The Cysteine-Rich Repeat Protein TaCRR1 Participates in Defense against Both Rhizoctonia cerealis and Bipolaris sorokiniana in Wheat
Abstract
:1. Introduction
2. Results
2.1. TaCRR1 Transcription in Wheat Is Responsive to R. Cerealis or B. Sorokiniana Infection
2.2. Sequence and Phylogenetic Analyses of TaCRR1
2.3. Heterologously Expressed TaCRR1 Inhibits the Mycelia Growth of B. sorokiniana and R. cerealis
2.4. Silencing of TaCRR1 Impairs Wheat Resistance to B. sorokiniana
2.5. Silencing of TaCRR1 Reduces Wheat Resistance to R. cerealis
2.6. Silencing of TaCRR1 Represses Expression of Several Pathogenesis-Related Genes
3. Discussion
4. Materials and Methods
4.1. Plant and Fungal Materials, and Primers
4.2. Cloning and Sequence Analysis of TaCRR1
4.3. RNA Extraction, cDNA Synthesis and (q)RT-PCR
4.4. Heterologous Expression and Purification of TaCRR1
4.5. Antifungal Activity Assay of TaCRR1 In Vitro
4.6. BSMV-Mediated TaCRR1 Gene Silencing in Wheat Plants and Their Disease Assessment
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Saintenac, C.; Lee, W.S.; Cambon, F.; Rudd, J.J.; King, R.C.; Marande, W.; Powers, S.J.; Bergès, H.; Phillips, A.L.; Uauy, C.; et al. Wheat receptor-kinase-like protein Stb6 controls gene-for-gene resistance to fungal pathogen Zymoseptoria tritici. Nat. Genet. 2018, 50, 368–374. [Google Scholar] [CrossRef] [PubMed]
- Yue, H.M.; Wang, M.; Gong, W.F.; Zhang, L.Q. The screening and identification of the biologica lcontrol fungi Chaetomium spp. Against wheat common root rot. FEMS Microbiol. Lett. 2018, 365. [Google Scholar] [CrossRef]
- Kumar, J.; Schäfer, P.; Hückelhoven, R.; Langen, G.; Baltruschat, H.; Stein, E.; Nagarajan, S.; Kogel, K.H. Bipolaris sorokiniana, a cereal pathogen of global concern: Cytological and molecular approaches towards better controldouble dagger. Mol. Plant Pathol. 2002, 3, 185–195. [Google Scholar] [CrossRef]
- Kumar, U.; Joshi, A.K.; Kumar, S.; Chand, R.; Röder, M.S. Mapping of resistance to spot blotch disease caused by Bipolaris sorokiniana in spring wheat. Theor. Appl. Genet. 2009, 118, 783–792. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Li, G.H.; Du, Z.Y.; Quan, W.; Zhang, H.Y.; Che, M.Z.; Wang, Z.; Zhang, Z.J. Mapping of QTL conferring resistance to sharp eyespot (Rhizoctonia cerealis) in bread wheat at the adult plant growth stage. Theor. Appl. Genet. 2013, 126, 2865–2878. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Yang, K.; Wei, X.; Zhang, Q.; Rong, W.; Du, L.; Ye, X.; Qi, L.; Zhang, Z. The wheat AGC kinase TaAGC1 is a positive contributor to host resistance to the necrotrophic pathogen Rhizoctonia cerealis. J. Exp. Bot. 2015, 66, 6591–6603. [Google Scholar] [CrossRef] [Green Version]
- Wu, X.; Cheng, K.; Zhao, R.; Zang, S.; Bie, T.; Jiang, Z.; Wu, R.; Gao, D.; Zhang, B. Quantitative trait loci responsible for sharp eyespot resistance in common wheat CI12633. Sci. Rep. 2017, 7, 11799. [Google Scholar] [CrossRef] [Green Version]
- Jones, J.D.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [Green Version]
- Sanz-Martín, J.M.; Pacheco-Arjona, J.R.; Bello-Rico, V.; Vargas, W.A.; Monod, M.; Díaz-Mínguez, J.M.; Thon, M.R.; Sukno, S.A. A highly conserved metalloprotease effector enhances virulence in the maize anthracnose fungus Colletotrichum graminicola. Mol. Plant Pathol. 2016, 17, 1048–1062. [Google Scholar] [CrossRef] [Green Version]
- Wu, Q.; Dou, X.; Wang, Q.; Guan, Z.; Cai, Y.; Liao, X. Isolation of β-1,3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology. Molecules 2018, 23, 1555. [Google Scholar] [CrossRef] [Green Version]
