An FMRFamide Neuropeptide in Cuttlefish Sepia pharaonis: Identification, Characterization, and Potential Function
Abstract
:1. Introduction
2. Results
2.1. Full-Length Transcript Sequence and Predicted Precursor Protein
2.2. Blast Search and Phylogenetic Tree Construction
2.3. Quantitative Expression Analysis of SpFMRFamide
2.4. Effects of SpFMRFamide and SpFLRFamide on the Total Protein Secretory Activity of CHO-K1 Cells
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. RNA Extraction and cDNA Full-Length Amplification
4.3. Bioinformatics Analysis of SpFMRFamide
4.4. Quantitative Real-Time PCR of SpFMRFamide in Different Tissues
4.5. Protein Secretion Activity of SpFMRFamide, SpFLRFamide, and SpGnRH in CHO-K1 Cells
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Anil, M.K.; Andrews, J.; Unnikrishnan, C. Growth, behavior, and mating of pharaoh cuttlefish (Sepia pharaonis Ehrenberg) in captivity. Israeli J. Aquac. Bamidgeh 2005, 57, 25–31. [Google Scholar]
- Chen, D.H.; Zheng, Y.L. The reproduction ethogram of cuttlefish sepia pharaonis. Oceanol. Limnol. Sin. 2013, 44, 931–936. [Google Scholar]
- Espinoza, E.; Carrigan, M.; Thomas, S.G.; Shaw, G.; Edison, A.S. A statistical view of FMRFamide neuropeptide diversity. Mol. Neurobiol. 2000, 21, 35–56. [Google Scholar]
- Krajniak, K.G. Invertebrate FMRFamide related peptides. Protein Pept. Lett. 2013, 20, 647. [Google Scholar] [CrossRef] [PubMed]
- Walker, R.J.; Papaioannou, S.; Holden-Dye, L. A review of FMRFamide and RFamide-like peptides in metazoa. Invertebr. Neurosci. 2009, 9, 111–153. [Google Scholar] [CrossRef] [PubMed]
- Price, D.A.; Greenberg, M.J. Purification and characterization of a cardioexcitatory neuropeptide from the central ganglia of a bivalve mollusc. Prep. Biochem. 1977, 7, 261. [Google Scholar] [CrossRef]
- López-Vera, E.; Aguilar, M.B.; Cotera, E.P.H.D.L. FMRFamide and related peptides in the phylum mollusca. Peptides 2008, 29, 310–317. [Google Scholar] [CrossRef]
- Dockray, G.J. The expanding family of RFamide peptides and their effects on feeding behaviour. Exp. Physiol. 2004, 89, 229–235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salzet, M.; Bulet, P.; Wattez, C.; Malecha, J. FMRFamide-related peptides in the sex segmental ganglia of the Pharyngobdellid leech Erpobdella octoculata. Identification and involvement in the control of hydric balance. Eur. J. Biochem. 1994, 221, 269–275. [Google Scholar] [CrossRef]
- Baratte, B.; Grasmasse, H.; Ricart, G.; Bulet, P.; Dhainautcourtois, N. Isolation and characterization of authentic Phe-Met-Arg-Phe-NH2 and the novel Phe-Thr-Arg-Phe-NH2 peptide from Nereis diversicolor. Eur. J. Biochem. 1991, 198, 627–633. [Google Scholar] [CrossRef]
- Evans, B.D.; Pohl, J.; Kartsonis, N.A.; Calabrese, R.L. Identification of RFamide neuropeptides in the medicinal leech. Peptides 1991, 12, 897–908. [Google Scholar] [CrossRef]
- Grimmelikhuijzen, C.J.P.; Williamson, M.; Hansen, G.N. Neuropeptides in cnidarians. Can. J. Zool. 2002, 80, 1690–1702. [Google Scholar] [CrossRef]
- Anderson, P.A.V.; Thompson, L.F.; Moneypenny, C.G. Evidence for a common pattern of peptidergic innervation of cnidocytes. Biol. Bull. 2004, 207, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Maule, A.G.; Mousley, A.; Marks, N.J.; Day, T.A.; Thompson, D.P.; Geary, T.G.; Halton, D.W. Neuropeptide signaling systems potential drug targets for parasite and pest control. Curr. Top. Med. Chem. 2002, 2, 733–758. [Google Scholar] [CrossRef] [PubMed]
- Nihei, K.I.; Kazuma, K.; Ando, K.; Konno, K. Chemical and biological characterization of a novel neuropeptide in the venom of solitary digger wasp. Toxicon 2012, 60, 95–248. [Google Scholar] [CrossRef]
- Orchard, I.; Lange, A.B.; Bendena, W.G. FMRFamide-related peptides: A multifunctional family of structurally related neuropeptides in insects. Adv. Insect Physiol. 2001, 28, 267–329. [Google Scholar]
