Next Article in Journal
Novel Nested-Seq Approach for SARS-CoV-2 Real-Time Epidemiology and In-Depth Mutational Profiling in Wastewater
Next Article in Special Issue
The Bul1/2 Alpha-Arrestins Promote Ubiquitylation and Endocytosis of the Can1 Permease upon Cycloheximide-Induced TORC1-Hyperactivation
Previous Article in Journal
Mitochondrial Carriers and Substrates Transport Network: A Lesson from Saccharomyces cerevisiae
Previous Article in Special Issue
Heterodimer Formation of the Homodimeric ABC Transporter OpuA
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 22
Issue 16
10.3390/ijms22168497
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat

by
Qing Chen
1,2,†,
Lu Lei
2,†,
Caihong Liu
2,
Yazhou Zhang
2,
Qiang Xu
2,
Jing Zhu
2,
Zhenru Guo
2,
Yan Wang
2,
Qingcheng Li
2,
Yang Li
2,
Li Kong
2,
Yunfeng Jiang
2,
Xiujin Lan
2,
Jirui Wang
1,2,
Qiantao Jiang
2,
Guoyue Chen
1,2,
Jian Ma
2,
Yuming Wei
1,2,
Youliang Zheng
2 and
Pengfei Qi
2,*
1
State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Chengdu 611130, China
2
Triticeae Research Institute, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
†
Contributed equally to this paper.
Int. J. Mol. Sci. 2021, 22(16), 8497; https://doi.org/10.3390/ijms22168497
Submission received: 18 July 2021 / Revised: 3 August 2021 / Accepted: 4 August 2021 / Published: 7 August 2021
(This article belongs to the Special Issue Transport Proteins for Microbial Adaptations 2.0)
Browse Figures
Versions Notes

Abstract

:
Wheat is a major staple food crop worldwide, due to its total yield and unique processing quality. Its grain yield and quality are threatened by Fusarium head blight (FHB), which is mainly caused by Fusarium graminearum. Salicylic acid (SA) has a strong and toxic effect on F. graminearum and is a hopeful target for sustainable control of FHB. F. graminearum is capable of efficientdealing with SA stress. However, the underlying mechanisms remain unclear. Here, we characterized FgMFS1 (FGSG_03725), a major facilitator superfamily (MFS) transporter gene in F. graminearum. FgMFS1 was highly expressed during infection and was upregulated by SA. The predicted three-dimensional structure of the FgMFS1 protein was consistent with the schematic for the antiporter. The subcellular localization experiment indicated that FgMFS1 was usually expressed in the vacuole of hyphae, but was alternatively distributed in the cell membrane under SA treatment, indicating an element of F. graminearum in response to SA. ΔFgMFS1 (loss of function mutant of FgMFS1) showed enhanced sensitivity to SA, less pathogenicity towards wheat, and reduced DON production under SA stress. Re-introduction of a functional FgMFS1 gene into ∆FgMFS1 recovered the mutant phenotypes. Wheat spikes inoculated with ΔFgMFS1 accumulated more SA when compared to those inoculated with the wild-type strain. Ecotopic expression of FgMFS1 in yeast enhanced its tolerance to SA as expected, further demonstrating that FgMFS1 functions as an SA exporter. In conclusion, FgMFS1 encodes an SA exporter in F. graminearum, which is critical for its response to wheat endogenous SA and pathogenicity towards wheat.

1. Introduction

Wheat (Triticum aestivum) is a major staple food crop due to its total grain yield and unique processing quality. Fusarium graminearum is the major causal agent for Fusarium head blight (FHB), which seriously threatens wheat production [1]. FHB leads to yield loss, poor bread-making quality, and contamination of trichothecene mycotoxins (mainly deoxynivalenol (DON)) in grains [1,2,3]. The contaminated grains are proven to be unsuitable for human consumption and animal feed. In humans, trichothecene mycotoxins cause weight loss, diarrhea, hemorrhage, immunomodulation, emesis, and even death [4,5]. DON, a major virulence factor of F. graminearum during infection, is critical for its spread in spikes [6]. There is a great demand for FHB management to reduce its threat in Food and Agriculture.
Novel and sustainable strategies are strongly required for managing FHB. At present, chemical control, resistive breeding, and biological control are three main strategies to control FHB [7,8,9,10]. Nevertheless, these methods cannot control this disease well in the field under current conditions. Salicylic acid (SA) is a key phytohormone in wheat resistance against FHB [11,12,13,14]. F. graminearum infection in wheat heads can significantly increase the accumulation of SA [14], and SA signaling plays an important role in wheat FHB resistance [12,15]. Besides SA signaling, SA has a direct, strong, and toxic effect on conidial germination, mycelial growth, and DON production [13], partially because SA is capable of destroying the fungal cell membrane by reducing the expression level of FgLAI12 (a linoleic acid isomerase gene) and the inner cell wall by inhibiting the expression of FgCHS8 (a chitin synthase gene), which are required for the response of F. graminearum to environmental stresses, including SA [16,17]. It seems likely that SA is a hopeful and valuable target for sustainable control of FHB. Nevertheless, F. graminearum has an efficient system to deal with SA stress, including the capacity to metabolize and to export SA [13,18,19,20] and to strengthen the outer cell wall [21] (Figure 1). Considering the potential value of SA in designing a sustainable way of managing FHB, it is necessary to further elucidate the molecular mechanisms of F. graminearum in response to SA stress.
Transport systems play a critical role in the export of secondary metabolites and waste compounds during infection [22]. In fungi, ATP-binding cassette (ABC) and the major facilitator superfamily (MFS) transporter proteins are two main classes of transporters [22]. As a class of secondary active transporters, the MFS transporters couple the transportation of substrates to proton motive force generated across the cell membrane, rather than ATP hydrolysis, and play a crucial role in diverse physiological processes [23,24]. MFS transporters target a wide spectrum of substrates including lipids, ions, amino acids and peptides, carbohydrates, and nucleosides [25]. Members of this superfamily have been divided into 17 distinct families by phylogenic analysis [26] and into antiporters, uniporters, and symporters, which move substrates across the membranes via exchange, facilitated diffusion, and cotransport, respectively [27]. As one of the 17 families, DHA1 (drug: H+ antiporter-1) has 12-transmembrane-spanner (TMS), and members of this family are antiporters [26]. In Fusarium, the MFS transporter TRI12 is attributed to secrete trichothecene mycotoxins [28]; the MFS transporter gene (FIR1) is related to siderophore production [29]. It remains unclear whether any MFS transporter contributes F. graminearum to reduce the toxicity of SA during infection in wheat spikes.
We previously found that a candidate MFS transporter gene FGSG_03725 was upregulated by SA [13], which had a high expression level during the infection of F. graminearum in wheat spikes [30], indicating that it was involved in the mechanisms alleviating SA. Using the wild-type (WT) strain and the mutants, we determined the effects of FgMFS1 on mycelial growth, sensitivity to SA, DON production, SA accumulation in spikes, and visual FHB disease symptom. This research deepens our understanding of the mechanisms of F. graminearum in response to SA during the wheat/F. graminearum interaction and may provide key information for designing an efficient and sustainable strategy to control FHB by relying on wheat endogenous SA.

