Ezrin Modulates the Cell Surface Expression of Programmed Cell Death Ligand-1 in Human Cervical Adenocarcinoma Cells
Abstract
:1. Introduction
2. Results
2.1. Gene and Protein Expression Analysis for ERM and PD-L1 in HeLa Cells
2.2. Subcellular Localization of ERM and PD-L1 in HeLa Cells
2.3. Molecular Interactions between PD-L1 and Ezrin, Radixin, and Moesin in HeLa Cells
2.4. Effect of siRNAs against ERM on the Total Expression Levels of Corresponding mRNAs and Proteins in HeLa Cells
2.5. Effects of ERM Silencing on the Gene and Protein Expressions of PD-L1 in HeLa Cells
2.6. Phosphorylated Ezrin Contributes to the Surface Membrane Localization of PD-L1 in HeLa Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Transfection of Cells with siRNAs
4.3. RNA Isolation and qRT-PCR
4.4. Confocal Laser Scanning Microscopy (CLSM) Analysis
4.4.1. Single Immunofluorescence Staining
4.4.2. Double Immunofluorescence Staining
4.5. Cell Viability Assay
4.6. Protein Isolation
4.7. Western Blotting
4.8. Immunoprecipitation Assay
4.9. Flow Cytometry Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Jiang, J.; Liu, C.; Zhao, W.; Ma, Y.; Zheng, Z.; Zhou, Q.; Zhao, Y. Synergistic anti-tumor effect of anti-PD-L1 antibody cationic microbubbles for delivery of the miR-34a gene combined with ultrasound on cervical carcinoma. Am. J. Transl. Res. 2021, 13, 988–1005. [Google Scholar] [PubMed]
- Mauricio, D.; Zeybek, B.; Tymon-Rosario, J.; Harold, J.; Santin, A.D. Immunotherapy in Cervical Cancer. Curr. Oncol. Rep. 2021, 23, 61. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Luo, H.; Zhang, W.; Shen, Z.; Hu, X.; Zhu, X. Molecular mechanisms of cisplatin resistance in cervical cancer. Drug Des. Dev. Ther. 2016, 10, 1885–1895. [Google Scholar] [CrossRef] [Green Version]
- Shi, L.; Chen, S.; Yang, L.; Li, Y. The role of PD-1 and PD-L1 in T-cell immune suppression in patients with hematological malignancies. J. Hematol. Oncol. 2013, 6, 74. [Google Scholar] [CrossRef] [Green Version]
- Ohaegbulam, K.C.; Assal, A.; Lazar-Molnar, E.; Yao, Y.; Zang, X. Human cancer immunotherapy with antibodies to the PD-1 and PD-L1 pathway. Trends Mol. Med. 2015, 21, 24–33. [Google Scholar] [CrossRef] [Green Version]
- Garon, E.B.; Rizvi, N.A.; Hui, R.; Leighl, N.; Balmanoukian, A.S.; Eder, J.P.; Patnaik, A.; Aggarwal, C.; Gubens, M.; Horn, L.; et al. Pembrolizumab for the treatment of non-small-cell lung cancer. N. Engl. J. Med. 2015, 372, 2018–2028. [Google Scholar] [CrossRef]
- Gatalica, Z.; Snyder, C.; Maney, T.; Ghazalpour, A.; Holterman, D.A.; Xiao, N.; Overberg, P.; Rose, I.; Basu, G.D.; Vranic, S.; et al. Programmed cell death 1 (PD-1) and its ligand (PD-L1) in common cancers and their correlation with molecular cancer type. Cancer Epidemiol. Biomark. Prev. 2014, 23, 2965–2970. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tu, X.; Qin, B.; Zhang, Y.; Zhang, C.; Kahila, M.; Nowsheen, S.; Yin, P.; Yuan, J.; Pei, H.; Li, H.; et al. PD-L1 (B7-H1) Competes with the RNA Exosome to Regulate the DNA Damage Response and Can Be Targeted to Sensitize to Radiation or Chemotherapy. Mol. Cell 2019, 74, 1215–1226.e4. [Google Scholar] [CrossRef]
