1B Inhibitor-Phosphate of Polymannuronic Acid Ameliorates Insulin Resistance by Regulating IRS-1/Akt Signaling. Int. J. Mol. Sci. 2021, 22, 12693. https://doi.org/10.3390/ijms222312693
Li D, Zhang S, Yang C, Li Q, Wang S, Xu X, Hao J, Li C. A Novel PTP1B Inhibitor-Phosphate of Polymannuronic Acid Ameliorates Insulin Resistance by Regulating IRS-1/Akt Signaling. International Journal of Molecular Sciences. 2021; 22(23):12693. https://doi.org/10.3390/ijms222312693
Chicago/Turabian StyleLi, Dan, Shuai Zhang, Cheng Yang, Quancai Li, Shixin Wang, Ximing Xu, Jiejie Hao, and Chunxia Li. 2021. "A Novel PTP1B Inhibitor-Phosphate of Polymannuronic Acid Ameliorates Insulin Resistance by Regulating IRS-1/Akt Signaling" International Journal of Molecular Sciences 22, no. 23: 12693. https://doi.org/10.3390/ijms222312693