Peptoids with Antibiofilm Activity against the Gram Negative Obligate Anaerobe, Fusobacterium nucleatum
Abstract
:1. Introduction
2. Results
2.1. Haemolytic Effect of Peptoids on Human Erythrocytes
2.2. Cytotoxicity of Peptoids against Human Gingival Fibroblasts
2.3. Biofilm Inhibition by Peptoids
3. Discussion
4. Materials and Methods
4.1. Peptoid Preparation
4.2. Haemolytic Assay
4.3. 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium Bromide (MTT Assay)
4.4. Biofim Inhibition Assay
4.5. Propidium Monoazide (PMA–Modified) qPCR
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Hancock, R.E.W.; Sahl, H.G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef]
- Sztukowska, M.N.; Roky, M.; Demuth, D.R. Peptide and non-peptide mimetics as potential therapeutics targeting oral bacteria and oral biofilms. Mol. Oral Microbiol. 2019, 34, 169–182. [Google Scholar] [CrossRef]
- Niu, J.Y.; Yin, I.X.; Wu, W.K.K.; Li, Q.L.; Mei, M.L.; Chu, C.H. Antimicrobial peptides for the prevention and treatment of dental caries: A concise review. Arch. Oral Biol. 2021, 122, 105022. [Google Scholar] [CrossRef] [PubMed]
- Marr, A.; Goooderham, W.; Hancock, R. Antibacterial peptides for therapeutic use: Obstacles and realistic outlook. Curr. Opin. Pharm. 2006, 6, 468–472. [Google Scholar] [CrossRef]
- Daep, C.A.; Novak, E.A.; Lamont, R.J.; Demuth, D.R. Selective substitution of amino acids limits proteolytic cleavage and improves the bioactivity of an anti-biofilm peptide that targets the periodontal pathogen, Porphyromonas gingivalis. Peptides 2010, 31, 2173–2178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McCrudden, M.T.C.; Orr, D.F.; Yu, Y.; Coulter, W.A.; Manning, G.; Irwin, C.R.; Lundy, F.T. LL-37 in periodontal health and disease and its susceptibility to degradation by proteinases present in gingival crevicular fluid. J. Clin. Periodontol. 2013, 40, 933–941. [Google Scholar] [CrossRef] [PubMed]
- Gimenez, D.; Zhou, G.; Hurley, M.F.D.; Aguilar, J.A.; Voelz, V.A.; Cobb, S.L. Fluorinated Aromatic Monomers as Building Blocks to Control α-Peptoid Conformation and Structure. J. Am. Chem. Soc. 2019, 141, 3430–3434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuckermann, R.; Kodaek, T. Peptoids as potential therapeutics. Curr. Opin. Mol. Ther. 2009, 11, 299–307. [Google Scholar]
- Herlan, C.N.; Sommer, K.; Weis, P.; Nieger, M.; Bräse, S. Structural Diversity of Peptoids: Tube-Like Structures of Macrocycles. Molecules 2021, 26, 150. [Google Scholar] [CrossRef]
- Luo, Y.; Bolt, H.L.; Eggimann, G.A.; McAuley, D.F.; McMullan, R.; Curran, T.; Zhou, M.; Jahoda, P.C.A.B.; Cobb, S.L.; Lundy, F.T. Peptoid Efficacy against Polymicrobial Biofilms Determined by Using Propidium Monoazide-Modified Quantitative PCR. ChemBioChem 2017, 18, 111–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mojsoska, B.; Carretero, G.; Larsen, S.; Mateiu, R.V.; Jenssen, H. Peptoids successfully inhibit the growth of Gram negative E. coli causing substantial membrane damage. Sci. Rep. 2017, 7, 42332. [Google Scholar] [CrossRef] [Green Version]
- Chongsiriwatana, N.P.; Lin, J.S.; Kapoor, R.; Wetzler, M.; Rea, J.A.C.; Didwania, M.K.; Contag, C.H.; Barron, A.E. Intracellular biomass flocculation as a key mechanism of rapid bacterial killing by cationic, amphipathic antimicrobial peptides and peptoids. Sci. Rep. 2017, 7, 16718. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Kang, D.; Choi, J.; Huang, W.; Wadman, M.; Barron, A.E.; Seo, J. Effect of side chain hydrophobicity and cationic charge on antimicrobial activity and cytotoxicity of helical peptoids. Bioorg. Med. Chem. Lett. 2018, 28, 170–173. [Google Scholar] [CrossRef]
