Characterization of Avian Pathogenic Escherichia coli Isolated from Broiler Breeders with Colibacillosis in Mississippi

Abstract

Avian pathogenic Escherichia coli (APEC) causes colibacillosis in poultry, a leading cause of poultry mortality worldwide. It is crucial to control APEC in broiler breeders as it is vertically transferred to progeny via eggs. However, there is only limited knowledge on the current APEC population in breeders. This study characterized 28 APEC strains isolated from broiler breeders with colibacillosis. The genotypic-virulence characteristics as well as antimicrobial and heavy-metal resistance patterns of the isolates were determined. Results showed that O88 is the most prevalent serogroup and B2 is the predominant phylogenetic group. Among virulence genes, genes for iron acquisition (iroN and iutA), protectins (iss and ompT), and toxin production (hlyF) exhibited the highest prevalence. Further, 93% of the isolates carried at least one antimicrobial resistance gene with highest prevalence for tetracycline gene tetA. Among the isolates, 10.71% exhibited multidrug resistance. All isolates carried at least one heavy-metal resistance gene with the highest prevalence for arsenic gene arsC and the highest resistance towards silver. Our findings provide insight into the characteristics of current APEC populations in broiler breeders in Mississippi. This will help future research on the pathogenesis of APEC and the development of effective prevention and control strategies against APEC in broiler breeders.

1. Introduction

Escherichia coli is a ubiquitous bacterium that typically predominates the gut microflora of humans, animals, and birds [1,2]. Apart from commensal E. coli, there is a large variety of pathogenic strains that cause intestinal and/or extraintestinal infections. Among them, avian pathogenic E. coli (APEC) causes extraintestinal infections in poultry [3,4]. APEC infections in poultry cause the disease, colibacillosis, manifested as perihepatitis, pericarditis, airsacculitis, salpingitis, and peritonitis progressing to septicemia and death [5,6,7]. In fact, this is one of the leading causes of mortality and morbidity in poultry that affects all stages of production and is economically devastating to the industry [3,4,8]. It is estimated that at least 30% of the commercial flocks in the United States are affected by colibacillosis at any point of time, causing a multi-billion-dollar loss to the poultry industry annually [4,6,9].

APEC can infect poultry through different routes. Oral and respiratory routes enable the bacteria to colonize the gastrointestinal and respiratory tracts, and in the presence of stressors, they may migrate to different internal organs and cause infection. Further, the infected birds can horizontally transmit the bacteria to other birds by contaminating feed and water [3,4,5]. Another route of entry is the vaginal route leading to ascending infection of the reproductive tract, causing salpingitis [10]. This can lead to a contamination of the egg while it is formed in the oviduct, leading to vertical transmission from hens to chicks. Sometimes the bacteria may not be pathogenic to the embryo during egg incubation, but the chicks after hatching can act as a source of infection causing horizontal transmission to other chicks in the hatchery, leading to increased first-week mortality [11,12,13]. Previously, APEC was considered as a secondary pathogen causing disease outbreaks due to concurrent virus infections, inappropriate management practices, or insufficient egg hygiene. However, recent research has identified its potential role as a primary pathogen that causes severe disease and high mortality in the absence of stressors [14,15,16].

The pathogenic property of APEC is facilitated by multiple virulence factors such as adhesins, invasins, protectins, iron acquisition mechanisms, toxins, and plasmids [15]. These factors facilitate the attachment, invasion, colonization, replication, and damage of the host cells, as well as evasion from the host immune response [4,17,18]. These virulence factors are encoded by a large array of virulence-associated genes. For instance, papC (P-fimbriae) and tsh (temperature-sensitive hemagglutinin) code for adhesion, and ibeA (invasion of the brain endothelium protein A) code for the invasion of the host system. Genes like iutA (aerobactin siderophore receptor), along with iroN (salmochelin siderophore receptor), enable iron acquisition from the body fluids, while iss (increased serum survival) and ompT (outer membrane protease) provide protection against host immune response. Further, astA (heat-stable enterotoxin) and hlyF (putative avian hemolysin) enable APEC to produce toxins to damage the host’s tissues along with Colicin V (ColV) plasmid genes like cva/cvi [15,19,20]. Several studies have identified combinations of different virulence genes for predicting the disease-causing potential of APEC strains [6,21,22]. However, the high diversity of APEC strains is challenging for ensuring the accuracy of these predictors and, thus, hinders the effective diagnosis, treatment, and prevention of E. coli infections in poultry [23].