- Enwere, E.K.; Kornaga, E.N.; Dean, M.; Koulis, T.A.; Phan, T.; Kalantarian, M.; Kobel, M.; Ghatage, P.; Magliocco, A.M.; Lees-Miller, S.P.; et al. Expression of PD-L1 and presence of CD8-positive T cells in pre-treatment specimens of locally advanced cervical cancer. Mod. Pathol. 2017, 30, 577–586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lai, Y.; Zhou, B.; Tan, Q.; Xu, J.; Wan, T.; Zhang, L. LINC00116 enhances cervical cancer tumorigenesis through miR-106a/c-Jun pathway. J. Cell. Biochem. 2020, 121, 2247–2257. [Google Scholar] [CrossRef]
- Qin, W.; Hu, L.; Zhang, X.; Jiang, S.; Li, J.; Zhang, Z.; Wang, X. The Diverse Function of PD-1/PD-L Pathway Beyond Cancer. Front. Immunol. 2019, 10, 2298. [Google Scholar] [CrossRef]
- Nixon, N.A.; Blais, N.; Ernst, S.; Kollmannsberger, C.; Bebb, G.; Butler, M.; Smylie, M.; Verma, S. Current landscape of immunotherapy in the treatment of solid tumours, with future opportunities and challenges. Curr. Oncol. 2018, 25, e373–e384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gong, J.; Chehrazi-Raffle, A.; Reddi, S.; Salgia, R. Development of PD-1 and PD-L1 inhibitors as a form of cancer immunotherapy: A comprehensive review of registration trials and future considerations. J. Immunother. Cancer 2018, 6, 8. [Google Scholar] [CrossRef]
- Yarchoan, M.; Johnson, B.A., 3rd; Lutz, E.R.; Laheru, D.A.; Jaffee, E.M. Targeting neoantigens to augment antitumour immunity. Nat. Rev. Cancer 2017, 17, 209–222. [Google Scholar] [CrossRef] [PubMed]
- Melillo, G.; Chand, V.; Yovine, A.; Gupta, A.; Massacesi, C. Curative-Intent Treatment with Durvalumab in Early-Stage Cancers. Adv. Ther. 2021, 38, 2759–2778. [Google Scholar] [CrossRef]
- Cha, J.H.; Chan, L.C.; Li, C.W.; Hsu, J.L.; Hung, M.C. Mechanisms Controlling PD-L1 Expression in Cancer. Mol. Cell 2019, 76, 359–370. [Google Scholar] [CrossRef] [PubMed]
- Zaretsky, J.M.; Garcia-Diaz, A.; Shin, D.S.; Escuin-Ordinas, H.; Hugo, W.; Hu-Lieskovan, S.; Torrejon, D.Y.; Abril-Rodriguez, G.; Sandoval, S.; Barthly, L.; et al. Mutations Associated with Acquired Resistance to PD-1 Blockade in Melanoma. N. Engl. J. Med. 2016, 375, 819–829. [Google Scholar] [CrossRef]
- Sharma, P.; Hu-Lieskovan, S.; Wargo, J.A.; Ribas, A. Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 2017, 168, 707–723. [Google Scholar] [CrossRef] [Green Version]
- Koyama, S.; Akbay, E.A.; Li, Y.Y.; Herter-Sprie, G.S.; Buczkowski, K.A.; Richards, W.G.; Gandhi, L.; Redig, A.J.; Rodig, S.J.; Asahina, H.; et al. Adaptive resistance to therapeutic PD-1 blockade is associated with upregulation of alternative immune checkpoints. Nat. Commun. 2016, 7, 10501. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wu, X. Study and analysis of antitumor resistance mechanism of PD1/PD-L1 immune checkpoint blocker. Cancer Med. 2020, 9, 8086–8121. [Google Scholar] [CrossRef]
- Perez-Ruiz, E.; Melero, I.; Kopecka, J.; Sarmento-Ribeiro, A.B.; Garcia-Aranda, M.; De Las Rivas, J. Cancer immunotherapy resistance based on immune checkpoints inhibitors: Targets, biomarkers, and remedies. Drug Resist. Update 2020, 53, 100718. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.N.; Lee, H.H.; Hsu, J.L.; Yu, D.; Hung, M.C. The impact of PD-L1 N-linked glycosylation on cancer therapy and clinical diagnosis. J. Biomed. Sci. 2020, 27, 77. [Google Scholar] [CrossRef]