- Middleton, M.P.; Armstrong, S.A.; Bicker, K.L. Improved potency and reduced toxicity of the antifungal peptoid AEC5 through submonomer modification. Bioorg. Med. Chem. Lett. 2018, 28, 3514–3519. [Google Scholar] [CrossRef] [PubMed]
- Bicker, K.L.; Cobb, S.L. Recent advances in the development of anti-infective peptoids. Chem. Commun. 2020, 56, 11158–11168. [Google Scholar] [CrossRef]
- Bolt, H.L.; Eggimann, G.A.; Denny, P.W.; Cobb, S.L. Enlarging the chemical space of anti-leishmanials: A structure–activity relationship study of peptoids against Leishmania mexicana, a causative agent of cutaneous leishmaniasis. MedChemComm 2016, 7, 799–805. [Google Scholar] [CrossRef] [Green Version]
- Bolt, H.L.; Eggimann, G.A.; Jahoda, C.A.B.; Zuckermann, R.N.; Sharples, G.J.; Cobb, S.L. Exploring the links between peptoid antibacterial activity and toxicity. MedChemComm 2017, 8, 886–896. [Google Scholar] [CrossRef] [Green Version]
- Eggimann, G.A.; Bolt, H.L.; Denny, P.W.; Cobb, S.L. Investigating the Anti-leishmanial Effects of Linear Peptoids. ChemMedChem 2015, 10, 233–237. [Google Scholar] [CrossRef]
- Shyam, R.; Charbonnel, N.; Job, A.; Blavignac, C.; Forestier, C.; Taillefumier, C.; Faure, S. 1,2,3-Triazolium-Based Cationic Amphipathic Peptoid Oligomers Mimicking Antimicrobial Helical Peptides. ChemMedChem 2018, 13, 1513–1516. [Google Scholar] [CrossRef]
- Chongsiriwatana, N.P.; Patch, J.A.; Czyzewski, A.M.; Dohm, M.T.; Ivankin, A.; Gidalevitz, D.; Zuckermann, R.N.; Barron, A.E. Peptoids that mimic the structure, function, and mechanism of helical antimicrobial peptides. Proc. Nat. Acad. Sci. USA 2008, 105, 2794–2799. [Google Scholar] [CrossRef] [Green Version]
- Pye, A.D.; Lockhart, D.E.A.; Dawson, M.P.; Murray, C.A.; Smith, A.J. A review of dental implants and infection. J. Hosp. Infect. 2009, 72, 104–110. [Google Scholar] [CrossRef] [PubMed]
- The NHS Information Centre. Adult Dental Health Survey 2009. Available online: http://www.dhsspsni.gov.uk/ adultdentalhealthsurvey_2009_firstrelease.pdf (accessed on 12 April 2021).
- Derks, J.; Tomasi, C. Peri-implant health and disease. A systematic review of current epidemiology. J. Clin. Periodontol. 2015, 42, S158–S171. [Google Scholar] [CrossRef]
- Sweeney, L.C.; Dave, J.; Chambers, P.A.; Heritage, J. Antibiotic resistance in general dental practice—A cause for concern? J. Antimicrob. Chemother. 2004, 53, 567–576. [Google Scholar] [CrossRef]
- Ardila, C.M.; Granada, M.I.; Guzmán, I.C. Antibiotic resistance of subgingival species in chronic periodontitis patients. J. Periodontal Res. 2010, 45, 557–563. [Google Scholar] [CrossRef]
- McLean, D.T.; McCrudden, M.T.; Linden, G.J.; Irwin, C.R.; Conlon, J.M.; Lundy, F.T. Antimicrobial and immunomodulatory properties of PGLa-AM1, CPF-AM1, and magainin-AM1: Potent activity against oral pathogens. Regul. Pept. 2014, 194–195, 63–68. [Google Scholar] [CrossRef]
- Afami, M.E.; El Karim, I.; About, I.; Coulter, S.M.; Laverty, G.; Lundy, F.T. Ultrashort Peptide Hydrogels Display Antimicrobial Activity and Enhance Angiogenic Growth Factor Release by Dental Pulp Stem/Stromal Cells. Materials 2021, 14, 2237. [Google Scholar] [CrossRef]
- Bernegossi, J.; Fontana, C.R.; Caiaffa, K.S.; Duque, C.; Chorilli, M. Inhibitory Effect of a KSL-W Peptide-Loaded Poloxamer 407-Based Microemulsions for Buccal Delivery on Fusobacterium nucleatum Biofilm. J. Biomed. Nanotechnol. 2020, 16, 390–397. [Google Scholar] [CrossRef]
- Wang, H.; Ai, L.; Zhang, Y.; Cheng, J.; Yu, H.; Li, C.; Zhang, D.; Pan, Y.; Lin, L. The Effects of Antimicrobial Peptide Nal-P-113 on Inhibiting Periodontal Pathogens and Improving Periodontal Status. Biomed. Res. Int. 2018, 2018, 1805793. [Google Scholar] [CrossRef] [Green Version]