2. Results

2.1. Sequence Analysis

FgMFS1 (FGSG_03725) is 1926 bp in length with no intron, and its open reading frame (ORF) is 1809 bp. The deduced peptide has 602 residues and 12 transmembrane-spanners (TMS) (Figure 2). Phylogenic analysis demonstrates that FgMFS1 belongs to the cluster II of the DHA1 (drug: H+ antiporter-1) family (Figure 3). It suggests that when protons flow in, FgMFS1 can export its substrate.

2.2. Deletion and Complementation of FgMFS1 Gene in F. graminearum

The gene sequence of FgMFS1 was removed from the WT strain by homologous recombination (Figure 4A) to create the deletion mutants (ΔFgMFS1). PCR was used to screen the ΔFgMFS1 mutants to make sure that the construct had been recombined into the intended homologous site (Figure 4C). The ORF of FgMFS1 was randomly inserted into the genome of ΔFgMFS1 to create the complementation mutants (C-FgMFS1; Figure 4B). Reverse transcription (RT)-PCR showed that FgMFS1 was normally transcribed in C-FgMFS1 as in the WT strain, and no expression was detected in ΔFgMFS1 as expected (Figure 4D).

2.3. FgMFS1 Is Important for Fungal Response to SA

The expression of FgMFS1 was induced by SA (Figure 5D). Moreover, the ΔFgMFS1 strains were more sensitive to SA than the WT and C-FgMFS1 strains on mSNA (modified Synthetischer Nährstoffarmer Agar) plates supplemented with 0.9 mM SA (Figure 5A,B), indicating a key role of FgMFS1 in exporting SA in F. graminearum.
Subcellular localization experiment indicated that FgMFS1 was usually distributed in the vacuoles and alternatively located in the cell membrane under SA stress (Figure 5C).
To confirm its function, FgMFS1 was expressed in yeast (Saccharomyces cerevisiae) (S-FgMFS1). RT-PCR showed that FgMFS1 was normally expressed in S-FgMFS1 strains, and no expression was found in the WT yeast strain (S-WT) as expected (Figure 5E). The growth of S-WT was more sensitive to SA than that of S-FgMFS1 (Figure 5F–H). These data demonstrate that FgMFS1 plays a key role in the outward transport of SA.

2.4. FgMFS1 Affects Pathogenicity towards Wheat

The spikes point inoculated with ΔFgMFS1 showed fewer visual FHB disease symptoms (Figure 6A,B) and less fungal biomass (Figure 6C) compared to those point inoculated with WT and C-FgMFS1 on the 6th, 8th, and 10th dpi. The expression of FgMFS1 was significantly increased during infection (Figure 6D,E).
The effects of FgMFS1 on DON production were measured both in wheat spikes and in liquid media. ΔFgMFS1 produced much less DON in wheat spikes than WT and C-FgMFS1 (Figure 6F). In liquid media, the accumulation of DON was not affected by the FgMFS1 gene when there was no SA. Consistent with our previous result [13], SA significantly inhibited the production of DON. Notably, this inhibition was much stronger for ΔFgMFS1 than for the WT and C-FgMFS1 strains (Figure 6G).

2.5. Expression of FgMFS1 Affects the Accumulation of Phytohormones in Spikes

SA, jasmonic acid (JA), and indole acetic acid (IAA) participate in wheat resistance against F. graminearum [14,33]. To understand whether FgMFS1 affects the accumulation of these hormones, we compared the contents of SA, JA, and IAA in spikes inoculated with water (CK treatment), WT, and ΔFgMFS1, respectively (Figure 7). On the 1st dpi, the contents of SA, JA, and IAA were higher in spikes inoculated with WT and ΔFgMFS1 than those under CK treatment, although most comparisons were insignificant. Inconsistent with the fungal biomass data in Figure 6C, spikes inoculated with ΔFgMFS1 accumulated more SA, JA, and IAA than those inoculated with WT strain. On the 2nd dpi, the contents of these hormones showed similar changes to the 1st dpi.

3. Discussion

SA plays a critical role in wheat resistance against F. graminearum infection [12,13,14,19,34]. Nonexpresser of PR Genes 1 (NPR1) is an essential positive regulator of SA-induced pathogenesis-related gene expression and systemic acquired resistance [35]. Transgenic expression of NPR1 of Arabidopsis thaliana in wheat enhances its FHB resistance level [12]. SA significantly and directly inhibits spore germination, DON production, and mycelial growth of F. graminearum [13]. Furthermore, infection of wheat spikes with F. graminearum induced the accumulation of SA and the expression of SA-related genes [13,14]. These results strongly suggest that wheat endogenous SA can protect wheat from the infection of F. graminearum.
Due to the importance of SA in wheat resistance, F. graminearum has evolved a set of efficient gene tools to make sure that wheat endogenous SA content is below the toxicity threshold during infection (Figure 1). Unsurprisingly, treating wheat spikes with exogenous SA cannot improve wheat FHB resistance [13]. The MFS transporters are one of the largest groups of secondary active transporters conserved from bacteria to mammals, which can transport a broad range of substrates across biological membranes [25]. MFS transporters have been divided into uniporters, symporters, and antiporters, which move substrates across membranes via facilitated diffusion, co-transport, and exchange, respectively [27]. In this study, we characterized the MFS transporter gene FgMFS1 (FGSG_03725) in F. graminearum, which is induced by the defense hormone SA (Figure 5D) and highly expressed during infection in wheat spikes (Figure 6E). As one of the gene tools mentioned above, FgMFS1 functions as an antiporter (DHA1 family; Figure 3). Disruption of the FgMFS1 gene resulted in enhanced sensitivity to SA (Figure 5A), increased accumulation of SA (Figure 7A), less fungal biomass (Figure 6C), and fewer visual disease symptoms in wheat spikes (Figure 6A,B). The presence of FgMFS1 was critical for the outward transport of SA by F. graminearum under SA stress (Figure 5). Our results suggest that the manipulation of the expression level or activity of FgMFS1 would be a hopeful way to manage FHB disease.
FgABCC9 (FG05_07325) encodes an ABC-C (ATP-binding cassette transporter family C) transporter in F. graminearum, which is highly expressed during infection in wheat and is up-regulated by SA as well. FgABCC9 functions as an SA exporter and is localized in the cell membrane [18]. Microscopic observation indicated that FgMFS1 protein was usually expressed in the vacuoles of hyphae, and alternatively expressed in the cell membrane under SA stress (Figure 5C). It reflects an element of F. graminearum in response to SA synthesized by the host plant. FgMFS1 may usually transport other substrates from vacuoles to cytoplasm. When wheat spikes synthesize and release more SA after infection, F. graminearum begins to alter the expression level and the subcellular localization of FgMFS1 protein. Consequently, FgMFS1 and FgABCC9 [18] synergistically export SA to minimize the toxicity of SA.
We previously demonstrated that point inoculation of solution containing 1 × 103 conidia and 400 μM SA was sufficient to prevent disease in the susceptible common wheat cultivar Roblin [13]. Moreover, no mycelial growth was observed on mSNA plates supplemented with 3 mM SA. Therefore, SA is a valuable chemical target for obtaining wheat germplasms immune/highly resistant to FHB. Considering the redundancy and complicacy of the gene tools of F. graminearum in response to SA (Figure 1), host-induced silencing of multiple genes in Figure 1 is a candidate and ongoing strategy for managing FHB [36].