The high diversity of APEC strains is further evident in the number of serotypes established. Serotyping is vital for unraveling APEC-virulence mechanisms [5,24]. O (lipopolysaccharide) and H types (flagellar antigen) have been widely used to classify E. coli strains over decades. Currently, there are 188 O and 53 H groups of E. coli identified [25,26]. Some of the O serogroups associated with APEC strains causing disease in poultry are O1, O2, O21, O35, O36, and O78 [16,27,28], while some of the H serogroups are H1, H2, H4, H7, H23, and H10 [29,30,31]. Serotyping, along with phylogenetic grouping, is a better predictor of the virulence potential of E. coli [32]. Most of the extraintestinal pathogenic E. coli, including APEC, are typed under the phylogroups B2 and D, while most of the commensal ones fall under phylogroups A and B1 [33,34,35,36].

Antimicrobial resistance is globally observed in APEC strains [4]. They have been reported to exhibit resistance to a variety of antibiotics, such as tetracyclines, sulfonamides, and aminoglycosides, which are commonly used in the poultry industry to treat APEC infections [4]. The antimicrobial resistance genes, along with the virulence genes, are often associated with plasmids that aid in their transmission between bacteria and, thus, need to be continuously monitored [37]. Also, as the poultry industry is moving towards antibiotic-free production, new effective intervention strategies for APEC control need to be developed.

To develop alternative treatment strategies like vaccines, it is essential to understand the changing properties of APEC and the effects it can have on a bird. Additionally, there is only limited information available on APEC strains from broiler breeders. Over the years, the control of APEC in broiler breeders have been highly neglected; however, recent findings have emphasized the importance of its’ control in broiler breeders as they play a key role in spreading APEC through contaminated eggs to broilers [11,13]. Therefore, the objective of this study is to characterize the virulence properties as well as antimicrobial and heavy-metal resistance patterns of APEC strains isolated from broiler breeders with symptoms of colibacillosis in Mississippi.

2. Materials and Methods

2.1. E. coli Isolation and Identification

Twenty-eight APEC isolates were recovered from the lesions of twenty-eight broiler breeder hens of 1 day to 57 weeks of age diagnosed with colibacillosis. Isolates were recovered from different tissues including the ovary, oviduct, peritoneum, heart, liver, bone marrow, yolk sac, lung, air sac, and hock joint. The isolates were provided by Poultry Research and Diagnostic Laboratory/Mississippi Veterinary Research and Diagnostic Laboratory (PRDL/MVRDL) on blood-agar plates. Individual representative colonies were selected, streaked onto MacConkey agar (Becton, Dickinson and Company, Sparks, MD, USA), and incubated aerobically at 37 °C for 18 to 24 h. Pink lactose-positive colonies, suspected as E. coli strains, were selected and further confirmed positive by real-time PCR for the ybbW gene (Eurofins Genomics LLC, Louisville, KY), which is part of the E. coli core genome [38]. The positive control was ATCC 25922, while DNA from Campylobacter jejuni (ATCC 33560) was used as the negative control. The strains included in this study were collected between 2019 and 2021.

2.2. DNA Isolation

DNA used as a template for PCR amplifications was extracted by boiling-lysis method as described previously [39]. Briefly, an individual representative colony from MacConkey agar was inoculated into Luria–Bertani (LB) broth (Becton, Dickinson and Company, Sparks, MD, USA) and grown for 18 to 24 h at 37 °C with shaking. From this fresh overnight culture, 200 µL was centrifuged, the supernatant was discarded, and the bacterial pellet was resuspended in 150 µL of nuclease-free water (Thermo Fisher Scientific, Vilnius, Lithuania) and then boiled at 98 °C for 5 min. The resulting solution was allowed to cool, centrifuged, and the supernatant was transferred into a new tube to serve as the DNA template and was stored at −20 °C until further use.