- Kuhlman, J.R.; Li, C.; Calabrese, R.L. FMRF-amide-like substances in the leech. II. Bioactivity on the heartbeat system. J. Neurosci. Off. J. Soc. Neurosci. 1985, 5, 2310. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Calabrese, R.L. FMRFamide-like substances in the leech. III. Biochemical characterization and physiological effects. J. Neurosci. Off. J. Soc. Neurosci. 1987, 7, 595–603. [Google Scholar] [CrossRef] [Green Version]
- Hoek, R.M.; Li, K.W.; Van, M.J.; Lodder, J.C.; De, J.M.; Smit, A.B.; van Kesteren, R.E. LFRFamides: A novel family of parasitation-induced RFamide neuropeptides that inhibit the activity of neuroendocrine cells in Lymnaea stagnalis. J. Neurochem. 2005, 92, 1073–1080. [Google Scholar] [CrossRef]
- Kim, K.; Li, C. Expression and regulation of an FMRFamide-related neuropeptide gene family in Caenorhabditis elegans. J. Comp. Neurol. 2004, 475, 540. [Google Scholar] [CrossRef]
- Keating, C.D.; Kriek, N.; Daniels, M.; Ashcroft, N.R.; Hopper, N.A.; Siney, E.J.; Holden-Dye, L.; Burke, J.F. Whole-genome analysis of 60 G protein-coupled receptors in Caenorhabditis elegans by gene knockout with RNAi. Curr. Biol. Cb 2003, 13, 1715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coates, J.C.; De, B.M. Antagonistic pathways in neurons exposed to body fluid regulate social feeding in Caenorhabditis elegans. Nature 2002, 419, 925. [Google Scholar] [CrossRef] [PubMed]
- Holman, G.M.; Cook, B.J.; Nachman, R.J. Isolation, primary structure and synthesis of leucomyosuppressin, an insect neuropeptide that inhibits spontaneous contractions of the cockroach hindgut. Comp. Biochem. Physiol. Part C Comp. Pharmacol. 1986, 85, 329–333. [Google Scholar] [CrossRef]
- Zatylnygaudin, C.; Favrel, P. Diversity of the rfamide peptide family in mollusks. Front. Endocrinol. 2014, 5, 178. [Google Scholar]
- Bechtold, D.A.; Luckman, S.M. The role of RFamide peptides in feeding. J. Endocrinol. 2007, 192, 3. [Google Scholar] [CrossRef]
- Cao, Z.H.; Sun, L.L.; Chi, C.F.; Liu, H.H.; Zhou, L.Q.; Lv, Z.M.; Wu, C.W. Molecular cloning, expression analysis and cellular localization of an LFRFamide gene in the cuttlefish Sepiella japonica. Peptides 2015, 80, 40–47. [Google Scholar] [CrossRef]
- Cristo, C.D.; Delli, B.P.; Cosmo, A.D. Role of FMRFamide in the reproduction of Octopus vulgaris: Molecular analysis and effect on visual input. Peptides 2003, 24, 1525. [Google Scholar] [CrossRef]
- Loi, P.K.; Tublitz, N. Molecular analysis of FMRFamide- and FMRFamide-related peptides (FaRPS) in the cuttlefish Sepia officinalis. J. Exp. Biol. 1997, 200, 1483. [Google Scholar]
- Fisher, T.; Lin, C.H.; Kaczmarek, L.K. The peptide FMRFa terminates a discharge in Aplysia bag cell neurons by modulating calcium, potassium, and chloride conductances. J. Neurophysiol. 1993, 69, 2164. [Google Scholar] [CrossRef]
- Wang, L.; Smyth, A.; Johnsen, A.H.; Zhou, M.; Chen, T.; Walker, B.; Shaw, C. FMRFamide-related peptides (FaRPs): A new family of peptides from amphibian defensive skin secretions. Biochem. Biophys. Res. Commun. 2009, 383, 314. [Google Scholar] [CrossRef]
- Egido, E.M.; Hernández, R.; Leprince, J.; Chartrel, N.; Vaudry, H.; Marco, J.; Silvestre, R.A. 26RFa, a novel orexigenic neuropeptide, inhibits insulin secretion in the rat pancreas. Peptides 2007, 28, 725–730. [Google Scholar] [CrossRef] [PubMed]
- Primeaux, S.D.; Blackmon, C.; Barnes, M.J.; Braymer, H.D.; Bray, G.A. Central administration of the rf-amide peptides, qrfp-26 and qrfp-43, increases high fat food intake in rats. Peptides 2008, 29, 1994–2000. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kriegsfeld, L.J. Driving reproduction: RFamide peptides behind the wheel. Horm. Behav. 2006, 50, 660–666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malin, D.H.; Lake, J.R.; Fowler, D.E.; Hammond, M.V.; Dougherty, T.M. FMRF-NH2-like mammalian peptide precipitates opiate-withdrawal syndrome in the rat. Peptides 1990, 11, 277–280. [Google Scholar] [CrossRef]