- Li, S.M.; Zhou, J.; Wang, Y.; Nie, R.C.; Chen, J.W.; Xie, D. Recent Findings in the Posttranslational Modifications of PD-L1. J. Oncol. 2020, 2020, 5497015. [Google Scholar] [CrossRef] [PubMed]
- Mezzadra, R.; Sun, C.; Jae, L.T.; Gomez-Eerland, R.; de Vries, E.; Wu, W.; Logtenberg, M.E.W.; Slagter, M.; Rozeman, E.A.; Hofland, I.; et al. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators. Nature 2017, 549, 106–110. [Google Scholar] [CrossRef]
- Burr, M.L.; Sparbier, C.E.; Chan, Y.C.; Williamson, J.C.; Woods, K.; Beavis, P.A.; Lam, E.Y.N.; Henderson, M.A.; Bell, C.C.; Stolzenburg, S.; et al. CMTM6 maintains the expression of PD-L1 and regulates anti-tumour immunity. Nature 2017, 549, 101–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsukita, S.; Yonemura, S. Cortical actin organization: Lessons from ERM (ezrin/radixin/moesin) proteins. J. Biol. Chem. 1999, 274, 34507–34510. [Google Scholar] [CrossRef] [Green Version]
- Tsukita, S.; Oishi, K.; Sato, N.; Sagara, J.; Kawai, A. ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J. Cell Biol. 1994, 126, 391–401. [Google Scholar] [CrossRef]
- Yano, K.; Tomono, T.; Ogihara, T. Advances in Studies of P-Glycoprotein and Its Expression Regulators. Biol. Pharm. Bull. 2018, 41, 11–19. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Sarker, R.; Singh, V.; Sarker, P.; Yin, J.; Chen, T.E.; Chaerkady, R.; Li, X.; Tse, C.M.; Donowitz, M. The NHERF2 sequence adjacent and upstream of the ERM-binding domain affects NHERF2-ezrin binding and dexamethasone stimulated NHE3 activity. Biochem. J. 2015, 470, 77–90. [Google Scholar] [CrossRef] [Green Version]
- Fehon, R.G.; McClatchey, A.I.; Bretscher, A. Organizing the cell cortex: The role of ERM proteins. Nat. Rev. Mol. Cell Biol. 2010, 11, 276–287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bretscher, A.; Edwards, K.; Fehon, R.G. ERM proteins and merlin: Integrators at the cell cortex. Nat. Rev. Mol. Cell Biol. 2002, 3, 586–599. [Google Scholar] [CrossRef] [PubMed]
- Ogihara, T.; Mizoi, K.; Kamioka, H.; Yano, K. Physiological Roles of ERM Proteins and Transcriptional Regulators in Supporting Membrane Expression of Efflux Transporters as Factors of Drug Resistance in Cancer. Cancers 2020, 12, 3352. [Google Scholar] [CrossRef] [PubMed]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Mechanisms of P-glycoprotein alteration during anticancer treatment: Role in the pharmacokinetic and pharmacological effects of various substrate drugs. J. Pharmacol. Sci. 2014, 125, 242–254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luciani, F.; Molinari, A.; Lozupone, F.; Calcabrini, A.; Lugini, L.; Stringaro, A.; Puddu, P.; Arancia, G.; Cianfriglia, M.; Fais, S. P-glycoprotein-actin association through ERM family proteins: A role in P-glycoprotein function in human cells of lymphoid origin. Blood 2002, 99, 641–648. [Google Scholar] [CrossRef] [PubMed]