2.3. Serotyping

All E. coli isolates were submitted to the College of Veterinary Medicine, University of Georgia for multiplex PCR-based O and H serotyping. A total of 27 O-serogroups and 10 H-serogroups were tested using the primers and PCR conditions as described by Iguchi et al. [40] for O-antigen encoding genes and Banjo et al. [41] for H-antigen encoding genes, respectively (Eurofins Genomics LLC, Louisville, KY, USA). For O-grouping, the reactions were carried out in a final volume of 25 μL under the PCR conditions: 94 °C for 5 min, 30 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 2 min, and a final extension step of 72 °C for 10 min. For H-grouping, the PCR conditions were: 94 °C for 1 min, followed by 25 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min, and then a final extension at 72 °C for 2 min. The positive control was E. coli ATCC 25922, while nuclease-free water was used as the negative control. PCR products were separated and visualized using the Kodak Gel Logic 200 imaging system (Eastman Kodak Co., Rochester, NY, USA) and SYBR safe DNA gel stain (Invitrogen, Carlsbad, CA, USA).

2.4. Phylogenetic Classification

The phylogenetic group of the isolates were determined according to the E. coli phylogenetic-typing method described by Clermont et al. [34] and based on the presence or absence of the genes chuA, yjaA, and DNA fragment TSPE4.C2 (Eurofins Genomics LLC, Louisville, KY). The E. coli strains were then assigned to the phylogenetic groups A, B1, B2, or D. The PCR conditions used were 94 °C for 2 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 45 s, and a final cycle of amplification at 72 °C for 10 min. The positive control was E. coli ATCC 25922, while nuclease-free water was used as the negative control. PCR products were separated and visualized using the Kodak Gel Logic 200 imaging system (Eastman Kodak Co., Rochester, NY, USA) and SYBR safe DNA gel stain (Invitrogen, Carlsbad, CA, USA).

2.5. Screening for Virulence Genes

All isolates were investigated for the presence of ten genes that encode for different virulence factors such as papC, tsh, ibeA, iutA, iroN, iss, ompT, astA, hlyF, and cva/cvi (Eurofins Genomics LLC, Louisville, KY, USA). Of these virulence encoding genes, iroN, ompT, hlyF, iss, and iutA are described as the minimal APEC predictors, and a pentaplex PCR was used for detecting them as described by Johnson et al. [6]. For amplifying the remaining virulence genes, conventional PCR was used. The positive control was E. coli ATCC 25922, while nuclease-free water was used as the negative control. The primer sequences and annealing temperatures used are shown in

Table 1. Primer sequences and annealing temperatures used for the PCR analysis of virulence-associated genes.

Gene	Description	Size (bp)	Primer Sequence (5′-3′)	Annealing Temperature (°C)	References
Virulence genes
iroN	Iron acquisition	553	F: AATCCGGCAAAGAGACGAACCGCCT R: GTTCGGGCAACCCCTGCTTTGACTTT	63	[6]
iutA		302	F: GGCTGGACATCATGGGAACTGG R: CGTCGGGAACGGGTAGAATCG	63	[6]
ompT	Protectins	496	F: TCATCCCGGAAGCCTCCCTCACTACTAT R: TAGCGTTTGCTGCACTGGCTTCTGATAC	63	[6]
iss		323	F: CAGCAACCCGAACCACTTGATG R: AGCATTGCCAGAGCGGCAGAA	63	[6]
hlyF	Toxins	450	F: GGCCACAGTCGTTTAGGGTGCTTACC R: GGCGGTTTAGGCATTCCGATACTCAG	63	[6]
astA		116	F: TGCCATCAACACAGTATATCC R: TCAGGTCGCGAGTGACGGC	57	[42]
papC	Adhesins	501	F: TGATATCACGCAGTCAGTAGC R: CCGGCCATATTCACATAA	60	[42]
tsh		824	F: ACTATTCTCTGCAGGAAGTC R: CTTCCGATGTTCTGAACGT	60	[42]
ibeA	Invasins	171	F: AGGCAGGTGTGCGCCGCGTAC R: TGGTGCTCCGGCAAACCATGC	63	[39]
cva/cvi	Colicin V operon	1181	F: TGGTAGAATGTGCCAGAGCAAG R: GAGCTGTTTGTAGCGAAGCC	60	[42]

. All PCR products were analyzed by agarose-gel electrophoresis using 1% agarose gel (Bio-Rad Laboratories, Inc, Madrid, Spain), stained with SYBR Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, USA), and visualized under UV light.