4. Materials and Methods

4.1. Materials and Growth Conditions

The F. graminearum virulent strain DAOM180378 (Canadian Fungal Culture Collection, AAFC, Ottawa, ON, Canada) that was highly virulent in wheat was used throughout. The common wheat cultivar “Roblin” that is susceptible to Fusarium head blight (FHB) was used for inoculation. Plants of Roblin were grown in a climate-controlled glasshouse under 12/12 h day/night cycles at 23/18 °C. Plants were watered as needed and fertilized before sowing with 15-15-15 (N-P-K).
Conidia were produced in carboxymethyl cellulose liquid medium [37] at 28 °C, with shaking (180 rpm) for 5 d. The conidial concentration was measured with a hemocytometer by a microscope (BX63, Olympus, Tokyo, Japan). The effects of SA (sigma) on mycelial growth of F. graminearum were elevated on mSNA (modified Synthetischer Nährstoffarmer Agar; 1 g KH2PO4, 1 g KNO3, 0.5 g MgSO4, 0.5 g KCl, 1 g glucose, 1 g sucrose, and 20 g agar per L) plates. SA was supplemented after autoclaving. Mycelia were inoculated on each mSNA plate, which were maintained in darkness at 28 °C. There were five replicates for each treatment. The growing mycelia on mSNA plates were recorded by using the EPSON Perfection V700 Photo (Seiko Epson, Bekasi, Indonesia) on the 4th dpi. The diameters of mycelia was measured as [13].

4.2. Nucleic Acid Extraction and Sequence Analysis

Genomic DNA of F. graminearum was extracted from fresh mycelia cultured on potato dextrose agar plates at 28 °C for 5 d by the DNA extraction kit (Biofit, Chengdu, China). Total RNA was extracted from fresh mycelia and wheat samples by using the Total RNA extraction Kit (Biofit). RNA was reversely transcribed using PrimeScript™ RT Reagent Kit with genomic DNA Eraser (Takara, Dalian, China). The experiments were performed according to the manufacturer’s instructions.
Gene sequence of FgMFS1 (FGSG_03725) was downloaded from the Ensembl database (http://fungi.ensembl.org/index.html, accessed on 10/October/2019). The protein sequences of MFS transporters [26,38] were downloaded from the website of National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/, accessed on 29/June/2021). Prediction of transmembrane helices in FgMFS1 proteins were performed in TMHMM Server v.2.0 (http://www.cbs.dtu.dk/services/TMHMM/, accessed on 10/December/2019) (Figure 2A). The 3D-protein structure was predicted by using I-TASSER (https://zhanglab.ccmb.med.umich.edu/I-TASSER/, accessed on 15/December/2019) [39,40] and colored by Chimera software [41]. Neighbor-joining trees for the classification of MFS transporters were constructed by using MEGA version 5 [42] on the basis of a complete deletion of gaps and Poisson correction. A bootstrap test of phylogeny was performed with 10,000 replicates.

4.3. Preparation of ΔFgMFS1 and C-FgMFS1 Mutants

The pRF-HU2 vector [43] was used to remove the FgMFS1 gene from the genome of F. graminearum [18]. Transformation of F. graminearum by Agrobacterium tumefaciens was carried out as described previously [44].
The gene sequence of FgMFS1 was amplified by using the cDNA of F. graminearum and primer pair R-FgMFS1-F + R-FgMFS1-R. The cloned sequence of FgMFS1 was verified by sequencing, ligated into the pCAMBIA2301 vector (with green fluorescent protein gene (GFP) tag and 35S promoter), frozen thawed into the A. tumefaciens strain AGL-1 (Tiangen, Beijing, China), and transformed into ΔFgMFS1 to prepare the complementation mutants (C-FgMFS1). Primer Premier 5.0 (Premier Biosoft, Palo Alto, CA, USA) was used for designing PCR primers (Table 1). The restriction enzymes from New England Biolabs (Ipswich, MA, USA) were used for constructing vectors.

4.4. Subcellular Localization of FgMFS1

The C-FgMFS1 strains containing a GFP (green fluorescent protein) gene tag were used to determine the subcellular localization of the FgMFS1 protein in hyphae (Figure 5C). A Nikon-80i fluorescence microscope (Nikon, Tokyo, Japan) was used to detect the GFP fluorescence.
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerSequence (5′–3′)Source
FgMFS1-LB-FGCGGGCCCACGATGCCTCCACTGThis study
FgMFS1-LB -RGCGAGCTCTTGCCAAGCCTCTAATThis study
FgMFS1-RB-FGGAAGCTTTAGAGCCGAGGCAGAGThis study
FgMFS1-RB -RGGACTAGTCGACCAATCGCCAGTAThis study
P5GAGTTTCCGTCGGTGTCThis study
P6CCTACTACTGGGCTGCTTThis study
P7GCCTGGACGACTAAACThis study
P8TTCAAGACCTTGTGCCThis study
R- FgMFS1-FCGAGCTCTCCGTCCCTCTATAAACTCCThis study
R- FgMFS1-RCCCAAGCTTCATGTGAATGATTGCCTTGTThis study
RJ- FgMFS1-FCTGTCGCCCTTGTTTCAThis study
RJ- FgMFS1-RAAGCCACCGTTCTCCTGThis study
Qpcr-FgMFS1-FGCCAGATTGACCACGACThis study
Qpcr-FgMFS1-RAAAGGAGAAGCACGATAGGThis study
Fg-GAPDH-FTGACTTGACTGTTCGCCTCGAGAA[13]
Fg-GAPDH-RATGGAGGAGTTGGTGTTGCCGTTA[13]
Fg-Factor 1-FCCTCCAGGATGTCTACAAGA[13]
Fg-Factor 1-RCTCAACGGACTTGACTTCAG[13]
S-FgMFS1-FATGAGCGATAACGATAATATCGThis study
S-FgMFS1-RTGTGAATGATTGCCTTGTGThis study
Actin-FATTATATGTTTAGAGGTTGCTGCTTTGG[45]
Actin-RCAATTCGTTGTAGAAGGTATGATGCC[45]
SY-FgMFS1-FCTATAGGGCGAATTGGAGCTCATGAGCGATAACGATAATATCGThis study
SY-FgMFS1-RTCCTTTACTCATTATGGATCCTGTGAATGATTGCCTTGTGTTGThis study
w-GAPDH-FAACTGTTCATGCCATCACTGCCAC[13]
w-GAPDH-RAGGACATACCAGTGAGCTTGCCAT[13]
hn-RNP-Q-FTCACCTTCGCCAAGCTCAGAACTA[13]
hn-RNP-Q-RAGTTGAACTTGCCCGAAACATGCC[13]
Aox-FGACTTGTCATGGTAGATGCCTG[13]
Aox-RCAGGACGAGCATAACCATTCTC[13]

4.5. Gene Expression Analysis

At the mid-anthesis stage, two florets from each fully developed spikelet in a whole spike were inoculated with 1 × 103 conidia or water. The plants were placed into a room with a moist plastic wrap for 48 h at 25 °C and then transferred to another greenhouse at 25 °C as well. At least ten plants were used per treatment. At 1, 2 and 4 dpi, the inoculated heads were collected and ground into fine powders in liquid nitrogen, which were used for RNA extraction, for hormone quantification, and for DON measurement. Three biological replicates were conducted with at least 15 heads per treatment.
The primer pair Qpcr-FgMFS1-F + Qpcr-FgMFS1-R was used to measure the expression level of FgMFS1 in F. graminearum and in wheat spikes. Two reference genes, i.e., glyceraldehyde 3-phosphate dehydrogenase (FgGAPDH, FG05_06257, Fg-GAPDH-F + Fg-GAPDH-R in Table 1) and elongation factor 1 (Fg-Factor 1, FG05_08811, Fg-Factor 1-F + Fg-Factor 1-R), were used to normalize the expression of FgMFS1 in F. graminearum samples. The relative biomass of F. graminearum in wheat spikes was estimated by measuring the expression levels of FgGAPDH by using qRT-PCR with normalization to three wheat reference genes (i.e., w-GAPDH [w-GAPDH-F + w-GAPDH-R], Aox [Aox-F + Aox-R], and hn-RNP-Q [hn-RNP-Q-F + hn-RNP-Q-R]). qRT-PCR analyses were carried out as [13] in a MyiQ Real-Time PCR Detection System (Bio-Rad, Hercules, USA).