- Kawaguchi, K.; Yoshida, S.; Hatano, R.; Asano, S. Pathophysiological Roles of Ezrin/Radixin/Moesin Proteins. Biol. Pharm. Bull. 2017, 40, 381–390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asp, N.; Kvalvaag, A.; Sandvig, K.; Pust, S. Regulation of ErbB2 localization and function in breast cancer cells by ERM proteins. Oncotarget 2016, 7, 25443–25460. [Google Scholar] [CrossRef] [Green Version]
- Rudnicka, D.; Oszmiana, A.; Finch, D.K.; Strickland, I.; Schofield, D.J.; Lowe, D.C.; Sleeman, M.A.; Davis, D.M. Rituximab causes a polarization of B cells that augments its therapeutic function in NK-cell-mediated antibody-dependent cellular cytotoxicity. Blood 2013, 121, 4694–4702. [Google Scholar] [CrossRef] [PubMed]
- Clucas, J.; Valderrama, F. ERM proteins in cancer progression. J. Cell Sci. 2014, 127, 267–275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, F.; Su, Y.; Xu, B. Rho-associated protein kinase-dependent moesin phosphorylation is required for PD-L1 stabilization in breast cancer. Mol. Oncol. 2020, 14, 2701–2712. [Google Scholar] [CrossRef]
- Barretina, J.; Caponigro, G.; Stransky, N.; Venkatesan, K.; Margolin, A.A.; Kim, S.; Wilson, C.J.; Lehar, J.; Kryukov, G.V.; Sonkin, D.; et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 2012, 483, 603–607. [Google Scholar] [CrossRef] [PubMed]
- Tsherniak, A.; Vazquez, F.; Montgomery, P.G.; Weir, B.A.; Kryukov, G.; Cowley, G.S.; Gill, S.; Harrington, W.F.; Pantel, S.; Krill-Burger, J.M.; et al. Defining a Cancer Dependency Map. Cell 2017, 170, 564–576.e16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meyers, R.M.; Bryan, J.G.; McFarland, J.M.; Weir, B.A.; Sizemore, A.E.; Xu, H.; Dharia, N.V.; Montgomery, P.G.; Cowley, G.S.; Pantel, S.; et al. Computational correction of copy number effect improves specificity of CRISPR-Cas9 essentiality screens in cancer cells. Nat. Genet. 2017, 49, 1779–1784. [Google Scholar] [CrossRef] [Green Version]
- Yang, A.; Li, M.Y.; Zhang, Z.H.; Wang, J.Y.; Xing, Y.; Ri, M.; Jin, C.H.; Xu, G.H.; Piao, L.X.; Jin, H.L.; et al. Erianin regulates programmed cell death ligand 1 expression and enhances cytotoxic T lymphocyte activity. J. Ethnopharmacol. 2021, 273, 113598. [Google Scholar] [CrossRef]
- Ferreira, E.R.; Bonfim-Melo, A.; Cordero, E.M.; Mortara, R.A. ERM Proteins Play Distinct Roles in Cell Invasion by Extracellular Amastigotes of Trypanosoma cruzi. Front. Microbiol. 2017, 8, 2230. [Google Scholar] [CrossRef]
- Hiruma, S.; Kamasaki, T.; Otomo, K.; Nemoto, T.; Uehara, R. Dynamics and function of ERM proteins during cytokinesis in human cells. FEBS Lett. 2017, 591, 3296–3309. [Google Scholar] [CrossRef] [PubMed]
- Kschonsak, Y.T.; Hoffmann, I. Activated ezrin controls MISP levels to ensure correct NuMA polarization and spindle orientation. J. Cell Sci. 2018, 131, jcs214544. [Google Scholar] [CrossRef] [Green Version]
- Zuo, H.X.; Jin, Y.; Wang, Z.; Li, M.Y.; Zhang, Z.H.; Wang, J.Y.; Xing, Y.; Ri, M.H.; Jin, C.H.; Xu, G.H.; et al. Curcumol inhibits the expression of programmed cell death-ligand 1 through crosstalk between hypoxia-inducible factor-1alpha and STAT3 (T705) signaling pathways in hepatic cancer. J. Ethnopharmacol. 2020, 257, 112835. [Google Scholar] [CrossRef]