2.6. Antimicrobial Resistance (AMR) and Heavy-Metal Resistance Patterns

2.6.1. Screening for Antimicrobial and Heavy-Metal Resistance Genes

All isolates were screened by PCR for 11 AMR genes conferring resistance to β-lactamase inhibitors (blaTEM), cephalosporins (blaCTX-M), aminoglycosides (aac3Vla, aph3IA and aadA), tetracyclines (tetA), sulfonamides (dfr7, sul1), quinolones (qnr), phenicols (cat1), and quaternary ammonium compounds (QAC; qacEΔ); and for 11 heavy-metal resistance genes conferring resistance to arsenic (arsC), copper (pcoA, pcoD, and pcoE), silver (silE, silP), mercury (merA), and tellurite (terD, terF, terX, and terY3) (Eurofins Genomics LLC, Louisville, KY, USA). Primer sequences and annealing temperatures used for AMR genes and heavy-metal resistance genes are shown in

Table 2. Primer sequences and annealing temperatures used for PCR analysis of antimicrobial and heavy-metal resistance genes.

Gene	Description	Size (bp)	Primer Sequence (5′-3′)	Annealing Temperature (°C)	References
			Antimicrobial Resistance Genes
blaTEM	β-lactamase inhibitor	558	F: ATGTGCGCGGAACCCCTATTTGTTTA R: AAAAAGCGGTTAGCTCCTTCGGTCCT	55	[44]
blaCTX-M	3rd Generation Cephalosporins	585	F: CGATGTGCAGTACCAGTAA R: TTAGTGACCAGAATCAGCGG	56	[45]
aac3Vla	Aminoglycosides	502	F: GGCACCCGCGACGCCCTGGTCCAAAAG R: GGGCCCGGCGCCGATCGACAGGATTT	55	[44]
aph3IA		378	F: TCGGGCAATCAGGTGCGACAATCTA R: TGCCAGCGCATCAACAATATTTTCACC	55	[44]
aadA		365	F: TAACGGCGCAGTGGCGGTTTTCA R: AAGCTCGCCGCGTTGTTTCATCAAG	55	[6]
tetA	Tetracyclines	372	F: CGGGGCGACTGGGGCGGTAGC R: CAAAGCGCGGCCGGCACCTGT	55	[19]
dfr7	Sulfonamides	214	F: TCTTTAAAGCGCTCACATATAATCAGTG R: ATTTGACCGCCACCAGAGACA	55	[44]
sul1		462	F: CGCCGCTCTTAGACGCCCTGTCC R: CGCCGCTCTTAGACGCCCTGTCC	55	[19]
qnr	Quinolones	440	F: TCGCCGCTGCCGCTTTTATCAGT R: GCCAACAGTCGCGGGAGAAGGTG	55	[45]
cat1	Phenicols	547	F: AGTTGCTCAATGTACCTATAACC R: TTGTAATTCATTAAGCATTCTGCC	56	[46]
			Heavy-Metal Resistance Genes
terD	Tellurite	231	F: CCACTGCGCGGAATTTCCACTCACCAT R: ACGCCGTCCCGTCTGATGTTGACAAG	55	[43]
terX		576	F: ATGCGCCGCCTGCCTGTTTACCTTGTTA R: CGCGCTTGTGCTGCCGGAAGACA	55	[43]
terF		428	F: CCGACAAACTTCCAGAAGATGGGGTAGT R: GAGGCAGCGGTTGCATTTGTACTTGACG	55	[43]
terY3		302	F: CCTGGGGCCGTCAGCGGACCTG R: TCCTTGCTGGTGGCCGTTCATACTTCAT	55	[43]
pcoA	Copper	507	F: ATCCGGAAGGTCAGCACCGTCCATAGAC R: GACCTCGCGGATGTCAGTGGCTACACCT	55	[43]
pcoD		502	F: GGCGCCCAGAATGATAATCGCAACA R: GGGCGTGGCGCTGGCTACACTT	55	[43]
pcoE		385	F: GTGGGGCAGCTTTTGCTCAGTCCAGTGA R: CGAAGCTTTCTTGCCTGCGTCTGATGTG	55	[43]
arsC	Arsenic	268	F: ACCCGCTTCATCAACCACTT R: TGCCGATATGGGGATTTCCG	55	[43]
silP	Silver	603	F: ACACCCCGGCCTGGGCTCCTT R: GTGCGGGCACGGGAACAAACCTC	55	[43]
merA	Mercury	250	F: GATCCGCGCCGCCCATATCGCCCATCTG R: CACGCGCTCGCCGCCGTCGTTGAGTTG	56	[43]

and the heavy-metal resistance genes were previously described by Li et al. [43]. The positive control was ATCC 25922, while nuclease-free water was used as the negative control.