4.6. Pathogenicity Assay

To determine whether FgMFS1 had an effect on the pathogenicity of F. graminearum in wheat heads, two florets of a central spikelet from one head per plant were each inoculated with 1 × 103 conidia at the mid-anthesis stage. Five to ten plants were used per treatment. The inoculated plants were treated as above.
To measure whether the FgMFS1 gene was related to DON accumulation in wheat spikes, each powder sample (100 mg; obtained from 4.5) was added with 1 mL sterile water and maintained at 4 °C for 12 h. To make sure whether FgMFS1 gene affected DON production in liquid media, a two-stage protocol was used [13,46]. The DON contents were measured by a DON ELISA kit (Yonghui, Beijing, China) and a Multiskan Spectrum (Thermo Fisher Scientific, Waltham, MA, USA).

4.7. Expression of FgMFS1 in Yeast

The full ORF of FgMFS1 was amplified by the primer pair SY-FgMFS1-F + SY-FgMFS1-R (Table 1), ligated into PYC54 vector and transformed into yeast (Saccharomyces cerevisiae) strain Y1H (Oebiotech, Shanghai, China), following the manufacturer’s instructions. Yeast was dropped on the plates after dilution to measure the effect of FgMFS1 on yeast growth under 2 mM SA stress. Three independent experiments were conducted with at least three plates for each treatment.
Optical density (A600) was assessed to determine the effect of FgMFS1 on yeast growth under 0.5 mM SA stress in liquid DO Supplement-URA media by a Genequant Pro nucleic acid protein analyzer (Biochrom, England, UK). There were three biological replications for each treatment.

4.8. Quantification of Phytohormones

The contents of SA, IAA, and JA were quantified from frozen powders (obtained from 4.5) by ultra-performance liquid chromatography electrospray tandem mass spectroscopy utilizing a Waters Acquity UPLC HSS T3 (100 mm × 2.1 mm, 1.8 µm) in Oebiotech as previously described [47].

4.9. Statistical Analysis

Student’s t-test and one-way ANOVA (DPS software version 12.01 [48]) was used to test the significance of differences in fungal growth, hormone contents, gene expression, DON contents, and the level of disease.