- Thevissen, K.; Terras, F.R.; Broekaert, W.F. Permeabilization of fungal membranes by plant defensins inhibits fungal growth. Appl. Env. Microbiol. 1999, 65, 5451–5458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aerts, A.M.; François, I.E.; Cammue, B.P.; Thevissen, K. The mode of antifungal action of plant, insect and human defensins. Cell. Mol. Life Sci. 2008, 65, 2069–2079. [Google Scholar] [CrossRef] [PubMed]
- Thevissen, K.; Francois, I.E.; Aerts, A.M.; Cammue, B.P. Fungal sphingolipids as targets for the development of selective antifungal therapeutics. Curr. Drug Targets 2005, 6, 923–928. [Google Scholar] [CrossRef] [PubMed]
- Thevissen, K.; Kristensen, H.H.; Thomma, B.P.; Cammue, B.P.; François, I.E. Therapeutic potential of antifungal plant and insect defensins. Drug Discov. Today 2007, 12, 966–971. [Google Scholar] [CrossRef] [PubMed]
- Feige, M.J.; Hendershot, L.M. Disulfide bonds in ER protein folding and homeostasis. Curr. Opin. Cell Biol. 2011, 23, 167–175. [Google Scholar] [CrossRef] [Green Version]
- Yadeta, K.A.; Elmore, J.M.; Creer, A.Y.; Feng, B.; Franco, J.Y.; Rufian, J.S.; He, P.; Phinney, B.; Coaker, G. A Cysteine-Rich Protein Kinase Associates with a Membrane Immune Complex and the Cysteine Residues Are Required for Cell Death. Plant Physiol. 2017, 173, 771–787. [Google Scholar] [CrossRef] [Green Version]
- Bourdais, G.; Burdiak, P.; Gauthier, A.; Nitsch, L.; Salojärvi, J.; Rayapuram, C.; Idänheimo, N.; Hunter, K.; Kimura, S.; Merilo, E.; et al. Large-Scale Phenomics Identifies Primary and Fine-Tuning Roles for CRKs in Responses Related to Oxidative Stress. PLoS Genet. 2015, 11, e1005373. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z. A superfamily of proteins with novel cysteine-rich repeats. Plant Physiol. 2001, 126, 473–476. [Google Scholar] [CrossRef] [Green Version]
- Acharya, B.R.; Raina, S.; Maqbool, S.B.; Jagadeeswaran, G.; Mosher, S.L.; Appel, H.M.; Schultz, J.C.; Klessig, D.F.; Raina, R. Overexpression of CRK13, an Arabidopsis cysteine-rich receptor-like kinase, results in enhanced resistance to Pseudomonas syringae. Plant J. 2007, 50, 488–499. [Google Scholar] [CrossRef]
- Yeh, Y.H.; Chang, Y.H.; Huang, P.Y.; Huang, J.B.; Zimmerli, L. Enhanced Arabidopsis pattern-triggered immunity by overexpression of cysteine-rich receptor-like kinases. Front. Plant Sci. 2015, 6, 322. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.Y.; Wang, X.; Cui, W.; Sager, R.; Modla, S.; Czymmek, K.; Zybaliov, B.; van Wijk, K.; Zhang, C.; Lu, H.; et al. A plasmodesmata-localized protein mediates crosstalk between cell-to-cell communication and innate immunity in Arabidopsis. Plant Cell 2011, 23, 3353–3373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caillaud, M.C.; Wirthmueller, L.; Sklenar, J.; Findlay, K.; Piquerez, S.J.; Jones, A.M.; Robatzek, S.; Jones, J.D.; Faulkner, C. The plasmodesmal protein PDLP1 localises to haustoria-associated membranes during downy mildew infection and regulates callose deposition. PLoS Pathog. 2014, 10, e1004496. [Google Scholar] [CrossRef] [PubMed]