- Zaman, R.; Lombardo, A.; Sauvanet, C.; Viswanatha, R.; Awad, V.; Bonomo, L.E.; McDermitt, D.; Bretscher, A. Effector-mediated ERM activation locally inhibits RhoA activity to shape the apical cell domain. J. Cell Biol. 2021, 220, e202007146. [Google Scholar] [CrossRef]
- Takasawa, K.; Takasawa, A.; Akimoto, T.; Magara, K.; Aoyama, T.; Kitajima, H.; Murakami, T.; Ono, Y.; Kyuno, D.; Suzuki, H.; et al. Regulatory roles of claudin-1 in cell adhesion and microvilli formation. Biochem. Biophys. Res. Commun. 2021, 565, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Kvalvaag, A.S.; Pust, S.; Sandvig, K. Vps11, a subunit of the tethering complexes HOPS and CORVET, is involved in regulation of glycolipid degradation and retrograde toxin transport. Commun. Integr. Biol. 2014, 7, e28129. [Google Scholar] [CrossRef] [PubMed]
- Auvinen, E.; Kivi, N.; Vaheri, A. Regulation of ezrin localization by Rac1 and PIPK in human epithelial cells. Exp. Cell Res. 2007, 313, 824–833. [Google Scholar] [CrossRef]
- Berggren, S.; Gall, C.; Wollnitz, N.; Ekelund, M.; Karlbom, U.; Hoogstraate, J.; Schrenk, D.; Lennernas, H. Gene and protein expression of P-glycoprotein, MRP1, MRP2, and CYP3A4 in the small and large human intestine. Mol. Pharm. 2007, 4, 252–257. [Google Scholar] [CrossRef]
- Gerlach, J.H. Structure and function of P-glycoprotein. Cancer Treat. Res. 1989, 48, 37–53. [Google Scholar] [PubMed]
- Ogihara, T.; Kamiya, M.; Ozawa, M.; Fujita, T.; Yamamoto, A.; Yamashita, S.; Ohnishi, S.; Isomura, Y. What kinds of substrates show P-glycoprotein-dependent intestinal absorption? Comparison of verapamil with vinblastine. Drug Metab. Pharmacokinet. 2006, 21, 238–244. [Google Scholar] [CrossRef] [Green Version]
- Ghosh, S.; Di Bartolo, V.; Tubul, L.; Shimoni, E.; Kartvelishvily, E.; Dadosh, T.; Feigelson, S.W.; Alon, R.; Alcover, A.; Haran, G. ERM-Dependent Assembly of T Cell Receptor Signaling and Co-stimulatory Molecules on Microvilli prior to Activation. Cell Rep. 2020, 30, 3434–3447.e6. [Google Scholar] [CrossRef] [Green Version]
- Kobori, T.; Tanaka, C.; Tameishi, M.; Urashima, Y.; Ito, T.; Obata, T. Role of Ezrin/Radixin/Moesin in the Surface Localization of Programmed Cell Death Ligand-1 in Human Colon Adenocarcinoma LS180 Cells. Pharmaceuticals 2021, 14, 864. [Google Scholar] [CrossRef]
- Magro, F.; Fraga, S.; Soares-da-Silva, P. Interferon-gamma-induced STAT1-mediated membrane retention of NHE1 and associated proteins ezrin, radixin and moesin in HT-29 cells. Biochem. Pharmacol. 2005, 70, 1312–1319. [Google Scholar] [CrossRef]
- Hoshi, Y.; Uchida, Y.; Kuroda, T.; Tachikawa, M.; Couraud, P.O.; Suzuki, T.; Terasaki, T. Distinct roles of ezrin, radixin and moesin in maintaining the plasma membrane localizations and functions of human blood-brain barrier transporters. J. Cereb. Blood Flow Metab. 2020, 40, 1533–1545. [Google Scholar] [CrossRef]
- Zhang, Y.; Dong, J.; Zhu, X.; Wang, W.; Yang, Q. The effect of sphingomyelin synthase 2 (SMS2) deficiency on the expression of drug transporters in mouse brain. Biochem. Pharmacol. 2011, 82, 287–294. [Google Scholar] [CrossRef] [PubMed]