Author Contributions

Conceptualization, P.Q.; Data curation, Q.C., L.L., Z.G., Y.Z. (Youliang Zheng) and P.Q.; Formal analysis, L.L., Y.Z. (Yazhou Zhang), Z.G., J.Z., L.K., J.W. and G.C.; Funding acquisition, Q.C., Y.W. (Yuming Wei) and P.Q.; Investigation, Q.C., L.L., C.L., Y.Z. (Yazhou Zhang), J.Z., Z.G., Y.W. (Yan Wang), Q.L., Y.L., L.K. and Y.J.; Methodology, Q.C., C.L., Q.X., Y.W. (Yan Wang), Q.L, Y.L., J.W., Q.J., Y.W. (Yan Wang) and P.Q.; Project administration, Q.C. and P.Q.; Resources, L.K., X.L., Q.X., J.W, Q.J., G.C., J.M. and Y.Z. (Youliang Zheng); Validation, Q.L., Y.J., X.L. and J.M.; Writing – original draft, Q.C., L.L. and P.Q.; Writing – review & editing, P.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (31901961, 31971939 and 32072054) and the Department of Science and Technology of Sichuan (2020YFH0150).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data underlying this article will be shared on reasonable request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Goswami, R.S.; Kistler, H. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 2004, 5, 515–525. [Google Scholar] [CrossRef]
  2. Koga, S.; Rieder, A.; Ballance, S.; Uhlen, A.K.; Veiseth-Kent, E. Gluten-degrading proteases in wheat infected by Fusarium graminearum—Protease identification and effects on gluten and dough properties. J. Agric. Food Chem. 2019, 67, 11025–11034. [Google Scholar] [CrossRef]
  3. Xu, X.; Berrie, A.M. Epidemiology of mycotoxigenic fungi associated with Fusarium ear blight and apple blue mould: A review. Food Addit. Contam. 2005, 22, 290–301. [Google Scholar] [CrossRef]
  4. Kang’Ethe, E.K.; Sirma, A.J.; Murithi, G.; Mburugu-Mosoti, C.K.; Ouko, E.O.; Korhonen, H.J.; Nduhiu, G.J.; Mungatu, J.K.; Joutsjoki, V.; Lindfors, E.; et al. Occurrence of mycotoxins in food, feed, and milk in two counties from different agro-ecological zones and with historical outbreak of aflatoxins and fumonisins poisonings in Kenya. Food Qual. Saf. 2017, 1, 161–170. [Google Scholar] [CrossRef] [Green Version]
  5. Sobrova, P.; Adam, V.; Vasatkova, A.; Beklova, M.; Zeman, L.; Kizek, R. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 2010, 3, 94–99. [Google Scholar] [CrossRef] [PubMed]
  6. Ameye, M.; Audenaert, K.; De Zutter, N.; Steppe, K.; Van Meulebroek, L.; Vanhaecke, L.; De Vleesschauwer, D.; Haesaert, G.; Smagghe, G. Priming of wheat with the green leaf volatile Z-3-hexenyl acetate enhances defense against Fusarium graminearum but boosts deoxynivalenol production. Plant Physiol. 2015, 167, 1671–1684. [Google Scholar] [CrossRef] [Green Version]
  7. Lopinto, A.J.; Mohammed, H.O.; Ledbetter, E.C. Prevalence and risk factors for isolation of methicillin-resistant Staphylococcus in dogs with keratitis. Vet. Ophthalmol. 2014, 18, 297–303. [Google Scholar] [CrossRef]
  8. Bai, G.; Shaner, G. Management and resistance in wheat and barley to Fusarium head blight. Annu. Rev. Phytopathol. 2004, 42, 135–161. [Google Scholar] [CrossRef]
  9. Gilbert, J.; Tekauz, A. Review: Recent developments in research on fusarium head blight of wheat in Canada. Can. J. Plant Pathol. 2000, 22, 1–8. [Google Scholar] [CrossRef]
  10. Mesterhazy, A. Types and components of resistance to Fusarium head blight of wheat. Plant Breed. 1995, 114, 377–386. [Google Scholar] [CrossRef]
  11. Wang, J.R.; Wang, L.; Gulden, S.; Rocheleau, H.; Balcerzak, M.; Hattori, J.; Cao, W.; Han, F.; Zheng, Y.-L.; Fedak, G.; et al. RNA profiling of Fusarium head blight-resistant wheat addition lines containing the Thinopyrum elongatum chromosome 7E. Can. J. Plant Pathol. 2010, 32, 188–214. [Google Scholar] [CrossRef]
  12. Makandar, R.; Essig, J.S.; Schapaugh, M.A.; Trick, H.; Shah, J. Genetically engineered resistance to Fusarium head blight in wheat by expression of arabidopsis NPR1. Mol. Plant Microbe Interact. 2006, 19, 123–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Qi, P.-F.; Johnston, A.; Balcerzak, M.; Rocheleau, H.; Harris, L.J.; Long, X.-Y.; Wei, Y.-M.; Zheng, Y.-L.; Ouellet, T. Effect of salicylic acid on Fusarium graminearum, the major causal agent of fusarium head blight in wheat. Fungal Biol. 2012, 116, 413–426. [Google Scholar] [CrossRef]
  14. Qi, P.-F.; Balcerzak, M.; Rocheleau, H.; Leung, W.; Wei, Y.-M.; Zheng, Y.-L.; Ouellet, T. Jasmonic acid and abscisic acid play important roles in host-pathogen interaction between Fusarium graminearum and wheat during the early stages of Fusarium head blight. Physiol. Mol. Plant Pathol. 2016, 93, 39–48. [Google Scholar] [CrossRef]
  15. Sorahinobar, M.; Niknam, V.; Ebrahimzadeh, H.; Soltanloo, H.; Behmanesh, M.; Enferadi, S.T. Central role of salicylic acid in resistance of wheat against Fusarium graminearum. J. Plant Growth Regul. 2015, 35, 477–491. [Google Scholar] [CrossRef]
  16. Zhang, Y.-Z.; Chen, Q.; Liu, C.-H.; Liu, Y.-B.; Yi, P.; Niu, K.-X.; Wang, Y.-Q.; Wang, A.-Q.; Yu, H.-Y.; Pu, Z.-E.; et al. Chitin synthase gene FgCHS8 affects virulence and fungal cell wall sensitivity to environmental stress in Fusarium graminearum. Fungal Biol. 2016, 120, 764–774. [Google Scholar] [CrossRef]
  17. Zhang, Y.-Z.; Wei, Z.-Z.; Liu, C.-H.; Chen, Q.; Xu, B.-J.; Guo, Z.-R.; Cao, Y.-L.; Wang, Y.; Han, Y.-N.; Chen, C.; et al. Linoleic acid isomerase gene FgLAI12 affects sensitivity to salicylic acid, mycelial growth and virulence of Fusarium graminearum. Sci. Rep. 2017, 7, 46129. [Google Scholar] [CrossRef] [Green Version]
  18. Qi, P.-F.; Zhang, Y.-Z.; Liu, C.-H.; Zhu, J.; Chen, Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; Zheng, T.; Jiang, Y.-F.; et al. Fusarium graminearum ATP-binding cassette transporter gene FgABCC9 is required for its transportation of salicylic acid, fungicide resistance, mycelial growth and pathogenicity towards wheat. Int. J. Mol. Sci. 2018, 19, 2351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Qi, P.-F.; Zhang, Y.-Z.; Liu, C.-H.; Chen, Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; Jiang, Y.-F.; Zheng, T.; Gong, X.; et al. Functional analysis of FgNahG clarifies the contribution of salicylic acid to wheat (Triticum aestivum) resistance against Fusarium head blight. Toxins 2019, 11, 59. [Google Scholar] [CrossRef] [Green Version]
  20. Rocheleau, H.; Al-Harthi, R.; Ouellet, T. Degradation of salicylic acid by Fusarium graminearum. Fungal Biol. 2019, 123, 77–86. [Google Scholar] [CrossRef]
  21. Zhang, Y.-Z.; Chen, Q.; Liu, C.-H.; Lei, L.; Li, Y.; Zhao, K.; Wei, M.-Q.; Guo, Z.-R.; Wang, Y.; Xu, B.-J.; et al. Fusarium graminearum FgCWM1 encodes a cell wall mannoprotein conferring sensitivity to salicylic acid and virulence to wheat. Toxins 2019, 11, 628. [Google Scholar] [CrossRef] [Green Version]
  22. Del Sorbo, G.; Schoonbeek, H.-J.; De Waard, M.A. Fungal transporters involved in efflux of natural toxic compounds and fungicides. Fungal Genet. Biol. 2000, 30, 1–15. [Google Scholar] [CrossRef]
  23. Poolman, B.; Konings, W.N. Secondary solute transport in bacteria. Biochim. Biophys. Acta Bioenerg. 1993, 1183, 5–39. [Google Scholar] [CrossRef] [Green Version]
  24. Ward, S.J.; Scopes, D.; Christodoulides, M.; Clarke, I.; Heckels, J.E. Expression of Neisseria meningitidis class 1 porin as a fusion protein in Escherichia colli: The influence of liposomes and adjuvants on the production of a bactericidal immune reesponse. Microb. Pathog. 1996, 21, 499–512. [Google Scholar] [CrossRef]