2.6.2. Antimicrobial and Heavy-Metal Susceptibility Testing

Antibiotic Susceptibility Testing

All isolates were tested for antibiotic susceptibility by the Kirby–Bauer disk-diffusion method according to Clinical and Laboratory Standards Institute (CLSI) guidelines at 37 °C for 18–24 h [47]. The antibiotics used extensively for treating E. coli infections in poultry, livestock, and humans were tested, including ampicillin/sulbactam (20/20 µg), cefotaxime (30 µg), gentamicin (10 µg), kanamycin (30 µg), streptomycin (10 µg), tetracycline (30 µg), trimethoprim/sulfamethoxazole (1.25/23.75 µg), nalidixic acid (30 µg), ciprofloxacin (5 µg), and chloramphenicol (30 µg) (Thermo Scientific, Waltham, MA, USA). E. coli ATCC 25922 was used as the reference strain.

QAC and Heavy-Metal Susceptibility Testing

The susceptibilities of the isolates to QAC and heavy metals were evaluated by determining their respective inhibitory concentrations by a broth-microdilution method [48]. The QAC benzalkonium chloride (2 to 256 μg/mL; Sigma Aldrich, Burlington, MA, USA) and the heavy metals, copper (CuSO₄·5H₂O, 32 to 8192 μg/mL; Sigma Aldrich, USA), silver (AgNO₃, 0.5 to 64 μg/mL; Honeywell Fluka, Muskegon, MI, USA), mercury (HgCl₂, 0.84 to 54.4 µg/mL; Labchem, Zelienople, PA, USA), and tellurite (K₂TeO₃, 0.025 to 512 μg/mL; Sigma Aldrich, USA), were tested [48,49,50]. A working solution was prepared in sterile, deionized water, and subsequent concentrations were achieved by two-fold serial dilutions. For all of the E. coli isolates, an inoculum was prepared from fresh overnight culture, adjusted to the turbidity standard of 0.5 McFarland, and diluted 1:200 with LB broth. A volume of 50 μL of the dilutions of QAC/metals and 50 μL of the diluted suspension of bacteria was added to each well of the microtiter plate and incubated for 18 to 24 h at 37 °C. A strain was considered tolerant when it was able to grow at a QAC/metal concentration that inhibits the growth of the E. coli reference strain ATCC 25922 [51].

3. Results

3.1. Serotyping

We were able to identify the O and H-types of 60.7% and 67.9% of the isolates, respectively, using the PCR–based method (Figure 1a,b). O88:H7 was the most prevalent serotype among the typed isolates (19%), followed by O8:H32 and O115:H34 (13%). The other types identified were O88:H21, O166:H21, O8:H9, O55:H9, O25:H4, and O25:H9.

Regarding the O serogroups, the most prevalent among the typed isolates were O88 (31%), followed by O8 and O25 (19%), and O115 (13%). The serogroups O166, O161, O1, and O55 were distributed equally (6%) among the typed isolates. Following H-typing, H9 and H21 (21%) were found to be the most prevalent among the isolates. Other H serogroups found were H4 and H7 (16%), H32 and H34 (10%), and H8 (5%).

3.2. Phylogenetic Classification

Figure 2 shows the distribution of phylogenetic groups identified among the isolates of this study. We were able to type all 28 isolates into different phylogroups. The majority of the isolates were of the phylogenetic group B2 (71.4%). Lower prevalence was observed for the phylogenetic groups D and B1 with 25% and 3.6%, respectively. Of interest, none of the isolates were classified under the phylogenetic group A.

3.3. Screening for Virulence Genes

Figure 3 represents the overall prevalence of virulence-associated genes detected among the 28 APEC isolates. Interestingly, 96.4% of the isolates harbored at least one virulence-associated gene. The genes encoding for iron acquisition (iroN and iutA), protectins (iss and ompT), and toxin production (hlyF) exhibited the highest prevalence, with iroN, ompT, hylF, and iss present in 78.6% and iutA in 68% of the isolates. This is followed by the genes coding for adhesins papC (42.9%) and tsh (39.3%) as well as the colicin V plasmid-operon gene cva/cvi (28.6%). The gene encoding for invasin, ibeA (14.3%), showed the least prevalence among the virulence-associated genes tested.