- Kobori, T.; Fujiwara, S.; Miyagi, K.; Harada, S.; Nakamoto, K.; Nakagawa, T.; Takahashi, H.; Narita, M.; Tokuyama, S. Involvement of moesin in the development of morphine analgesic tolerance through P-glycoprotein at the blood-brain barrier. Drug Metab. Pharmacokinet. 2014, 29, 482–489. [Google Scholar] [CrossRef]
- Yano, K.; Otsuka, K.; Kato, Y.; Kawabata, H.; Ohmori, S.; Arakawa, H.; Ogihara, T. Different regulation of P-glycoprotein function between Caco-2 and Caki-1 cells by ezrin, radixin and moesin proteins. J. Pharm. Pharmacol. 2016, 68, 361–367. [Google Scholar] [CrossRef] [PubMed]
- Kobori, T.; Tameishi, M.; Tanaka, C.; Urashima, Y.; Obata, T. Subcellular distribution of ezrin/radixin/moesin and their roles in the cell surface localization and transport function of P-glycoprotein in human colon adenocarcinoma LS180 cells. PLoS ONE 2021, 16, e0250889. [Google Scholar] [CrossRef] [PubMed]
- Berryman, M.; Franck, Z.; Bretscher, A. Ezrin is concentrated in the apical microvilli of a wide variety of epithelial cells whereas moesin is found primarily in endothelial cells. J. Cell Sci. 1993, 105 Pt 4, 1025–1043. [Google Scholar] [CrossRef] [PubMed]
- Berryman, M.; Gary, R.; Bretscher, A. Ezrin oligomers are major cytoskeletal components of placental microvilli: A proposal for their involvement in cortical morphogenesis. J. Cell Biol. 1995, 131, 1231–1242. [Google Scholar] [CrossRef] [Green Version]
- Federici, C.; Brambilla, D.; Lozupone, F.; Matarrese, P.; de Milito, A.; Lugini, L.; Iessi, E.; Cecchetti, S.; Marino, M.; Perdicchio, M.; et al. Pleiotropic function of ezrin in human metastatic melanomas. Int. J. Cancer 2009, 124, 2804–2812. [Google Scholar] [CrossRef] [PubMed]
- Brambilla, D.; Fais, S. The Janus-faced role of ezrin in “linking” cells to either normal or metastatic phenotype. Int. J. Cancer 2009, 125, 2239–2245. [Google Scholar] [CrossRef]
- Fais, S. A role for ezrin in a neglected metastatic tumor function. Trends Mol. Med. 2004, 10, 249–250. [Google Scholar] [CrossRef]
- Takamatsu, H.; Espinoza, J.L.; Lu, X.; Qi, Z.; Okawa, K.; Nakao, S. Anti-moesin antibodies in the serum of patients with aplastic anemia stimulate peripheral blood mononuclear cells to secrete TNF-alpha and IFN-gamma. J. Immunol. 2009, 182, 703–710. [Google Scholar] [CrossRef]
- Suzuki, K.; Nagao, T.; Itabashi, M.; Hamano, Y.; Sugamata, R.; Yamazaki, Y.; Yumura, W.; Tsukita, S.; Wang, P.C.; Nakayama, T.; et al. A novel autoantibody against moesin in the serum of patients with MPO-ANCA-associated vasculitis. Nephrol. Dial. Transplant. 2014, 29, 1168–1177. [Google Scholar] [CrossRef] [Green Version]
- Kobori, T.; Hamasaki, S.; Kitaura, A.; Yamazaki, Y.; Nishinaka, T.; Niwa, A.; Nakao, S.; Wake, H.; Mori, S.; Yoshino, T.; et al. Interleukin-18 Amplifies Macrophage Polarization and Morphological Alteration, Leading to Excessive Angiogenesis. Front. Immunol. 2018, 9, 334. [Google Scholar] [CrossRef] [PubMed]