  25. Yan, N. Structural advances for the major facilitator superfamily (MFS) transporters. Trends Biochem. Sci. 2013, 38, 151–159. [Google Scholar] [CrossRef]
  26. Reddy, V.S.; Shlykov, M.A.; Castillo, R.; Sun, E.I., Jr. The major facilitator superfamily (MFS) revisited. FEBS J. 2012, 279, 2022–2035. [Google Scholar] [CrossRef]
  27. Yan, N. Structural biology of the major facilitator superfamily transporters. Annu. Rev. Biophys. 2015, 44, 257–283. [Google Scholar] [CrossRef]
  28. Alexander, N.J.; McCormick, S.; Waalwijk, C.; Van Der Lee, T.; Proctor, R.H. The genetic basis for 3-ADON and 15-ADON trichothecene chemotypes in Fusarium. Fungal Genet. Biol. 2011, 48, 485–495. [Google Scholar] [CrossRef] [Green Version]
  29. López-Errasquín, E.; González-Jaén, M.T.; Callejas, C.; Vázquez, C. A novel MFS transporter encoding gene in Fusarium verticillioides probably involved in iron-siderophore transport. Mycol. Res. 2006, 110, 1102–1110. [Google Scholar] [CrossRef]
  30. Harris, L.J.; Balcerzak, M.; Johnston, A.; Schneiderman, D.; Ouellet, T. Host-preferential Fusarium graminearum gene expression during infection of wheat, barley, and maize. Fungal Biol. 2016, 120, 111–123. [Google Scholar] [CrossRef] [Green Version]
  31. Glaser, L.; Brown, D.H. The synthesis of chitin in cell-free extracts of Neurospora crassa. J. Biol. Chem. 1957, 228, 729–742. [Google Scholar] [CrossRef]
  32. Ichinomiya, M.; Yamada, E.; Yamashita, S.; Ohta, A.; Horiuchi, H. Class I and class II chitin synthases are involved in septum formation in the filamentous fungus Aspergillus nidulans. Eukaryot. Cell 2005, 4, 1125–1136. [Google Scholar] [CrossRef] [Green Version]
  33. Qi, P.-F.; Jiang, Y.-F.; Guo, Z.-R.; Chen, Q.; Ouellet, T.; Zong, L.-J.; Wei, Z.-Z.; Wang, Y.; Zhang, Y.-Z.; Xu, B.-J.; et al. Transcriptional reference map of hormone responses in wheat spikes. BMC Genom. 2019, 20, 390. [Google Scholar] [CrossRef]
  34. Makandar, R.; Nalam, V.; Chaturvedi, R.; Jeannotte, R.; Sparks, A.A.; Shah, J. Involvement of salicylate and jasmonate signaling pathways in Arabidopsis interaction with Fusarium graminearum. Mol. Plant Microbe Interact. 2010, 23, 861–870. [Google Scholar] [CrossRef] [Green Version]
  35. Cao, H.; Glazebrook, J.; Clarke, J.D.; Volko, S.; Dong, X. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 1997, 88, 57–63. [Google Scholar] [CrossRef] [Green Version]
  36. Wang, M.; Wu, L.; Mei, Y.; Zhao, Y.; Ma, Z.; Zhang, X.; Chen, Y. Host-induced gene silencing of multiple genes of Fusarium graminearum enhances resistance to Fusarium head blight in wheat. Plant Biotechnol. J. 2020, 18, 2373–2375. [Google Scholar] [CrossRef]
  37. Cappellini, R.A.; Peterson, J.L. Macroconidium formation in submerged cultures by a non-sporulating strain of Gibberella zeae. Mycologia 1965, 57, 962. [Google Scholar] [CrossRef]
  38. Sá-Correia, I.; Tenreiro, S. The multidrug resistance transporters of the major facilitator superfamily, 6 years after disclosure of Saccharomyces cerevisiae genome sequence. J. Biotechnol. 2002, 98, 215–226. [Google Scholar] [CrossRef]
  39. Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [Google Scholar] [CrossRef] [Green Version]
  40. Yang, J.; Zhang, Y. I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef] [Green Version]
  41. Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Tamura, K.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Green Version]
  43. Frandsen, R.J.N.; Andersson, J.A.; Kristensen, M.B.; Giese, H. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Mol. Biol. 2008, 9, 70. [Google Scholar] [CrossRef] [Green Version]
  44. Maier, F.J.; Malz, S.; Lösch, A.P.; Lacour, T.; Schäfer, W. Development of a highly efficient gene targeting system for Fusarium graminearum using the disruption of a polyketide synthase gene as a visible marker. FEMS Yeast Res. 2005, 5, 653–662. [Google Scholar] [CrossRef] [Green Version]
  45. Teste, M.-A.; Duquenne, M.; François, J.M.; Parrou, J.-L. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol. Biol. 2009, 10, 99. [Google Scholar] [CrossRef] [Green Version]
  46. Miller, J.D.; Blackwell, B.A. Biosynthesis of 3-acetyldeoxynivalenol and other metabolites by Fusarium culmorum HLX 1503 in a stirred jar fermentor. Can. J. Bot. 1986, 64, 1–5. [Google Scholar] [CrossRef]
  47. Zha, Q.; Xi, X.; He, Y.; Jiang, A. Transcriptomic analysis of the leaves of two grapevine cultivars under high-temperature stress. Sci. Hortic. 2020, 265, 109265. [Google Scholar] [CrossRef]
  48. Tang, Q.-Y.; Zhang, C.-X. Data processing system (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2012, 20, 254–260. [Google Scholar] [CrossRef] [PubMed]
Ijms 22 08497 g001 550
Figure 1. Schematic of the mechanisms on F. graminearum to deal with the toxicity of SA, based on the reported data. Gene names in red and in black indicate the upregulation and downregulation under SA stress, respectively. The red dotted arrows indicate the export of SA. The blue dotted arrows indicate the proposed alternate non-oxidative decarboxylation of SA to catechol via and 2, 3 dihydroxybenzoic acid. The black dotted arrow represents the alternative subcellular localization of FgMFS1 before and after adding SA. FgCWM1 (cell wall mannoprotein 1) is an important component of the outer cell wall and is critical for maintaining the strength of the cell wall. Its expression is up-regulated by SA [21]; FgABCC9 (ATP-binding cassette transporter family C 9) is up-regulated by SA. It is distributed in the cell membrane and cost ATP to export SA [18]; Chitin is a major component of the inner cell wall. FgCHS8 (chitin synthase 8) encodes a chitin synthase (EC 2.4.1.16) that catalyzes polymerization of chitin from UDP-N-acetyl-alpha-D-glucosamine [31,32]. FgCHS8 is an integral membrane protein, and its expression is down-regulated by SA [16]; FgLAI12 (linoleic acid isomerase, EC 5.2.1.5) catalyzes the transformation of linoleic acid to cis-9,trans-11 conjugated linoleic acid. Its expression is down-regulated by SA. FgLAI12 is usually localized in vacuoles even under SA treatment and alternatively expressed in the cell membrane when linoleic acid is added [17]; FgNahG (salicylate hydroxylase, EC 1.14.13.1) catalyzes SA to catechol, which is widely distributed in fungal cells. Its expression is up-regulated by SA [19]; FGSG_03657 (salicylate 1-monooxygenase, EC 1.14.13.1) is up-regulated by SA, which catalyzes SA into catechol [13,20]; FGSG_09061 (2, 3-dihydroxybenzoic acid decarboxylase) is involved in a proposed alternate non-oxidative decarboxylation of SA to catechol via 2, 3 dihydroxybenzoic acid. Its expression is up-regulated by SA [13,20]; FGSG_03667 (catechol 1, 2-dioxygenase) catalyzes catechol into cis, cis-muconate [20]. Its expression is induced by SA.