3.4. AMR and Heavy-Metal Resistance Patterns

3.4.1. Screening for Antimicrobial and Heavy-Metal Resistance Genes

The presence of antimicrobial and heavy-metal resistance genes identified in the 28 isolates are represented in Figure 4a,b. Screening for AMR genes showed the highest prevalence for tetA (68%) followed by aph3IA (50%), aadA (25%), qacEΔ (21.4%), and blaTEM (17.9%). Further, blaCTX-M and sul1 exhibited an equal prevalence of 14.3% among the isolates. On the other hand, qnr, aac3Vla, cat1, and dfr7 were absent among the isolates analyzed.

Among the heavy-metal resistance genes, arsC (100%) was present in all the isolates. The genes silE and silP were present among 35.7 and 21.4% of the isolates, respectively. Further, pcoA, pcoD, and pcoE were present in 14.3, 25, and 17.9% of the isolates, respectively. The mercury-resistance gene, merA, showed 10.7% prevalence among the isolates. In the case of tellurite-resistance genes, terF showed 21.4% and terD showed 14.3% prevalence among the isolates, while terX and terY3 showed the least prevalence among all heavy metal resistance genes, at 7.1%.

Pearson correlation analysis using SAS 9.4 was performed to identify the relationship of AMR genes with virulence and heavy-metal resistance genes as well as serotypes and phylogenetic groups, but no significant correlations were observed.

3.4.2. Antimicrobial and Heavy-Metal Susceptibility Testing

Antibiotic-Susceptibility Testing

Of the 28 isolates tested (Figure 5a), the highest resistance was exhibited towards tetracycline (28.6%) followed by streptomycin (18%), kanamycin (14.3%), and gentamicin (7.1%), with the least resistance exhibited towards sulfamethoxazole-trimethoprim (3.6%). Interestingly, 10.7% of the isolates were multidrug-resistant (resistant to three or more antibiotic classes), and 42.9% of isolates demonstrated intermediate or complete resistance to at least one antibiotic tested. However, 100% isolates were susceptible to ampicillin/ sulbactam, cefotaxime, ciprofloxacin, chloramphenicol, and nalidixic acid.

QAC and Heavy-Metal Susceptibility Testing

Following the broth-microdilution assay (Figure 5b), 14.3% of the isolates were found to be resistant towards QAC. Among the five metals tested, the isolates demonstrated highest resistance towards silver (92.8%), followed by tellurium (21.4%), and mercury (14.3%). Furthermore, 96.4% of the isolates were resistant to at least one of the five metals tested. In contrast, all isolates were susceptible to copper, and all isolates were susceptible to at least two metals tested.

4. Discussion

There is a multitude of data on the characteristics of APEC isolates from broilers and layers worldwide [52,53,54]. However, there is only limited information about the isolates from broiler breeders. Recent studies have emphasized the importance of broiler breeders as reservoirs for APEC infection through vertical transmission to chicks and subsequent horizontal transmission between chicks [11,13,55]. Moreover, the constantly evolving genetic diversity of APEC strains requires their continuous monitoring in all species of poultry [23,56]. To our knowledge, this is the first study to characterize APEC isolates from broiler breeders with colibacillosis in Mississippi, and it provides information on their genotypic-virulence properties as well as antimicrobial and heavy-metal resistance patterns.

Serotyping revealed that O88:H7 was the most prevalent serotype among the APEC isolates typed in this study. Among the O serogroups, O88 was most prevalent, followed by O8, O25, O115, O166, O161, O1, and O55. Historically, in poultry, O1, O2, and O78 were most often correlated with disease-causing APEC worldwide [7]. Specifically, in broiler breeders, O2, O78, and O5 have been reported to be the most prevalent among APEC population [57]. Whereas, in the current study, all of the dominant serogroups detected were new serogroups. A recent study on layers with colibacillosis reported higher prevalence of the O88 serogroup [58]. Furthermore, the new serogroups, O25 and O8, were also observed to be dominant among E. coli isolated from turkeys with cellulitis [4] and poultry with colibacillosis in the United States [16]. Awad et al. [59] found O115 was the most prevalent serogroup among broilers, and none of the historic serogroups were detected. Among the H serogroups, H9 and H21 were highly prevalent among our isolates. The same pattern of prevalence for H9 was found in a study conducted among broilers with colibacillosis in Spain [53]. Previously, Nolan et al. [60] emphasized the diverse nature of APEC possible according to geographical location and disease; thus, it is not surprising to see newly evolving serogroups. Current data, along with findings from recent studies across globe, indicate the changing trend among APEC serotypes causing disease, and this warrants continuous monitoring.