- Dong, Z. Fauna Sinica (Mollusca Cephalopoda); Science Press: Beijing, China, 1988. [Google Scholar]
- Luo, J.; Jiang, X.-M.; Liu, M.-H.; Tang, F.; Peng, R.-B. Oogenesis and ovarian development in Sepia lycidas. Acta Hydrobiol. Sin. 2014, 38, 1107–1116. [Google Scholar]
- Jiang, X.M.; Fang-Yao, F.U.; Zheng, L.I.; Feng, X.D. Study on the oogenesis and ovarial development of Sepiella maindroni. J. Fish. China 2007, 31, 607–617. [Google Scholar]
- Boycott, B.B. The functional organization of the brain of the cuttlefish Sepia officinalis. Proc. Royal Soc. Lond. 1961, 153, 503–534. [Google Scholar]
- Dockray, G.J.; Reeve, J.R.; Shively, J.; Gayton, R.J.; Barnard, C.S. A novel active pentapeptide from chicken brain identified by antibodies to FMRFamide. Nature 1983, 305, 328. [Google Scholar] [CrossRef]
- Nagle, G.T. The molluscan cardioactive neuropeptide FMRFamide: Subcellular localization in bivalve ganglia. J. Neurobiol. 1981, 12, 599–611. [Google Scholar] [CrossRef]
- Anctil, M. Bioactivity of FMRFamide and related peptides on a contractile system of the coelenterate Renilla köllikeri. J. Comp. Physiol. B 1987, 157, 31–38. [Google Scholar] [CrossRef]
- Di, C.A.; Di, C.C. Neuropeptidergic control of the optic gland of Octopus vulgaris: FMRF-amide and GnRH immunoreactivity. J. Comp. Neurol. 1998, 398, 1–12. [Google Scholar]
- Di, C.C.; Di, C.A. Neuropeptidergic control of Octopus oviducal gland. Peptides 2007, 28, 163–168. [Google Scholar]
- Rőszer, T.; Kiss-Tóth, É.; Petkó, M.; Szentmiklósi, A.J.; Bánfalvi, G. Phe-met-arg-phe (FMRF) amide is a substrate source of NO synthase in the gastropod nervous system. Cell Tissue Res. 2006, 325, 567–575. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Wang, M.; Wang, W.; Wang, L.; Liu, Z.; Sun, J.; Wang, K.; Song, L. The immunomodulatory function of invertebrate specific neuropeptide FMRFamide in oyster Crassostrea gigas. Fish Shellfish Immunol. 2019, 88, 480–488. [Google Scholar] [CrossRef]
- Li, Y.; Cao, Z.; Li, H.; Liu, H.; Lü, Z.; Chi, C. Identification, characterization, and expression analysis of a fmrfamide-like peptide gene in the common chinese cuttlefish (Sepiella japonica). Molecules 2018, 23, 742. [Google Scholar]
Sample Availability: Samples of the primers and synthetic matured peptides are available from the authors. |
Primer Name | Sequence (5′-3′) | Positions |
---|---|---|
FMRF-F | GCTGAAGATGAAYTGGAAGARGAC | 1019–1042 |
FMRF-R | TCATCRTCTTCACCKCCGCG | 1235–1254 |
FMRF-5′outer | GATGTCTCTAGCTTGCTTCC | 1336–1355 |
FMRF-5′inner | GATAGTGCTGAACAGAAAAAC | 764–784 |
FMRF-3′outer | GAAACCCTGAGGACCAAGAAGCTGACAA | 1188–1215 |
FMRF-3′ inner | GGCGGTGAAGACGATGACGTGAACT | 1238–1262 |
RT-actin-F | TGAGAGGGAGATTGTGCGTG | 815–834 |
RT-actin-R | GAACATAGATTCTGGAGCACGG | 968–989 |
RT-FMRF-F | CCTGAGGACCAAGAAGCTGA | 1193–1212 |
RT-FMRF-R | GCCAAAGAAGGAAGCAAGCT | 1345–1364 |
FMRF-probeF | CCCAAGCGTGATGCGTTGTTGGAGT | 331–349 |
FMRF-probeR | CCGGAACGTTTGCTTCTCAGTCCATC | 515–534 |
Peptide | Sequence |
---|---|
SpFMRFamide | FMRF-NH2 |
SpFLRFamide | FLRF-NH2 |
SpGnRH | pENYHFSNGWHPG-NH2 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Y.; Sun, L.-l.; Wu, J.-h.; Liu, H.-h.; Zheng, L.-b.; Lü, Z.-m.; Chi, C.-f. An FMRFamide Neuropeptide in Cuttlefish Sepia pharaonis: Identification, Characterization, and Potential Function. Molecules 2020, 25, 1636. https://doi.org/10.3390/molecules25071636
Zhu Y, Sun L-l, Wu J-h, Liu H-h, Zheng L-b, Lü Z-m, Chi C-f. An FMRFamide Neuropeptide in Cuttlefish Sepia pharaonis: Identification, Characterization, and Potential Function. Molecules. 2020; 25(7):1636. https://doi.org/10.3390/molecules25071636
Chicago/Turabian StyleZhu, Yang, Lian-lian Sun, Jun-hong Wu, Hui-hui Liu, Li-bing Zheng, Zhen-ming Lü, and Chang-feng Chi. 2020. "An FMRFamide Neuropeptide in Cuttlefish Sepia pharaonis: Identification, Characterization, and Potential Function" Molecules 25, no. 7: 1636. https://doi.org/10.3390/molecules25071636