- Hamasaki, S.; Kobori, T.; Yamazaki, Y.; Kitaura, A.; Niwa, A.; Nishinaka, T.; Nishibori, M.; Mori, S.; Nakao, S.; Takahashi, H. Effects of scavenger receptors-1 class A stimulation on macrophage morphology and highly modified advanced glycation end product-protein phagocytosis. Sci. Rep. 2018, 8, 5901. [Google Scholar] [CrossRef] [PubMed]
- Lall, N.; Henley-Smith, C.J.; De Canha, M.N.; Oosthuizen, C.B.; Berrington, D. Viability Reagent, PrestoBlue, in Comparison with Other Available Reagents, Utilized in Cytotoxicity and Antimicrobial Assays. Int. J. Microbiol. 2013, 2013, 420601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stockert, J.C.; Horobin, R.W.; Colombo, L.L.; Blazquez-Castro, A. Tetrazolium salts and formazan products in Cell Biology: Viability assessment, fluorescence imaging, and labeling perspectives. Acta Histochem. 2018, 120, 159–167. [Google Scholar] [CrossRef] [Green Version]
- Boncler, M.; Rozalski, M.; Krajewska, U.; Podsedek, A.; Watala, C. Comparison of PrestoBlue and MTT assays of cellular viability in the assessment of anti-proliferative effects of plant extracts on human endothelial cells. J. Pharmacol. Toxicol. Methods 2014, 69, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; McCanna, D.J.; Sivak, J.G. Use of the viability reagent PrestoBlue in comparison with alamarBlue and MTT to assess the viability of human corneal epithelial cells. J. Pharmacol. Toxicol. Methods 2015, 71, 1–7. [Google Scholar] [CrossRef]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Changes in PtdIns(4,5)P2 induced by etoposide treatment modulates small intestinal P-glycoprotein via radixin. Biol. Pharm. Bull. 2014, 37, 1124–1131. [Google Scholar] [CrossRef] [Green Version]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Radixin influences the changes in the small intestinal p-glycoprotein by Etoposide treatment. Biol. Pharm. Bull. 2013, 36, 1822–1828. [Google Scholar]
Gene | Primer Sequence (5′→3′) |
---|---|
h-β-actin (forward) | TGGCACCCAGCACAATGAA |
h-β-actin (reverse) | CTAAGTCATAGTCCGCCTAGAAGCA |
h-PD-L1 (forward) | CAATGTGACCAGCACACTGAGAA |
h-PD-L1 (reverse) | GGCATAATAAGATGGCTCCCAGAA |
h-ezrin (forward) | ACCATGGATGCAGAGCTGGAG |
h-ezrin (reverse) | CATAGTGGAGGCCAAAGTACCACA |
h-radixin (forward) | GAATTTGCCATTCAGCCCAATA |
h-radixin (reverse) | GCCATGTAGAATAACCTTTGCTGTC |
h-moesin (forward) | CCGAATCCAAGCCGTGTGTA |
h-moesin (reverse) | GGCAAACTCCAGCTCTGCATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanaka, C.; Kobori, T.; Tameishi, M.; Urashima, Y.; Ito, T.; Obata, T. Ezrin Modulates the Cell Surface Expression of Programmed Cell Death Ligand-1 in Human Cervical Adenocarcinoma Cells. Molecules 2021, 26, 5648. https://doi.org/10.3390/molecules26185648
Tanaka C, Kobori T, Tameishi M, Urashima Y, Ito T, Obata T. Ezrin Modulates the Cell Surface Expression of Programmed Cell Death Ligand-1 in Human Cervical Adenocarcinoma Cells. Molecules. 2021; 26(18):5648. https://doi.org/10.3390/molecules26185648
Chicago/Turabian StyleTanaka, Chihiro, Takuro Kobori, Mayuka Tameishi, Yoko Urashima, Takuya Ito, and Tokio Obata. 2021. "Ezrin Modulates the Cell Surface Expression of Programmed Cell Death Ligand-1 in Human Cervical Adenocarcinoma Cells" Molecules 26, no. 18: 5648. https://doi.org/10.3390/molecules26185648