Results of phylogenetic classification revealed a higher prevalence of phylogroup B2, followed by D and B1. Many studies have reported that extraintestinal pathogenic E. coli belongs to phylogroups B2 and D [27,44]. Also, this is consistent with APEC strains isolated from broiler breeders with salpingitis and peritonitis [35]. Similarly, a study on free-range chickens further supports our findings, with majority of APEC isolates belonging to phylogroups B2 and D [61]. Interestingly, in commercial broiler breeders vaccinated using the autogenous E. coli vaccine, the repression of most phylogroups present in the vaccine and a phylogenetic shift to B2 group have been observed among APEC isolates [62]. This, in fact, indicates the opportunistic nature of APEC and its ability to evolve.

The prevalence of virulence genes tested in the present study are highly variable, ranging from 14.3% to 78.6%. The genes encoding for iron acquisition (iroN and iutA), protectins (iss and ompT), and toxin production (hlyF) were found to exhibit the highest prevalence among the isolates. In fact, these five genes are associated with the ColV plasmid [63] and have been identified as genes more predominantly associated with highly pathogenic APEC (APEC minimal predictors) by Johnson et al. [6]. A similarly high prevalence of these five genes was observed in E. coli isolated from broilers and broiler breeders with colibacillosis from different geographical locations, such as Canada [64], Brazil [65,66], Egypt [67], Korea [37], and the United States [16]. On the other hand, the gene cva/cvi, which is also part of the ColV plasmid, was found to have a lower prevalence compared to these five ColV plasmid genes. This was unexpected but was also reported by de Oliveira et al. [39] in turkeys with cellulitis and warrants further investigation. Similarly, the occurrence of other virulence genes analyzed, papC, astA, and tsh, was also less compared to the minimal predictors and was similar to that reported in APEC from broilers in Nepal [42]. The gene encoding the mechanism for invasion, ibeA, was the lowest among the isolates and was comparable to that observed in E. coli isolated from cellulitis lesions in turkeys from Iowa, United States [39]. In general, the current results indicate the virulence-defining nature of the APEC minimal-predictor genes in E. coli isolated from broiler breeders with colibacillosis.

The widespread use of antimicrobials in poultry over the years against multiple pathogens has resulted in antimicrobial resistance [68]. Moreover, the extensive use of antibiotics as growth-promoters in feed over the past 60 years made this a big issue for the poultry industry worldwide [68]. Furthermore, the spread of AMR genes has affected the genetics and mechanisms of resistance of bacteria to combat other antimicrobial agents [69]. In this study, tetA (68%), which encodes for tetracycline resistance, showed the highest prevalence among all of the antibiotic resistance genes tested. This genotypic characteristic was expressed phenotypically following disk-diffusion assay, where the highest resistance was noted towards tetracycline among the isolates. Tetracycline is one of the most widely used antibiotics in poultry and animals [70] and that might be the reason for the high resistance towards this antibiotic among the isolates. Furthermore, our results were consistent with that reported in E. coli isolated from broiler breeders from different parts of the world [64,71,72,73]. Also, similar findings were reported among APEC isolates from broilers in Mississippi [43], Jordan [74], and Egypt [67]. Besides tetA, our isolates showed a high prevalence of genes encoding for aminoglycoside resistance, aph3IA and aadA, and sulfonamide resistance, sul1, and this might be the reason for high kanamycin, streptomycin, and sulfamethoxazole-trimethoprim resistance among the isolates, respectively. On the other hand, the gene coding for resistance to gentamicin, aac3Vla, was absent, but resistance towards this antibiotic was noted among the isolates. There are six clusters of genes that code for gentamicin resistance [75] and some of these genes that we have not tested might be present in our isolates and could be the plausible reason for this resistance among the isolates. A similar resistance pattern towards these antibiotics was previously reported in APEC isolated from broilers and broiler breeders in Canada [64].