- Sawano, Y.; Miyakawa, T.; Yamazaki, H.; Tanokura, M.; Hatano, K. Purification, characterization, and molecular gene cloning of an antifungal protein from Ginkgo biloba seeds. Biol. Chem. 2007, 388, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Miyakawa, T.; Hatano, K.; Miyauchi, Y.; Suwa, Y.; Sawano, Y.; Tanokura, M. A secreted protein with plant-specific cysteine-rich motif functions as a mannose-binding lectin that exhibits antifungal activity. Plant Physiol. 2014, 166, 766–778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, L.B.; Li, Y.B.; Wang, F.X.; Wang, W.Y.; Liu, J.; Wu, J.H.; Zhong, N.Q.; Wu, S.J.; Jiao, G.L.; Wang, H.Y.; et al. The Cotton Apoplastic Protein CRR1 Stabilizes Chitinase 28 to Facilitate Defense against the Fungal Pathogen Verticillium dahliae. Plant Cell 2019, 31, 520–536. [Google Scholar] [CrossRef]
- Ma, L.S.; Wang, L.; Trippel, C.; Mendoza-Mendoza, A.; Ullmann, S.; Moretti, M.; Carsten, A.; Kahnt, J.; Reissmann, S.; Zechmann, B.; et al. The Ustilago maydis repetitive effector Rsp3 blocks the antifungal activity of mannose-binding maize proteins. Nat. Commun. 2018, 9, 1711. [Google Scholar] [CrossRef] [Green Version]
- Wei, X.; Shan, T.; Hong, Y.; Xu, H.; Liu, X.; Zhang, Z. TaPIMP2, a pathogen-induced MYB protein in wheat, contributes to host resistance to common root rot caused by Bipolaris sorokiniana. Sci. Rep. 2017, 7, 1754. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Liu, X.; Wang, X.; Zhou, M.; Zhou, X.; Ye, X.; Wei, X. An R2R3 MYB transcription factor in wheat, TaPIMP1, mediates host resistance to Bipolaris sorokiniana and drought stresses through regulation of defense- and stress-related genes. New Phytol. 2012, 196, 1155–1170. [Google Scholar] [CrossRef]
- Rong, W.; Luo, M.; Shan, T.; Wei, X.; Du, L.; Xu, H.; Zhang, Z. A Wheat Cinnamyl Alcohol Dehydrogenase TaCAD12 Contributes to Host Resistance to the Sharp Eyespot Disease. Front. Plant Sci. 2016, 7, 1723. [Google Scholar] [CrossRef] [Green Version]
- Naumann, T.A.; Wicklow, D.T.; Price, N.P. Identification of a chitinase-modifying protein from Fusarium verticillioides: Truncation of a host resistance protein by a fungalysin metalloprotease. J. Biol. Chem. 2011, 286, 35358–35366. [Google Scholar] [CrossRef] [Green Version]
- Hein, I.; Barciszewska-Pacak, M.; Hrubikova, K.; Williamson, S.; Dinesen, M.; Soenderby, I.E.; Sundar, S.; Jarmolowski, A.; Shirasu, K.; Lacomme, C. Virus-induced gene silencing-based functional characterization of genes associated with powdery mildew resistance in barley. Plant Physiol. 2005, 138, 2155–2164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, G.F.; Wei, X.; Fan, R.; Zhou, H.; Wang, X.; Yu, C.; Dong, L.; Dong, Z.; Wang, X.; Kang, Z.; et al. Molecular analysis of common wheat genes encoding three types of cytosolic heat shock protein 90 (Hsp90): Functional involvement of cytosolic Hsp90s in the control of wheat seedling growth and disease resistance. New Phytol. 2011, 191, 418–431. [Google Scholar] [CrossRef] [PubMed]
- Gabriëls, S.H.; Vossen, J.H.; Ekengren, S.K.; van Ooijen, G.; Abd-El-Haliem, A.M.; van den Berg, G.C.; Rainey, D.Y.; Martin, G.B.; Takken, F.L.; de Wit, P.J.; et al. An NB-LRR protein required for HR signalling mediated by both extra- and intracellular resistance proteins. Plant J. 2007, 50, 14–28. [Google Scholar] [CrossRef] [PubMed]
- Scofield, S.R.; Huang, L.; Brandt, A.S.; Gill, B.S. Development of a virus-induced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol. 2005, 138, 2165–2173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, X.; Lu, C.; Du, L.; Ye, X.; Liu, X.; Coules, A.; Zhang, Z. The wheat NB-LRR gene TaRCR1 is required for host defence response to the necrotrophic fungal pathogen Rhizoctonia cerealis. Plant Biotechnol. J. 2017, 15, 674–687. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Wang, B.; Wei, J.; Wang, X.; Han, Q.; Kang, Z. TaNTF2, a contributor for wheat resistance to the stripe rust pathogen. Plant Physiol. Biochem. 2018, 123, 260–267. [Google Scholar] [CrossRef]