- McCrudden, M.; O’Donnell, K.; Irwin, C.; Lundy, F. Effects of LL-37 on Gingival Fibroblasts: A Role in Periodontal Tissue Remodeling? Vaccines 2018, 6, 44. [Google Scholar] [CrossRef] [Green Version]
- Politis, C.; Schoenaers, J.; Jacobs, R.; Agbaje, J.O. Wound Healing Problems in the Mouth. Front. Physiol. 2016, 7, 507. [Google Scholar] [CrossRef] [Green Version]
- Metterlein, T.; Hoffmann, P.; Späth, R.; Gruber, M.; Graf, B.M.; Zink, W. In vitro myotoxic effects of bupivacaine on rhab- domyosarcoma cells, immortalized and primary muscle cells. Cancer Cell Int. 2015, 15, 75. [Google Scholar] [CrossRef] [Green Version]
- Bozzo, C.; Tiberio, R.; Graziola, F.; Pertusi, G.; Valente, G.; Colombo, E.; Small, P.L.; Leigheb, G. A Mycobacterium ulcerans toxin, mycolactone, induces apoptosis in primary human keratinocytes and in HaCaT cells. Microbes Infect. 2010, 12, 1258–1263. [Google Scholar] [CrossRef]
- Chen, X.; Murdoch, R.; Shafer, D.J.; Ajuwon, K.M.; Applegate, T.J. Cytotoxicity of various chemicals and mycotoxins in fresh primary duck embryonic fibroblasts: A comparison to HepG2 cells. J. Appl. Toxicol. 2016, 36, 1437–1445. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Mendis, N.; Trigui, H.; Oliver, J.D.; Faucher, S.P. The importance of the viable but non-culturable state in human bacterial pathogens. Front. Microbiol. 2014, 5, 258. [Google Scholar] [CrossRef] [Green Version]
- Pasquaroli, S.; Zandri, G.; Vignaroli, C.; Vuotto, C.; Donelli, G.; Biavasco, F. Antibiotic pressure can induce the viable but non-culturable state in Staphylococcus aureus growing in biofilms. J. Antimicrob. Chemother. 2013, 68, 1812–1817. [Google Scholar] [CrossRef] [Green Version]
- Brooks, I. Antimicrobials therapy of anaerobic infections. J. Chemother. 2016, 28, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Van Frankenhuyzen, J.K.; Trevors, J.T.; Flemming, C.A.; Lee, H.; Habash, M.B. Optimization, validation, and application of a real-time PCR protocol for quantification of viable bacterial cells in municipal sewage sludge and biosolids using reporter genes and Escherichia coli. J. Ind. Microbiol. Biotechnol. 2013, 40, 1251–1261. [Google Scholar] [CrossRef]
Sequence | |
---|---|
F. nucleatum Forward Primer | CAACCATTACTTTAACTCTACCATGTTCA |
F. nucleatum Reverse Primer | GTTGACTTTACAGAAGGAGATTATGTAAAAATC |
Volume Per Reaction | Final Concentration | |
---|---|---|
Lightcycler 480 SYBR Green I Master (x2) | 5 µL | X1 |
Forward Primer (10 µM) | 0.1 µL | 100 nM |
Reverse Primer (10 µM) | 0.1 µL | 100 nM |
Nuclease free water | 3.6 µL | |
DNA template | 1.2 µL | |
Total Reaction Volume | 10 µL |
Cycles | Temperature | Hold Time |
---|---|---|
1 | 95 °C | 5 min |
65 | 95 °C | 10 s |
65 | 55 °C | 10 s |
65 | 72 °C | 10 s |
Melt analysis | ||
1 | 95 °C | 5 s |
1 | 96 °C | 1 min |
1 | 97 °C | 1 min |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Toole, J.; Bolt, H.L.; Marley, J.J.; Patrick, S.; Cobb, S.L.; Lundy, F.T. Peptoids with Antibiofilm Activity against the Gram Negative Obligate Anaerobe, Fusobacterium nucleatum. Molecules 2021, 26, 4741. https://doi.org/10.3390/molecules26164741
Toole J, Bolt HL, Marley JJ, Patrick S, Cobb SL, Lundy FT. Peptoids with Antibiofilm Activity against the Gram Negative Obligate Anaerobe, Fusobacterium nucleatum. Molecules. 2021; 26(16):4741. https://doi.org/10.3390/molecules26164741
Chicago/Turabian StyleToole, Jamie, Hannah L. Bolt, John J. Marley, Sheila Patrick, Steven L. Cobb, and Fionnuala T. Lundy. 2021. "Peptoids with Antibiofilm Activity against the Gram Negative Obligate Anaerobe, Fusobacterium nucleatum" Molecules 26, no. 16: 4741. https://doi.org/10.3390/molecules26164741