Our study also identified the genes encoding for β-lactamase inhibitor blaTEM (Ampicillin and Sulbactam) and third generation cephalosporin blaCTX-M (Cefotaxime) resistance among our isolates. However, no isolates were completely resistant to these antibiotics following disk-diffusion assay. A recent study from Algeria reported the occurrence of blaTEM in E. coli isolated from the ovaries of healthy broiler breeders and that it co-harbored with blaCTX-M. This in fact indicates the vertical-transmission potential of extended-spectrum β-lactamases in the poultry-production pyramid [76]. Additionally, vertical transmission of extended-spectrum β-lactamases-producing E. coli from broiler breeders down the production pyramid was previously reported in Switzerland [77], Finland [78], and Sweden [79]. This is definitely a rising concern that seeks our attention because controlling APEC colonization and infections in broiler breeders might be one of the ways to control the increasing antibiotic resistance in poultry.

Of interest, 10.7% of our isolates were multidrug-resistant, which is a concern considering the control of various bacterial diseases in broiler breeders. A majority of the isolates exhibited multidrug resistance towards tetracycline, kanamycin, streptomycin, and gentamicin. A similar pattern of multidrug resistance was previously reported in broiler breeder APEC isolates from Algeria [76]. Also, several recent studies globally from different poultry species have reported multidrug resistance of APEC to different combinations of antibiotics [43,80,81]. The potential reason for this multidrug resistance is the spread of mobile genetic elements or plasmids carrying genes encoding the antibiotic resistance phenotype and promoting their co-selection, co-resistance, and co-expression [76,82].

The antimicrobial-resistance gene, qacEΔ (QAC), was also identified in our isolates (21.4%). Further, following broth microdilution assay, 14.3% of the isolates exhibited resistance to QAC benzalkonium chloride. Similar results on the prevalence of genes encoding for QAC resistance were found in E. coli collected from omphalitis-affected baby chicks [83] and broilers [43,74]. QAC-based disinfectants are widely used in poultry facilities for cleaning and sanitation. Their inappropriate use, such as long-term exposure of bacteria to subinhibitory concentrations, may lead to the development of resistance [84].

Among 11 heavy-metal resistance genes tested, arsC (100%) was present in all isolates. Even though FDA has currently banned the use of arsenic-based products in poultry feed, this could be the effect of the long-term use of poultry feed supplemented with arsenicals-based antimicrobials for disease control and growth promotion [85]. A similarly high prevalence was also reported in E. coli from broilers in Mississippi [43]. The prevalence of arsC was followed by silver resistance genes, silE (35.7%) and silP (21.4%), in our isolates. Phenotypically, 92.8% of the isolates showed resistance towards silver, which was the highest among all of the heavy metals tested. One possible reason for this difference is that, apart from the two genes tested, there are other genes responsible for silver resistance in E. coli [86]. This is the first report of such high resistance towards silver in broiler breeder APEC isolates. Besides, the genes for tellurite (terF, terD, terY3, and terX) and mercury (merA) resistance were identified in our isolates. These genes were also reported in poultry from China [86], broilers from Mississippi [43], and turkeys from Iowa [39]. Further, genes for copper resistance (pcoA, pcoD, and pcoE) were also identified in the isolates; however, all of the isolates were susceptible to copper. At the moment, copper might be a possible solution for controlling APEC in broiler breeders in Mississippi, however, the presence of these genes is quite concerning, and further studies on the extent of their vertical and horizontal transmission potentials are required.

5. Conclusions

Broiler breeders are critical in the vertical transmission of APEC to progeny and, thus, controlling the disease in breeder flock is crucial to lowering the occurrence of colibacillosis in broilers [11]. Hence, continuous monitoring of APEC isolates from broiler breeders is imperative. To our knowledge, this is the first time APEC isolates were specifically collected and characterized from broiler breeders with colibacillosis in Mississippi. In this study, we identified the serogroup pattern, phylogenetic groups, and the presence of virulence genes, as well as the antimicrobial and metal resistance patterns among the APEC isolates. Results showed that O88 is the most prevalent serogroup, and B2 is the predominant phylogenetic group. Among virulence genes, iroN, iutA, iss, ompT, and hlyF exhibited the highest prevalence. Multidrug resistance and resistance towards heavy metals were also observed among the isolates. These findings provide a reference basis for future research on the pathogenesis of APEC as well as to develop effective intervention strategies in the prevention and control of APEC in broiler breeders.