- Yang, C.; Yu, Y.; Huang, J.; Meng, F.; Pang, J.; Zhao, Q.; Islam, M.A.; Xu, N.; Tian, Y.; Liu, J. Binding of the Magnaporthe oryzae Chitinase MoChia1 by a Rice Tetratricopeptide Repeat Protein Allows Free Chitin to Trigger Immune Responses. Plant Cell 2019, 31, 172–188. [Google Scholar] [CrossRef] [Green Version]
- Liu, B.; Lu, Y.; Xin, Z.; Zhang, Z. Identification and antifungal assay of a wheat beta-1,3-glucanase. Biotechnol. Lett. 2009, 31, 1005–1010. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCTmethod. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lu, L.; Liu, Y.; Zhang, Z. Global Characterization of GH10 Family Xylanase Genes in Rhizoctonia cerealis and Functional Analysis of Xylanase RcXYN1 During Fungus Infection in Wheat. Int. J. Mol. Sci. 2020, 21, 1812. [Google Scholar] [CrossRef] [Green Version]
- Holzberg, S.; Brosio, P.; Gross, C.; Pogue, G.P. Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J. 2002, 30, 315–327. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′–3′) | Use |
---|---|---|
TaCRR1-F1 | CGCACTCGTTATAAGCTGCC | PCR for TaCRR1 DNA and cDNA amplification |
TaCRR1-R1 | ACAGCTTACATAACCCCCGC | |
TaCRR1-F2 | CACATGGCAAGCTCAATCGT | |
TaCRR1-R2 | GCATCTCAACACCAAAGGCA | |
TaCRR1-QF | CTACCTATCCGACGCCAGAA | qRT-PCR for wheat TaCRR1 transcript |
TaCRR1-QR | CGTAGATGGTGACGAACGGC | |
TaCRR1-γ-F | CTAGCTAGCAGGGTGCGCTACGAGATCTA | BSMV:TaCRR1 vector construction |
TaCRR1-γ-R | CTAGCTAGC TGCAGCTCAGATATCACGTCT | |
BSMV-CP-F | TGACTGCTAAGGGTGGAGGA | RT-PCR for wheat BMSV coat protein |
BSMV-CP-R | CGGTTGAACATCACGAAGAGT | |
TaGAPDH-QF | TTAGACTTGCGAAGCCAGCA | qRT-PCR for wheat GAPDH transcript |
TaGAPDH-QR | AAATGCCCTTGAGGTTTCCC | |
Defensin-QF | ATGTCCGTGCCTTTTGCTA | qRT-PCR for wheat Defensin transcript |
Defensin-QR | CCAAACTACCGAGTCCCCG | |
Chitinase1-QF | ATGCTCTGGGACCGATACTT | qRT-PCR for wheat Chitinase1 transcript |
Chitinase1-QR | AGCCTCACTTTGTTCTCGTTTG | |
Chitinase3-QF | CCCACCCTAACCTGAGCATC | qRT-PCR for wheat Chitinase3 transcript |
Chitinase3-QR | ACTGGTTGATCATGGCGGAG | |
Chitinase4-QF | GAAGTCCCCCATGGCGATC | qRT-PCR for wheat Chitinase4 transcript |
Chitinase4-QR | GGTCCCGCAATAACCGTACT | |
β-1,3-Glucanase-QF | ACGACATCACGGCGAGGT | qRT-PCR for wheat β-1,3-Glucanase transcript |
β-1,3-Glucanase-QR | CACGGGGAAAGAGAGGATGA | |
Pcold-TaCRR1-F | GGTACCCTCGAGGGATCCATGGCAAGCTCAATCGCT | Heterologously-expressed His-TF-TaCRR1 vector construction |
Pcold-TaCRR1-R | AAGCTTGAATTCGGATCCTCAAGCGTGCACGACGAT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, F.; Shan, Z.; Yu, J.; Xu, G.; Zhang, Z. The Cysteine-Rich Repeat Protein TaCRR1 Participates in Defense against Both Rhizoctonia cerealis and Bipolaris sorokiniana in Wheat. Int. J. Mol. Sci. 2020, 21, 5698. https://doi.org/10.3390/ijms21165698
Guo F, Shan Z, Yu J, Xu G, Zhang Z. The Cysteine-Rich Repeat Protein TaCRR1 Participates in Defense against Both Rhizoctonia cerealis and Bipolaris sorokiniana in Wheat. International Journal of Molecular Sciences. 2020; 21(16):5698. https://doi.org/10.3390/ijms21165698
Chicago/Turabian StyleGuo, Feilong, Zilong Shan, Jinfeng Yu, Gangbiao Xu, and Zengyan Zhang. 2020. "The Cysteine-Rich Repeat Protein TaCRR1 Participates in Defense against Both Rhizoctonia cerealis and Bipolaris sorokiniana in Wheat" International Journal of Molecular Sciences 21, no. 16: 5698. https://doi.org/10.3390/ijms21165698