Figure 1. Schematic of the mechanisms on F. graminearum to deal with the toxicity of SA, based on the reported data. Gene names in red and in black indicate the upregulation and downregulation under SA stress, respectively. The red dotted arrows indicate the export of SA. The blue dotted arrows indicate the proposed alternate non-oxidative decarboxylation of SA to catechol via and 2, 3 dihydroxybenzoic acid. The black dotted arrow represents the alternative subcellular localization of FgMFS1 before and after adding SA. FgCWM1 (cell wall mannoprotein 1) is an important component of the outer cell wall and is critical for maintaining the strength of the cell wall. Its expression is up-regulated by SA [21]; FgABCC9 (ATP-binding cassette transporter family C 9) is up-regulated by SA. It is distributed in the cell membrane and cost ATP to export SA [18]; Chitin is a major component of the inner cell wall. FgCHS8 (chitin synthase 8) encodes a chitin synthase (EC 2.4.1.16) that catalyzes polymerization of chitin from UDP-N-acetyl-alpha-D-glucosamine [31,32]. FgCHS8 is an integral membrane protein, and its expression is down-regulated by SA [16]; FgLAI12 (linoleic acid isomerase, EC 5.2.1.5) catalyzes the transformation of linoleic acid to cis-9,trans-11 conjugated linoleic acid. Its expression is down-regulated by SA. FgLAI12 is usually localized in vacuoles even under SA treatment and alternatively expressed in the cell membrane when linoleic acid is added [17]; FgNahG (salicylate hydroxylase, EC 1.14.13.1) catalyzes SA to catechol, which is widely distributed in fungal cells. Its expression is up-regulated by SA [19]; FGSG_03657 (salicylate 1-monooxygenase, EC 1.14.13.1) is up-regulated by SA, which catalyzes SA into catechol [13,20]; FGSG_09061 (2, 3-dihydroxybenzoic acid decarboxylase) is involved in a proposed alternate non-oxidative decarboxylation of SA to catechol via 2, 3 dihydroxybenzoic acid. Its expression is up-regulated by SA [13,20]; FGSG_03667 (catechol 1, 2-dioxygenase) catalyzes catechol into cis, cis-muconate [20]. Its expression is induced by SA.
Ijms 22 08497 g001
Ijms 22 08497 g002 550
Figure 2. Structure of FgMFS1. (A) Deduced amino acid sequence of FgMFS1. The underlined are the 12 transmembrane spanners (TMS; I-XII). (B) Predicted tertiary structure of FgMFS1. The 12 TMS are colored from the N-terminus in blue to the C-terminus in red. Consistent with [25], TMS I, IV, VII, and X are in the center of the predicted structure; II, V, VIII, and XI are on the sides; III, VI, IX, and XII are placed on the outside. (C) Simplified topology of FgMFS1 in the membrane.
Figure 2. Structure of FgMFS1. (A) Deduced amino acid sequence of FgMFS1. The underlined are the 12 transmembrane spanners (TMS; I-XII). (B) Predicted tertiary structure of FgMFS1. The 12 TMS are colored from the N-terminus in blue to the C-terminus in red. Consistent with [25], TMS I, IV, VII, and X are in the center of the predicted structure; II, V, VIII, and XI are on the sides; III, VI, IX, and XII are placed on the outside. (C) Simplified topology of FgMFS1 in the membrane.
Ijms 22 08497 g002
Ijms 22 08497 g003 550
Figure 3. Phylogenetic analysis of MFS transporters. (A) MFS transporters can be classified into 17 families: DHA 1 (drug: H+ antiporter (12-TMS)) drug efflux family, ACS (anion: cation symporter) family, NNP (nitrate–nitrite porter) family, OPA (organophosphate: inorganic phosphate antiporter) family, AAHS (aromatic acid: H+ symporter) family, SP (sugar porter) family, PHS (phosphate: H+ symporter) family, MHS (metabolite: H+ symporter) family, SHS (sialate: H+ symporter) family, OFA (oxalate: formate antiporter) family, MCP (monocarboxylate porter) family, CP (cyanate permease) family, FGHS (fucose–galactose–glucose: H+ symporter) family, OHS (oligosaccharide: H+ symporter) family, NHS (nucleoside: H+ symporte) family, UMF (unknown major facilitator) family, and DHA 2 (drug: H+ antiporter (14-TMS)) drug efflux family. (B) Phylogenetic analysis of the members of DHA1 family. “YGR138c (CAA97151.1) Saccharomyces cerevisiae” represents the protein name, accession number, and Latin name, respectively. The numbers under/above each node are the bootstrap values.
Figure 3. Phylogenetic analysis of MFS transporters. (A) MFS transporters can be classified into 17 families: DHA 1 (drug: H+ antiporter (12-TMS)) drug efflux family, ACS (anion: cation symporter) family, NNP (nitrate–nitrite porter) family, OPA (organophosphate: inorganic phosphate antiporter) family, AAHS (aromatic acid: H+ symporter) family, SP (sugar porter) family, PHS (phosphate: H+ symporter) family, MHS (metabolite: H+ symporter) family, SHS (sialate: H+ symporter) family, OFA (oxalate: formate antiporter) family, MCP (monocarboxylate porter) family, CP (cyanate permease) family, FGHS (fucose–galactose–glucose: H+ symporter) family, OHS (oligosaccharide: H+ symporter) family, NHS (nucleoside: H+ symporte) family, UMF (unknown major facilitator) family, and DHA 2 (drug: H+ antiporter (14-TMS)) drug efflux family. (B) Phylogenetic analysis of the members of DHA1 family. “YGR138c (CAA97151.1) Saccharomyces cerevisiae” represents the protein name, accession number, and Latin name, respectively. The numbers under/above each node are the bootstrap values.
Ijms 22 08497 g003
Ijms 22 08497 g004 550
Figure 4. Preparation of the ΔFgMFS1 and C-FgMFS1 mutants. (A) Disruption of FgMFS1. The left border (LB) and right border (RB) of FgMFS1 for homologous recombination were cloned, by using the primer pairs FgMFS1-LB-F + FgMFS1-LB-R and FgMFS1-RB-F + FgMFS1-RB-R, respectively (a), and ligated into the plasmid (b). The ΔFgMFS1 mutants (d) were generated from a recombination that occurred between the plasmid (b) and the homologous sequence of FgMFS1 in the wild-type (WT) F. graminearum strain (c). (B) Complementation of FgMFS1. The full open reading frame of FgMFS1 was cloned from the WT strain by using primer pair R-FgMFS1-F + R-FgMFS1-R (a) and ligated into the complementation plasmid (b). The T-DNA region of the complementation plasmid was randomly inserted into the genome of ΔFgMFS1 to generate the C-FgMFS1 mutants (c). ApaI, SacI, HindIII, and SpeI indicate the cutting sites of corresponding restriction enzymes used. (C) Verification of the ΔFgMFS1 mutants by PCR, with primer pairs P5 + P6 and P7 + P8, which are located at the upstream and downstream of the inserted T-DNA region in ΔFgMFS1, respectively. (D) Verification of the expression of FgMFS1 in the ΔFgMFS1 and C-FgMFS1 mutants by reverse transcription (RT)-PCR, with RJ-FgMFS1-F + RJ-FgMFS1-R. The FgGAPDH (Fg-GAPDH-F + Fg-GAPDH-R) gene was used as the reference. The black lines between primers show the amplified sequences. The PCR amplification products were validated by sequencing in Qingke biotech (Chengdu, China). The sequences for primers can be found in Table 1.
Figure 4. Preparation of the ΔFgMFS1 and C-FgMFS1 mutants. (A) Disruption of FgMFS1. The left border (LB) and right border (RB) of FgMFS1 for homologous recombination were cloned, by using the primer pairs FgMFS1-LB-F + FgMFS1-LB-R and FgMFS1-RB-F + FgMFS1-RB-R, respectively (a), and ligated into the plasmid (b). The ΔFgMFS1 mutants (d) were generated from a recombination that occurred between the plasmid (b) and the homologous sequence of FgMFS1 in the wild-type (WT) F. graminearum strain (c). (B) Complementation of FgMFS1. The full open reading frame of FgMFS1 was cloned from the WT strain by using primer pair R-FgMFS1-F + R-FgMFS1-R (a) and ligated into the complementation plasmid (b). The T-DNA region of the complementation plasmid was randomly inserted into the genome of ΔFgMFS1 to generate the C-FgMFS1 mutants (c). ApaI, SacI, HindIII, and SpeI indicate the cutting sites of corresponding restriction enzymes used. (C) Verification of the ΔFgMFS1 mutants by PCR, with primer pairs P5 + P6 and P7 + P8, which are located at the upstream and downstream of the inserted T-DNA region in ΔFgMFS1, respectively. (D) Verification of the expression of FgMFS1 in the ΔFgMFS1 and C-FgMFS1 mutants by reverse transcription (RT)-PCR, with RJ-FgMFS1-F + RJ-FgMFS1-R. The FgGAPDH (Fg-GAPDH-F + Fg-GAPDH-R) gene was used as the reference. The black lines between primers show the amplified sequences. The PCR amplification products were validated by sequencing in Qingke biotech (Chengdu, China). The sequences for primers can be found in Table 1.
Ijms 22 08497 g004
Ijms 22 08497 g005 550
Figure 5. FgMFS1 encodes an SA exporter. (A) Mycelial growth on mSNA (modified Synthetischer Nährstoffarmer Agar) plates with and without SA. CK, control. Plates were photographed on the 4th d post inoculation (dpi). (B) Percentages of mycelial growth inhibited by SA ([A1-B1]/A1 for WT, [A2-B2]/A2 for ∆FgMFS1). A1 (A2) and B1 (B2) indicate mycelial diameters of the WT (∆FgMFS1) strain under the CK and SA treatments, respectively. Asterisks indicate significance at P < 0.01. (C) Subcellular localization of the FgMFS1 protein, scale bar, 10 µm. (D) SA induces the expression of FgMFS1 in the WT F. graminearum strain. (E) RT-PCR verification of the expression of FgMFS1 in yeast by using primer pair S-FgMFS1-F + S-FgMFS1-R (Table 1). Actin (Actin-F + Actin-R) was used as the reference. (F) Yeast growth on dropout plates without uracil (DO Supplement-Ura) under SA and CK treatments, which were photographed on the 5th dpi. (G) Growth of S-WT and S-FgMFS1 strains in liquid DO Supplement-URA media with (0.5 mM) and without (CK) SA. Optical density was determined at 48 h after initial inoculation. (H) Percentages of growth inhibited by SA ([C1-D1]/C1 for S-WT, [C2-D2]/C2 for S-FgMFS1). C1 (C2) and D1 (D2) indicate the optical density of S-WT (S-FgMFS1) strain under the CK and SA treatments, respectively. Different small letters above each column indicate significance at P < 0.05. Asterisks indicate significance at P < 0.01.
Figure 5. FgMFS1 encodes an SA exporter. (A) Mycelial growth on mSNA (modified Synthetischer Nährstoffarmer Agar) plates with and without SA. CK, control. Plates were photographed on the 4th d post inoculation (dpi). (B) Percentages of mycelial growth inhibited by SA ([A1-B1]/A1 for WT, [A2-B2]/A2 for ∆FgMFS1). A1 (A2) and B1 (B2) indicate mycelial diameters of the WT (∆FgMFS1) strain under the CK and SA treatments, respectively. Asterisks indicate significance at P < 0.01. (C) Subcellular localization of the FgMFS1 protein, scale bar, 10 µm. (D) SA induces the expression of FgMFS1 in the WT F. graminearum strain. (E) RT-PCR verification of the expression of FgMFS1 in yeast by using primer pair S-FgMFS1-F + S-FgMFS1-R (Table 1). Actin (Actin-F + Actin-R) was used as the reference. (F) Yeast growth on dropout plates without uracil (DO Supplement-Ura) under SA and CK treatments, which were photographed on the 5th dpi. (G) Growth of S-WT and S-FgMFS1 strains in liquid DO Supplement-URA media with (0.5 mM) and without (CK) SA. Optical density was determined at 48 h after initial inoculation. (H) Percentages of growth inhibited by SA ([C1-D1]/C1 for S-WT, [C2-D2]/C2 for S-FgMFS1). C1 (C2) and D1 (D2) indicate the optical density of S-WT (S-FgMFS1) strain under the CK and SA treatments, respectively. Different small letters above each column indicate significance at P < 0.05. Asterisks indicate significance at P < 0.01.
Ijms 22 08497 g005
Ijms 22 08497 g006 550
Figure 6. FgMFS1 is essential for full pathogenicity towards wheat. (A) Wheat heads and rachises, respectively, point inoculated with the WT, ΔFgMFS1, and C-FgMFS1 strains on the 8th dpi. The red arrows indicate the inoculated spikelets. (B) Numbers of infected and bleached spikelets in wheat spikes, respectively, point inoculated with the WT, ΔFgMFS1 and C-FgMFS1 strains, on the 6th, 8th, and 10th dpi. (C) Relative expression levels of FgGAPDH in spikes inoculated with the WT and ΔFgMFS1 strains on the 1st, 2nd, and 4th dpi, respectively. (D) Expression of FgMFS1 in spikes inoculated with the WT strain, on the 1st, 2nd, and 4th dpi. (E) Ratio of the expression of FgMFS1 to that of FgGAPDH in wheat spikes inoculated with the WT strain, on the 1st, 2nd, and 4th dpi. (F) Contents of DON in spikes inoculated with WT, ΔFgMFS1, and C-FgMFS1, respectively. (G) Concentrations of DON in liquid media without (CK) and with 1 mM SA. Different letters above each column indicate significance at P < 0.05. FW, fresh weight.
Figure 6. FgMFS1 is essential for full pathogenicity towards wheat. (A) Wheat heads and rachises, respectively, point inoculated with the WT, ΔFgMFS1, and C-FgMFS1 strains on the 8th dpi. The red arrows indicate the inoculated spikelets. (B) Numbers of infected and bleached spikelets in wheat spikes, respectively, point inoculated with the WT, ΔFgMFS1 and C-FgMFS1 strains, on the 6th, 8th, and 10th dpi. (C) Relative expression levels of FgGAPDH in spikes inoculated with the WT and ΔFgMFS1 strains on the 1st, 2nd, and 4th dpi, respectively. (D) Expression of FgMFS1 in spikes inoculated with the WT strain, on the 1st, 2nd, and 4th dpi. (E) Ratio of the expression of FgMFS1 to that of FgGAPDH in wheat spikes inoculated with the WT strain, on the 1st, 2nd, and 4th dpi. (F) Contents of DON in spikes inoculated with WT, ΔFgMFS1, and C-FgMFS1, respectively. (G) Concentrations of DON in liquid media without (CK) and with 1 mM SA. Different letters above each column indicate significance at P < 0.05. FW, fresh weight.
Ijms 22 08497 g006
Ijms 22 08497 g007 550
Figure 7. Contents of SA (A), jasmonic acid (JA; B), and indole acetic acid (IAA; C) in spikes, respectively, inoculated with water (CK), WT, and ΔFgMFS1 on the 1st and 2nd dpi. Values are the mean ± standard deviation. “a1, b1” and “a2, b2” are used to show the significance at P < 0.05 within treatment, since there are more than one treatments in the same chart. FW, fresh weight.
Figure 7. Contents of SA (A), jasmonic acid (JA; B), and indole acetic acid (IAA; C) in spikes, respectively, inoculated with water (CK), WT, and ΔFgMFS1 on the 1st and 2nd dpi. Values are the mean ± standard deviation. “a1, b1” and “a2, b2” are used to show the significance at P < 0.05 within treatment, since there are more than one treatments in the same chart. FW, fresh weight.
Ijms 22 08497 g007
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chen, Q.; Lei, L.; Liu, C.; Zhang, Y.; Xu, Q.; Zhu, J.; Guo, Z.; Wang, Y.; Li, Q.; Li, Y.; et al. Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat. Int. J. Mol. Sci. 2021, 22, 8497. https://doi.org/10.3390/ijms22168497

AMA Style

Chen Q, Lei L, Liu C, Zhang Y, Xu Q, Zhu J, Guo Z, Wang Y, Li Q, Li Y, et al. Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat. International Journal of Molecular Sciences. 2021; 22(16):8497. https://doi.org/10.3390/ijms22168497

Chicago/Turabian Style

Chen, Qing, Lu Lei, Caihong Liu, Yazhou Zhang, Qiang Xu, Jing Zhu, Zhenru Guo, Yan Wang, Qingcheng Li, Yang Li, and et al. 2021. "Major Facilitator Superfamily Transporter Gene FgMFS1 Is Essential for Fusarium graminearum to Deal with Salicylic Acid Stress and for Its Pathogenicity towards Wheat" International Journal of Molecular Sciences 22, no. 16: 8497. https://doi.org/10.3390/ijms22168497

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop