Next Article in Journal
Transcriptomic Analysis of Anthocyanin and Carotenoid Biosynthesis in Red and Yellow Fruits of Sweet Cherry (Prunus avium L.) during Ripening
Previous Article in Journal
Influence of the 135 bp Intron on Stilbene Synthase VaSTS11 Transgene Expression in Cell Cultures of Grapevine and Different Plant Generations of Arabidopsis thaliana
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 4
10.3390/horticulturae9040515
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of miRNAs Involved in Male Fertility and Pollen Development in Brassica oleracea var. capitata L. by High-Throughput Sequencing

by
Shoukat Sajad
,
Qian Dai
,
Jing Yang
and
Jianghua Song
*
College of Horticulture, Vegetable Genetics, and Breeding Laboratory, Anhui Agricultural University, 130 West Changjiang Road, Hefei 230036, China
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(4), 515; https://doi.org/10.3390/horticulturae9040515
Submission received: 28 February 2023 / Revised: 6 April 2023 / Accepted: 18 April 2023 / Published: 21 April 2023
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Versions Notes

Abstract

:
MicroRNAs (miRNAs) are endogenously expressed, non-coding RNAs that play essential roles in numerous developmental and physiological processes in plants. However, there is a lack of data available on regulating fertility in cabbage (Brassica oleracea var. capitata L.). This study examined the expression of miRNAs during cabbage pollen development using high-throughput sequencing. Two small RNA libraries were constructed from flower buds from the cytoplasmic male-sterile (CMS) line and its maintainer fertile (MF) linee of cabbage, resulting in over 10 million sequence reads. A total of 211 new miRNAs and 7 conserved miRNAs were discovered. Eight randomly chosen miRNAs were found to have differential expression between CMS and MF, as determined by stem-loop quantitative real-time PCR (qRT-PCR). The expression patterns were similar to those detected with Illumina sequencing. Moreover, the possible targets of these putative miRNAs were inferred using a BlastX search and Gene Ontology (GO) analysis. The majority of targets have been indicated to be essential for the development of pollen or other plant parts. The discovery and characterization of miRNAs involved in pollen development in CMS and MF cabbage lines might drive research on the regulatory mechanisms of male sterility, leading to a better understanding of the crucial roles performed by miRNAs in this process.

1. Introduction

Pollen formation in flowering plants comprises a complex series of activities governed by numerous genes [1,2]. Their growth and maturity require precise gene control at the transcriptional and post-transcriptional stages [3]. Pollen production has been linked to various distinct genes in recent years, and complete transcriptome investigations have revealed that the male gametophyte exhibits a complicated gene expression pattern [4,5,6,7]. The primary method of utilizing heterosis is male sterility [8]. Plant male sterility occurs when the male reproductive organs of a flowering plant are unable to produce fertile pollen or rupture, resulting in an abortion. Meanwhile, the female gametes can still develop normally, ensuring a smooth hybridization process [9,10]. There has been an increase in the number of studies conducted on pollen development in recent years, aiming to understand the molecular mechanism of male sterility in different plant species, including rice [11,12], soybean [13], cotton [14], and wheat [15]. MicroRNAs (miRNAs) are a type of small regulatory single-stranded non-coding RNA, typically between 20 and 24 nucleotides (nt) in length, that are ubiquitously present in eukaryotic organisms [16]. MiRNAs regulate their targets in higher plants by cleaving messenger RNA (mRNA) at virtually absolute complementarity sites to the miRNA sequence [17,18]. In particular, it has become clear that miRNAs play crucial roles in a broad range of biological processes, such as developmental regulation, signal transduction, hormone response, and stress tolerance [19,20]. In addition, there is mounting evidence that they play a regulatory role in plant growth and development, specifically in the initiation of leaf sprouting [21], in flowering time regulation [22], in the accumulation of anthocyanins [23], in the response to the phytohormone abscisic acid [24], in root development [25], in cotton fiber elongation [26], in pollen or flower bud development [27,28], and so on. Researchers are now able to utilize sequence-based analysis as a powerful technique for uncovering previously unknown miRNAs in plants, especially those that are tissue-specific or have low abundance, due to the recent advancements in and affordability of high-throughput sequencing technologies [29,30,31]. To date, using experimental and computational methods, more than 38,000 miRNAs have been discovered in various plant species (release 22.1 by mirbase) [1].
Cabbage (Brassica oleracea var. capitata L.), one of the most important vegetable crops in the world, exhibits considerable heterosis, and male sterile lines have been widely used for hybrid seed production. Considering the economic significance of cabbage and its similarity to Arabidopsis, comprehensive genome sequencing projects have been undertaken, and mapping of the genome sequences has been completed [32]. In addition to the importance of cabbage, understanding the molecular processes that lead to cabbage pollen development is critical for controlling male fertility and exploiting heterosis. To date, certain genes have been identified as being involved in pollen development [33,34,35,36,37]. However, the miRNAs involved in cabbage pollen development remain unknown. Using computational analysis or high-throughput sequencing methods, only 10 miRNAs have been found in cabbage [38,39,40]. These miRNAs were expressed in the roots, stems, leaves, and cabbage flowers.
In the current study, we used high-throughput sequencing technology to sequence small RNA populations during cytoplasmic male sterility and maintain fertile lines during pollen development. Further analyses identified 7 known and 211 novel miRNAs based on sequence similarities or the secondary structure of their precursors. We used stem-loop quantitative real-time PCR to verify eight of these miRNAs in flower buds. In addition, we conducted a target function prediction analysis of miRNA using information from a BlastX search and the Gene Ontology (GO) database. The majority of these target genes are vital in plant pollen or anther development. These findings could offer useful knowledge on the possible regulatory function of miRNAs in forming cabbage CMS pollen. As a result, we can understand and explain the molecular mechanism underlying male sterility in cabbage.

2. Materials and Methods

2.1. Plant Materials, Sample Collection, and Total RNA Extraction

A male sterile system in cabbage (Brassica oleracea var. capitata L.), named ‘Bo01-12A/B’ was used in this study. All floral organs of the ‘Bo01-12A/B’ sister line show a completely consistent phenotype, except for the difference in pollen fertility. ‘Bo01-12A’ is a cytoplasmic male sterile line (CMS) that lacks mature pollen, and ‘Bo01-12B’ is the fertile maintainer line (MF) that generates normal mature pollen. The stable CMS line ‘Bo01-12A’ was developed by eight generations of continuous backcrossing, with fertile ‘Bo01-12B’ being self-crossed as its corresponding maintainer line. When reproducing the ‘Bo01-12A/B’ line, half of the resulting offspring were found to be sterile, and the other half were fertile. The sterility traits in male offspring can be sustained over time. All plant materials used in this study were produced at the School of Horticulture’s experimental farm at Anhui Agricultural University. During this investigation, three distinct types of samples were collected from ‘Bo01-12A/B’ plants during the flowering stage. These samples consisted of a combination of flower buds from ‘Bo01-12A’ and ‘Bo01-12B’ and the inflorescences exclusively from ‘Bo01-12B’. The flower buds were divided into five developmental stages based on longitudinal diameter and cytology results [33]. All specimens were pooled from 15 different plants, frozen quickly in liquid nitrogen, and stored at −80 °C until RNA extraction. Three biological replicates were performed. According to the manufacturer’s protocol, total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA).

2.2. Small RNA Library Preparation and Sequencing

To prepare small RNA libraries, 1.5 μg of RNA per sample was employed as the input material, following the manufacturer’s instructions for Illumina TruSeq Small RNA Prep Kits (LC Sciences, Hangzhou, China). To summarize, we ligated small RNAs to 3′ and 5′ RNA adapters. After ligating the adaptor to the RNA, it was transcribed into cDNA and then subjected to PCR. Then, fragments with 16–30 nucleotides (nt) were selected and analyzed using 15% PAGE. Once complete, the PCR products were purified, and the library was created. The small RNA libraries were sequenced using the Illumina Genome Analyzer according to the manufacturer’s protocol (Beijing Genomics Institute, Beijing, China). All sequencing data were collected from 3 independent biological replicates and statistically analyzed.

2.3. Identification of Known and Novel miRNAs

After the raw sequence reads were extracted, they were filtered to remove adapter sequences, impurities, or sequences that were more than 15 to 30 nucleotides in length. The remaining sequences, ranging from 15 to 30 nucleotides, were fed into the ACGT101-miR software for miRNA prediction (edition 4.2; LC Sciences). Initially, the sequences were aligned to the RFam database (RFam contains ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), other ncRNAs, and repeats), and then Bowtie software was utilized to eliminate any clean reads that matched these sequences [41]. The sequencing data were compared to the Brassica database (BRAD) [2] using Brassica oleracea genome sequences. Any sequences that did not match were excluded. We used the miRBase database (miRBase version 22.1) [1] to compare the remaining sequences to those of all known plant miRNAs to determine which ones were conserved in Brassica oleracea. Candidates for conserved miRNAs were sequence pairs with no more than three mismatches. Simultaneously, the unmatched sequences were set aside as potential novel miRNA candidates.
The sequences were compared with the Brassica oleracea genome using a blasting technique to examine both new and established potential miRNAs. The flanking sequences were then utilized to forecast the hairpin folding structure of miRNA precursors, employing the Mireap method BGI, (http://sourceforge.net/projects/mireap/ (accessed on 3 August 2022)). Some requirements must be met by the non-coding sequence that makes up a putative miRNA precursor. The primary and crucial condition is a miRNA/miRNA* pair, which must be detected in high-throughput sequencing. The miRNA* sequence is the complementary reverse sequence to the target miRNA.
Additionally, the stem must contain both the miRNA and miRNA* sequences, and there must be no more than four mismatched nucleotides between them, with four continuous mismatches being unacceptable. Another requirement is that there should be no more than one asymmetric bulge in the miRNA/miRNA* duplex, and each asymmetric bulge must have no more than two bases. Fourth, a duplex with two nucleotide 3′ overhangs is formed when the miRNA and miRNA* are placed on opposite stem-arms (51). Fifth, a putative miRNA precursor requires a minimal folding energy (MFE) and minimal folding energy index (MFEI) less than −0.8 to differentiate itself from other short RNAs. Following the aforementioned thorough analysis, both conserved and new miRNAs were found in Brassica oleracea.

2.4. Stem-Loop Quantitative Real-Time PCR Assay

Stem-loop qRT-PCR is a high-sensitivity and -specificity method for detecting miRNAs in animals and plants [42,43]. To verify the existence and expression of the detected miRNAs, three unknown cabbage miRNAs and five established miRNAs were chosen for qRT-PCR. The stem-loop primers for the qRT-PCR tests were developed using [44]. Total RNA was extracted from floral buds of both lines using Trizol reagent (Takara, Japan) and was reverse transcribed using a PrimeScript RT reagent kit (Takara, Japan) according to the manufacturer’s instructions. The qRT-PCR was performed with specific forward primers and the universal primer using SYBR Premix Ex TaqII Kit (Takara, Japan) on CFX96TM Real-time System (Bio-Rad, Hercules, CA, USA). The 25 μL of PCR mixture included 2.0 μL of cDNA templates, 12.5 μL of 2 × SYBR Premix Ex TaqII, 1.0 μL of forward primer, 1.0 μL of reverse primer and 8.5 μL of ddH2O. The amplification was performed as follows: 95 °C for 30 s, then 5 s at 95 °C and 30 s at 60 °C for 40 cycles. All reactions were performed with three biological replicates and GAPDH was used as an internal reference. All of the primers used in reverse transcription and PCR reactions are listed in Supplementary Table S1. The results were viewed using the CFX Manager Software (Bio-Rad, Hercules, CA, USA) and exported to Microsoft Excel. The 2−ΔΔCt method was used to analyze the relative transcript levels [45].

2.5. miRNA Target Prediction and Analysis

The potential targets of the identified miRNAs were predicted using the online software psRNATarget with default parameters [3]. The scoring system and the criteria established by [46] were then applied to each indicated target gene. Targets for microRNAs were deemed to be sequences with an aggregate score of fewer than 3.0 points. To acquire a deeper insight into the role and categorization of miRNA targets, a BlastX search was conducted against the NCBI protein database to assess the function of potential targets. The results of the GO classification were exhibited in three distinct hierarchies: cellular component, biological process, and molecular function [47].

3. Results

3.1. Morphological and Cytological Characterization of CMS and MF Lines

The sepals, petals, and pistils of both the cytoplasmic male sterile (CMS) and the maintainer fertility (MF) lines of cabbage exhibited normal development (Figure 1A,C). Nevertheless, the anthers of CMS lines were significantly different (Figure 1B,D) compared to the anthers of MF lines (Figure 1A,C). The developmental morphology of pollen was observed using the histochemical method. In the earliest phase of pollen development, the results revealed no significant differences between CMS and MF cabbage lines. The histochemical observation at the later stage of cabbage pollen development showed that tapetum cells gradually degenerated in MF lines, pollen cytoplasmic staining gradually deepened, and a large number of normal mature microspores were evenly distributed in the pollen sac (Figure 1C). However, the anther wall tissue of CMS lines degraded, the pollen sac shrank, the pollen content disappeared, the tapetum cells gradually disintegrated, and the pollen showed abortion (Figure 1D).

3.2. Overview Analysis of Sequences from Small RNAs in Cabbage Flower Buds

To find short RNAs that are differentially expressed during cabbage pollen development, two RNA libraries were created using flower buds from the MF and CMS lines. Deep sequencing of the libraries generated 6,866,663 and 6,895,083 raw sequence reads from MF and CMS cabbages, respectively (Supplementary Table S2). After omitting adapter sequences and filtering out low-quality reads, 5,158,080 (3,269,277 unique sequences) clean MF reads and 5,338,804 (3,269,277 unique sequences) clean CMS reads were retained for further analysis. We used NCBI GenBank and Rfam [4] to categorize and annotate the distinct small RNAs sequences. Among all unique small RNAs, 2.60% in MF and 2.14% in CMS flower buds matched non-coding RNAs, including rRNA, snRNA, snoRNA, and tRNA. The summaries of the various numbers and percentages of these various classes of small RNAs can be found in Table 1. Searching against miRBase 22.1 (http://www.mirbase.org (accessed on 14 June 2022)) identified 0.01% of miRNAs from MF and CMS.
Regarding shared and unique small RNA reads, the MF and CMS libraries contained 35.52 and 37.71 percent of the total small RNAs, respectively. The two libraries shared only 26.77% of the total small RNAs (Figure 2A) and only a small fraction (6.37%) of unique small RNAs (Figure 2B). This revealed the similarity and diversity of small RNAs expressed in the sterile cabbage (CMS) line and its fertile maintainer (MF) during pollen development.
Our library dataset also observed that the length dissemination of these small RNAs is not uniform (Figure 3). Most small RNAs for both libraries were 21–24 nt in length, the typical size range for Dicer-derived products. Consistent with the bulk of the previously published data on other plant species, the 24 nt-long RNAs were the most prevalent, accounting for 48.50% (MF) and 53.43% (CMS) of the total reads [48,49,50].

3.3. Identification of Known miRNAs in Cabbage MF and CMS Line

To locate known miRNAs in cabbage floral buds, all mappable small RNA sequences were blasted against the latest miRBase repository (miRBase 22.1). Currently, the cabbage miRbase 22.1 database [1] contains 10 known miRNAs and 1 miRNA* from 6 miRNA families. The seven known bol-miRNAs (bol-miR157a, bol-miR171a, bol-miR172a, bol-miR172b, bol-miR398a-3p, bol-miR398a-5p, bol-miR824) in miRbase 22.1 were found by high-throughput sequencing in the study. Table 2 displays the data on all the established miRNAs in the MF and CMS libraries.
To some extent, the number of reads indicates miRNA enrichment [51]. Significant discrepancies exist in miRNA read frequencies between the two libraries (Table 2). For example, the expression of bol-miR157a and bol-miR824 were comparatively upregulated in the MF line compared to the CMS line, whereas bol-miR171a, bol-miR172a, bol-miR172b and bol-miR398a indicated down-regulation in the MF line comparative to the CMS line. Meanwhile, the expression level of bol-miR824 was significantly higher than other miRNAs in both libraries. Conversely, specific micro RNAs were expressed at a very low level, as seen by the small number of reads. The number of miRNAs differed between MF and CMS, suggesting that miRNA genes are transcribed differently during pollen development.

3.4. Identification of Novel miRNAs in Cabbage Flower Buds

The capability of miRNA flanking sequences to fold back into a hairpin form is critical for distinguishing potential miRNA from other short RNAs [52]. Consequently, all genomic loci that can fold into secondary structures generate sRNAs deemed miRNA candidates. The secondary structure of each miRNA was predicted and analyzed for a stable stem-loop hairpin. Therefore, 211 putative novel miRNAs were detected from different flower buds in cabbage. Supplementary Table S3 demonstrates the sequence traits and read count of each miRNA detected through high-throughput sequencing. The secondary hairpin structures of the representative miRNAs (bol-miR0001 and bol-miR0023) are shown in Figure 4.
The length distribution of these new candidates is concentrated between 20 and 24 nt, while the length of the precursors varies from 63 to 101 nt, in contrast to previous studies on other plants such as A. thaliana, O. sativa and B. rapa [39,53]. The minimal folding energy of these anticipated pre-miRNAs varied from −18 to −51.5 kcal/mol, which met the criteria of miRNA annotation.
To determine the expression level of miRNAs in a particular tissue, one could count all of the sRNA reads that can be mapped in the corresponding libraries [54]. This study revealed that the number of reads obtained for the predicted new miRNAs varied between 0 and 673, most of which were sequenced fewer than 10 times, as presented in Table S3. Although expressed at relatively low levels, most of the predicted new miRNAs were found to be expressed in the flower buds of both lines, which is consistent with the observation that non-conserved miRNAs tend to have lower expression levels than conserved miRNAs [46]. When comparing the expression levels of new miRNAs in the flower buds of CMS and MF lines, only bol-miR0109-3p exhibited significantly high expression abundance, indicating its crucial function in cabbage pollen development. In addition, we discovered that several miRNAs were exclusively expressed in a single line; for instance, bol-miR0014-3p was only recognized in the sterile line (35 reads), but not in its maintainer line.

3.5. Expression Analysis of Known and Novel miRNAs in Cabbage CMS and MF Line

To confirm candidate miRNAs’ presence and expression patterns during pollen formation, stem-loop qRT-PCR was performed on eight randomly selected miRNAs, including five conserved miRNAs (bol-miR157a, 171a, 172a, 824, 398a-3p) and three new miRNAs (bol-miR0023, 0101, 0142). These miRNAs were identified by qRT-PCR and demonstrated differential expression levels between the two lines (Figure 5). Among the eight differentially expressed miRNAs, bol-miR171a, bol-miR172a, bol-miR398a-3p, bol-miR0023 and bol-miR0101 were expressed at a relatively higher level in the CMS line compared with in the fertile line, whereas bol-miR157a, bol-miR824 and bol-miR0142 were expressed at a much lower level. Their expression patterns detected by qRT-PCR were comparable with those obtained in the high-throughput sequencing results, indicating that the small RNA sequencing data were highly applicable in this research.

3.6. Prediction and GO Function Analysis of miRNA Targets in Cabbage

To gain additional insights into the biological roles of newly discovered and previously identified miRNAs in cabbage, we utilized the psRNATarget program with default parameters (http://plantgrn.noble.org/psRNATarget/ (accessed on 4 October 2022)) to predict potential target genes. As a result, 54 and 763 potential target genes were found for 7 conserved and 211 novel miRNAs (Supplementary Table S4), with an average of 7.71 and 3.62 targets per miRNA molecule, respectively. They were subjected to a BlastX search against the NCBI protein database to annotate the target genes. A significant portion of the predicted target genes were found to be involved in various plant growth and development functions, including transcription factors, growth-regulating factors, F-box domain-containing proteins, AP2-like proteins, Zinc finger proteins, and members of the SBP-box gene family. These proteins play essential roles in plant development [55,56,57]. The fact that some miRNAs (bol-miR172a) have several target sites suggests that these miRNAs have distinct biological roles. Meanwhile, a single gene may potentially be targeted by several miRNAs. For example, a few novel miRNAs target F-box domain-containing proteins, including bol-miR0028-3p, bol-miR0072-5p and bol-miR0082-3p.
All identified targets in this research were subsequently submitted to GO analysis to examine these target genes’ putative functions. Based on their biological and molecular functions, microRNA-targeted genes were organized into functional categories (Figure 6). The result of GO analysis revealed that 31 and 45 GO categories were enriched for novel and conserved miRNA targets, respectively. For conserved miRNAs, 139 genes participated in 9 cellular components, 78 genes were involved in 5 different molecular functions, and 311 genes were involved in 17 biological processes. According to classifications based on biological processes, the miRNA-target genes were associated with 17 biological processes. The most frequent term was “biological regulation”, followed by “developmental process” and “reproductive process”. For novel miRNAs, 1596 target genes were involved in 13 different cellular components, 721 target genes took part in 10 molecular functions, and 2681 target genes contributed to 22 biological processes (Supplementary Table S5). The most frequent terms were “metabolic process”, “cell part”, and “catalytic activity”. These results suggest that cabbage miRNAs are involved in various physiological functions.

4. Discussion

The role of small RNAs in regulating plant development, particularly in the process of anther and pollen formation, has been identified by researchers as significant [55,58]. However, the connection between miRNAs and pollen in B. oleracea has not been reported in any previous research. To identify miRNAs involved in the regulation of pollen development in B. oleracea, two small RNA libraries were constructed using the floral buds of a CMS line and its maintainer line. We found a substantially broader distribution of short RNAs (18–30 nt in length) using high-throughput sequencing, with 24 nt being the most abundant, followed by 21 and 22 nt. These results are consistent with previous research conducted on numerous other species, such as Arabidopsis thaliana [49], Cucumis sativus [59], Medicago truncatula [60], Oryza sativa [61] and Zea mays [62], suggesting that 24 nt is the most common length for small RNAs.
The detection of miRNAs in male-sterile plants such as maize, rice, Brassica campestris ssp. chinensis, Brassica juncea, and cotton has been documented previously [63,64]. This study is the first to utilize deep sequencing of flower buds from both CMS and maintainer lines in cabbage to discover miRNAs and their corresponding targets. The sequencing generated millions of unique sRNA raw reads, ranging from 16 to 30 nucleotides in length, resulting in the identification of 211 novel miRNAs, thereby increasing the number of known miRNAs in cabbage. Additionally, seven conserved miRNAs listed in miRBase 22.1 were also identified in this study.
Furthermore, some of the confirmed miRNAs and their target genes play a role in the regulation of pollen development [65,66]. These studies indicate that miRNA is significant in regulating plant pollen development, but there are few systematic studies on the miRNAs related to cabbage pollen development. The cabbage CMS line shares the same genetic makeup as its fertile maintainer line, making them valuable genetic resources for studying the mechanisms that lead to male sterility and pollen production. The use of high-throughput sequencing to examine the small RNA transcriptome has produced a vast amount of data, enabling the identification of conserved miRNAs and the exploration of novel miRNAs with high specificity and accuracy across various tissues, developmental stages, and environmental conditions. This study uses deep sequencing to perform comparative expression profiling of miRNAs during reproductive development in both the cabbage CMS and maintainer lines. This is the first study to attempt such an approach, which is essential in understanding how sRNA influences cabbage pollen development.
To study the molecular basis resulting in the cabbage male sterility, we constructed two small RNA libraries from the pollen development of CMS and its maintainer line pooled as one sample. The size and distribution of the millions of short RNAs read from the two libraries indicate that the 24 nt class is the most abundant, followed by the 22 nt and 18 nt classes. Similar findings were observed in A. thaliana [67], Oryza sativa [68], Medicago truncatula [69], Arachis hypogaea [70] and Hevea brasiliensis [71]. In the current study, we identified 211 novel miRNAs, increasing the number of distinct miRNAs in cabbage. This study detected seven conserved miRNAs registered in miRBase 22.1. Highly conserved miRNAs, as previously reported [72], are found in all organisms, are expressed at high levels, and are typically observed with members of the same family.
In contrast, non-conserved miRNAs may be unique to a single species, encoded in a single locus, and have low expression levels [73]. Our findings also provide for the number of reads anticipated for novel miRNAs being less than 100, which was in accord with the previous results. Notably, we could not detect the four newly identified miRNA (bol-miR9408, bol-miR9409, bol-miR9410, bol-miR9411) expressed in cabbage leaves from this high-throughput sequencing, perhaps implying that some miRNAs were specific to certain developmental stages, specific tissues, various growth conditions or different genotypes [38]. miRNAs are involved in numerous biochemical and physiological processes, responding to specific regulatory requirements at each developmental stage. It is plausible that iRNA classifications align with miRNAs’ temporal and spatial expression patterns [74]. Our libraries comprise a mixture of flower bud samples from the CMS line and its fertile line. Consequently, the miRNA expression levels in our findings represent the development of cabbage pollen.
Stem-loop qRT-PCR is a technique that enables high-throughput detection and quantification of miRNA expression. This method offers a quick, sensitive, and specific means of profiling miRNA expression [43]. This study employed quantitative RT-PCR using a stem-loop primer to detect the presence of three novels and five previously identified miRNAs in CMS and viable lines. Furthermore, the miRNA expression patterns between CMS and its maintainer reflected the count number of sequences through deep sequencing, suggesting that the small RNA sequencing results were reliable in this study and that miRNA genes would be differentially transcribed during the development of cabbage pollen. Previous reports have suggested a miRNA pathway in plant pollen and anther development. For example, Arabidopsis mature pollen contained miR157, miR171, miR172, and miR824 by utilizing 454 sequencings and the miRCURY array [65,75]. Microarray analysis identified miR171a and miR398 in loblolly pine male gametophyte and rice pollen, respectively [61,76]. Additionally, this investigation confirmed the existence and expression of these conserved miRNA families. Accordingly, many canonical miRNAs are evolutionarily conserved in various plant species; some have conserved functions in regulating the basic cellular and developmental pathways [77].
Understanding the control of miRNAs in plant growth requires the identification of target genes for miRNAs. In the current study, the prediction of probable target genes and GO analysis were carried out to evaluate and characterize the role of miRNA in the development of cabbage pollen. Some miRNAs whose targets have been established were found to play essential roles in the formation of floral organs and pollen. An instance is an interaction between bol-miR157 and the squamosa promoter binding protein-like (SBP) transcription factor, likely involved in gametophyte development [55]. Research has shown that bol-miR172 obstructs the functioning of AP2-like transcription factors by binding to them. These transcription factors are associated with regulating blooming time and developing floral organs in various plant species, such as Arabidopsis, maize, tobacco, and opium poppy [3,78,79,80]. Specific suppression of the mitochondrial electron transport chain has been shown to partially imitate the effects of bol-miR824 on MADs-box genes, which are involved in cytoplasmic homeostasis in CMS stem cells [81]. Both bol-miR0072 and bol-miR0082 target F-box proteins, which are crucial for controlling self-incompatibility as well as determining the identity of floral organs and floral meristems in plants [5,6], and in the control of the circadian clock, photomorphogenesis, and flowering time [80]; similarly, another study by Yan et al. (2015) reported that the important miRNA osa-miR528 might be involved in pollen sterility by targeting F-box proteins [81]. These findings support the notion that miRNAs are present in reproductive organs and might even contribute to the intricate regulatory network that governs pollen formation.

5. Conclusions

In conclusion, our research compared the expression profiles of the miRNAs derived from the CMS line of cabbage and its maintainer line of cabbage. Using high-throughput sequencing techniques, researchers identified several known and novel miRNAs that are expressed during the formation of cabbage flower buds. To verify the variance in the expression of several randomly picked miRNAs between the CMS and its maintainer line, the stem-loop quantitative real-time PCR analysis was employed. Analysis of predicted targets shows a clear role for miRNAs in both pollen development and male sterility. The present work establishes a firm basis for investigating miRNA-mediated regulatory networks in pollen formation. Additional research into the functional roles of these differentially expressed miRNAs and their targets is needed to shed light on the regulatory mechanisms that underlie cabbage’s male sterility.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae9040515/s1, Table S1: The miRNAs primers designed for stem-loop qRT-PCR. Table S2: The filtering for small RNA clean reads in the libraries of MF and CMS. Table S3: Novel miRNAs were identified from the MF and CMS lines in cabbage. Table S4: Predicted targets for identified candidate miRNAs. Table S5: GO analysis of target genes of known and novel miRNAs.

Author Contributions

S.S. and J.S. conceived and designed the work. Q.D. and J.Y. performed the experiments and analyzed the data. S.S. and J.S. wrote and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32272728, 31872108).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. McCormick, S. Control of male gametophyte development. Plant Cell 2004, 16, S142–S153. [Google Scholar] [CrossRef]
  2. Goldberg, R.B.; Beals, T.P.; Sanders, P.M. Anther development: Basic principles and practical applications. Plant Cell 1993, 5, 1217. [Google Scholar] [PubMed]
  3. Aukerman, M.J.; Sakai, H. Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. Plant Cell 2003, 15, 2730–2741. [Google Scholar] [CrossRef] [PubMed]
  4. Hamid, R.; Marashi, H.; Tomar, R.S.; Malekzadeh Shafaroudi, S.; Sabara, P.H. Transcriptome analysis identified aberrant gene expression in pollen developmental pathways leading to CGMS in cotton (Gossypium hirsutum L.). PLoS ONE 2019, 14, e0218381. [Google Scholar] [CrossRef] [PubMed]
  5. Li, C.; Zhang, B. MicroRNAs in control of plant development. J. Cell. Physiol. 2016, 231, 303–313. [Google Scholar] [CrossRef] [PubMed]
  6. Qiu, Y.; Liao, L.; Jin, X.; Mao, D.; Liu, R. Analysis of the meiotic transcriptome reveals the genes related to the regulation of pollen abortion in cytoplasmic male-sterile pepper (Capsicum annuum L.). Gene 2018, 641, 8–17. [Google Scholar] [CrossRef]
  7. Yang, X.; Ye, J.; Zhang, L.; Song, X. Blocked synthesis of sporopollenin and jasmonic acid leads to pollen wall defects and anther indehiscence in genic male sterile wheat line 4110S at high temperatures. Funct. Integr. Genom. 2020, 20, 383–396. [Google Scholar] [CrossRef]
  8. Toriyama, K. Molecular basis of cytoplasmic male sterility and fertility restoration in rice. Plant Biotechnol. 2021, 38, 285–295. [Google Scholar] [CrossRef] [PubMed]
  9. Lasa, J.; Bosemark, N. Male sterility. In Plant Breeding; Springer: Berlin/Heidelberg, Germany, 1993; pp. 213–228. [Google Scholar]
  10. Ishiguro, S.; Ogasawara, K.; Fujino, K.; Sato, Y.; Kishima, Y. Low temperature-responsive changes in the anther transcriptome’s repeat sequences are indicative of stress sensitivity and pollen sterility in rice strains. Plant Physiol. 2014, 164, 671–682. [Google Scholar] [CrossRef]
  11. Chen, L.; Shahid, M.Q.; Wu, J.; Chen, Z.; Wang, L.; Liu, X. Cytological and transcriptome analyses reveal abrupt gene expression for meiosis and saccharide metabolisms that associated with pollen abortion in autotetraploid rice. Mol. Genet. Genom. 2018, 293, 1407–1420. [Google Scholar] [CrossRef]
  12. Li, J.; Han, S.; Ding, X.; He, T.; Dai, J.; Yang, S.; Gai, J. Comparative transcriptome analysis between the cytoplasmic male sterile line NJCMS1A and its maintainer NJCMS1B in soybean (Glycine max (L.) Merr.). PLoS ONE 2015, 10, e0126771. [Google Scholar] [CrossRef] [PubMed]
  13. Yang, L.; Wu, Y.; Zhang, M.; Zhang, J.; Stewart, J.M.; Xing, C.; Wu, J.; Jin, S. Transcriptome, cytological and biochemical analysis of cytoplasmic male sterility and maintainer line in CMS-D8 cotton. Plant Mol. Biol. 2018, 97, 537–551. [Google Scholar] [CrossRef] [PubMed]
  14. Liu, Z.; Li, S.; Li, W.; Liu, Q.; Zhang, L.; Song, X. Comparative transcriptome analysis indicates that a core transcriptional network mediates isonuclear alloplasmic male sterility in wheat (Triticum aestivum L.). BMC Plant Biol. 2020, 20, 10. [Google Scholar] [CrossRef]
  15. Mallory, A.C.; Vaucheret, H. MicroRNAs: Something important between the genes. Curr. Opin. Plant Biol. 2004, 7, 120–125. [Google Scholar] [CrossRef] [PubMed]
  16. Rhoades, M.W.; Reinhart, B.J.; Lim, L.P.; Burge, C.B.; Bartel, B.; Bartel, D.P. Prediction of plant microRNA targets. Cell 2002, 110, 513–520. [Google Scholar] [CrossRef]
  17. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
  18. Navarro, L.; Dunoyer, P.; Jay, F.; Arnold, B.; Dharmasiri, N.; Estelle, M.; Voinnet, O.; Jones, J.D. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 2006, 312, 436–439. [Google Scholar] [CrossRef]
  19. Jones-Rhoades, M.W.; Bartel, D.P.; Bartel, B. MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 2006, 57, 19–53. [Google Scholar] [CrossRef] [PubMed]
  20. Mecchia, M.A.; Debernardi, J.M.; Rodriguez, R.E.; Schommer, C.; Palatnik, J.F. MicroRNA miR396 and RDR6 synergistically regulate leaf development. Mech. Dev. 2013, 130, 2–13. [Google Scholar] [CrossRef]
  21. Nie, S.; Xu, L.; Wang, Y.; Huang, D.; Muleke, E.M.; Sun, X.; Wang, R.; Xie, Y.; Gong, Y.; Liu, L. Identification of bolting-related microRNAs and their targets reveals complex miRNA-mediated flowering-time regulatory networks in radish (Raphanus sativus L.). Sci. Rep. 2015, 5, 14034. [Google Scholar] [CrossRef]
  22. Wu, X.; Ma, Y.; Wu, J.; Wang, P.; Zhang, Z.; Xie, R.; Liu, J.; Fan, B.; Wei, W.; Nie, L.Z. Identification of microRNAs and their target genes related to the accumulation of anthocyanin in purple potato tubers (Solanum tuberosum). Plant Direct 2022, 6, e418. [Google Scholar] [CrossRef] [PubMed]
  23. Duan, H.; Lu, X.; Lian, C.; An, Y.; Xia, X.; Yin, W. Genome-wide analysis of microRNA responses to the phytohormone abscisic acid in Populus euphratica. Front. Plant Sci. 2016, 7, 1184. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, H.; Yu, H.; Tang, G.; Huang, T. Small but powerful: Function of microRNAs in plant development. Plant Cell Rep. 2018, 37, 515–528. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, Y.; Ding, Y.; Liu, J.-Y. Identification and profiling of microRNAs expressed in elongating cotton fibers using small RNA deep sequencing. Front. Plant Sci. 2016, 7, 1722. [Google Scholar] [CrossRef]
  26. Chen, L.; Ding, X.; Zhang, H.; He, T.; Li, Y.; Wang, T.; Li, X.; Jin, L.; Song, Q.; Yang, S. Comparative analysis of circular RNAs between soybean cytoplasmic male-sterile line NJCMS1A and its maintainer NJCMS1B by high-throughput sequencing. BMC Genom. 2018, 19, 663. [Google Scholar] [CrossRef]
  27. Qu, H.; Liu, Y.; Jiang, H.; Liu, Y.; Song, W.; Chen, L. Identification and characterization of miRNAs associated with sterile flower buds in the tea plant based on small RNA sequencing. Hereditas 2021, 158, 26. [Google Scholar] [CrossRef]
  28. Yi, X.; Zhang, Z.; Ling, Y.; Xu, W.; Su, Z. PNRD: A plant non-coding RNA database. Nucleic Acids Res. 2015, 43, D982–D989. [Google Scholar] [CrossRef]
  29. Xie, Y.; Zhang, W.; Wang, Y.; Xu, L.; Zhu, X.; Muleke, E.M.; Liu, L. Comprehensive transcriptome-based characterization of differentially expressed genes involved in microsporogenesis of radish CMS line and its maintainer. Funct. Integr. Genom. 2016, 16, 529–543. [Google Scholar] [CrossRef]
  30. Alptekin, B.; Akpinar, B.A.; Budak, H. A comprehensive prescription for plant miRNA identification. Front. Plant Sci. 2017, 7, 2058. [Google Scholar] [CrossRef]
  31. Liu, S.; Liu, Y.; Yang, X.; Tong, C.; Edwards, D.; Parkin, I.A.; Zhao, M.; Ma, J.; Yu, J.; Huang, S. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes. Nat. Commun. 2014, 5, 3930. [Google Scholar] [CrossRef]
  32. Kang, J.; Guo, Y.; Chen, Y.; Li, H.; Zhang, L.; Liu, H. Upregulation of the AT-hook DNA binding gene BoMF2 in OguCMS anthers of Brassica oleracea suggests that it encodes a transcriptional regulatory factor for anther development. Mol. Biol. Rep. 2014, 41, 2005–2014. [Google Scholar] [CrossRef] [PubMed]
  33. Jiang, J.; Yao, L.; Yu, Y.; Lv, M.; Miao, Y.; Cao, J. PECTATE LYASE-LIKE10 is associated with pollen wall development in Brassica campestris. J. Integr. Plant Biol. 2014, 56, 1095–1105. [Google Scholar] [CrossRef] [PubMed]
  34. Kang, J.; Zhang, G.; Bonnema, G.; Fang, Z.; Wang, X. Global analysis of gene expression in flower buds of Ms-cd1 Brassica oleracea conferring male sterility by using an Arabidopsis microarray. Plant Mol. Biol. 2008, 66, 177–192. [Google Scholar] [CrossRef]
  35. Ma, C.; Zhu, C.; Zheng, M.; Liu, M.; Zhang, D.; Liu, B.; Li, Q.; Si, J.; Ren, X.; Song, H. CRISPR/Cas9-mediated multiple gene editing in Brassica oleracea var. capitata using the endogenous tRNA-processing system. Hortic. Res. 2019, 6, 20. [Google Scholar] [CrossRef]
  36. Ji, R.; Ge, W.; Wang, H.; Zhao, Y.; Feng, H. BrSKS13, a multiple-allele-inherited male sterility-related gene in Chinese cabbage (Brassica rapa L. ssp. pekinensis), affects pollen development and pollination/fertilization process. Gene 2019, 696, 113–121. [Google Scholar] [PubMed]
  37. Lukasik, A.; Pietrykowska, H.; Paczek, L.; Szweykowska-Kulinska, Z.; Zielenkiewicz, P. High-throughput sequencing identification of novel and conserved miRNAs in the Brassica oleracea leaves. BMC Genom. 2013, 14, 801. [Google Scholar] [CrossRef]
  38. Wang, F.; Li, L.; Liu, L.; Li, H.; Zhang, Y.; Yao, Y.; Ni, Z.; Gao, J. High-throughput sequencing discovery of conserved and novel microRNAs in Chinese cabbage (Brassica rapa L. ssp. pekinensis). Mol. Genet. Genom. 2012, 287, 555–563. [Google Scholar] [CrossRef]
  39. He, X.-F.; Fang, Y.-Y.; Feng, L.; Guo, H.-S. Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica. FEBS Lett. 2008, 582, 2445–2452. [Google Scholar] [CrossRef]
  40. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef]
  41. Chen, C.; Ridzon, D.A.; Broomer, A.J.; Zhou, Z.; Lee, D.H.; Nguyen, J.T.; Barbisin, M.; Xu, N.L.; Mahuvakar, V.R.; Andersen, M.R. Real-time quantification of microRNAs by stem–loop RT–PCR. Nucleic Acids Res. 2005, 33, e179. [Google Scholar] [CrossRef]
  42. Varkonyi-Gasic, E.; Wu, R.; Wood, M.; Walton, E.F.; Hellens, R.P. Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 2007, 3, 12. [Google Scholar] [CrossRef] [PubMed]
  43. Kramer, M.F. Stem-loop RT-qPCR for miRNAs. Curr. Protoc. Mol. Biol. 2011, 95, 15.10.1–15.10.15. [Google Scholar] [CrossRef]
  44. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
  45. Chi, X.; Yang, Q.; Chen, X.; Wang, J.; Pan, L.; Chen, M.; Yang, Z.; He, Y.; Liang, X.; Yu, S. Identification and characterization of microRNAs from peanut (Arachis hypogaea L.) by high-throughput sequencing. PLoS ONE 2011, 6, e27530. [Google Scholar] [CrossRef] [PubMed]
  46. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
  47. Sunkar, R.; Zhou, X.; Zheng, Y.; Zhang, W.; Zhu, J.-K. Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biol. 2008, 8, 25. [Google Scholar] [CrossRef]
  48. Rajagopalan, R.; Vaucheret, H.; Trejo, J.; Bartel, D.P. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 2006, 20, 3407–3425. [Google Scholar] [CrossRef]
  49. Song, C.; Wang, C.; Zhang, C.; Korir, N.K.; Yu, H.; Ma, Z.; Fang, J. Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata). BMC Genom. 2010, 11, 431. [Google Scholar] [CrossRef]
  50. Kwak, P.B.; Wang, Q.Q.; Chen, X.S.; Qiu, C.X.; Yang, Z.M. Enrichment of a set of microRNAs during the cotton fiber development. BMC Genom. 2009, 10, 457. [Google Scholar] [CrossRef]
  51. Meyers, B.C.; Axtell, M.J.; Bartel, B.; Bartel, D.P.; Baulcombe, D.; Bowman, J.L.; Cao, X.; Carrington, J.C.; Chen, X.; Green, P.J. Criteria for annotation of plant MicroRNAs. Plant Cell 2008, 20, 3186–3190. [Google Scholar] [CrossRef]
  52. Zhang, B.; Pan, X.; Cox, S.; Cobb, G.; Anderson, T. Evidence that miRNAs are different from other RNAs. Cell. Mol. Life Sci. CMLS 2006, 63, 246–254. [Google Scholar] [CrossRef] [PubMed]
  53. Coenen-Stass, A.M.; Magen, I.; Brooks, T.; Ben-Dov, I.Z.; Greensmith, L.; Hornstein, E.; Fratta, P. Evaluation of methodologies for microRNA biomarker detection by next generation sequencing. RNA Biol. 2018, 15, 1133–1145. [Google Scholar] [PubMed]
  54. Xing, S.; Salinas, M.; Höhmann, S.; Berndtgen, R.; Huijser, P. miR156-targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. Plant Cell 2010, 22, 3935–3950. [Google Scholar] [CrossRef]
  55. Tripathi, R.K.; Bregitzer, P.; Singh, J. Genome-wide analysis of the SPL/miR156 module and its interaction with the AP2/miR172 unit in barley. Sci. Rep. 2018, 8, 7085. [Google Scholar] [CrossRef]
  56. Hacquard, T.; Clavel, M.; Baldrich, P.; Lechner, E.; Pérez-Salamó, I.; Schepetilnikov, M.; Derrien, B.; Dubois, M.; Hammann, P.; Kuhn, L. The Arabidopsis F-box protein FBW2 targets AGO1 for degradation to prevent spurious loading of illegitimate small RNA. Cell Rep. 2022, 39, 110671. [Google Scholar] [CrossRef] [PubMed]
  57. Grant-Downton, R.; Le Trionnaire, G.; Schmid, R.; Rodriguez-Enriquez, J.; Hafidh, S.; Mehdi, S.; Twell, D.; Dickinson, H. MicroRNA and tasiRNA diversity in mature pollen of Arabidopsis thaliana. BMC Genom. 2009, 10, 643. [Google Scholar] [CrossRef] [PubMed]
  58. Kou, S.-J.; Wu, X.-M.; Liu, Z.; Liu, Y.-L.; Xu, Q.; Guo, W.-W. Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues. Plant Cell Rep. 2012, 31, 2151–2163. [Google Scholar] [CrossRef]
  59. Wang, T.; Chen, L.; Zhao, M.; Tian, Q.; Zhang, W.-H. Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing. BMC Genom. 2011, 12, 367. [Google Scholar] [CrossRef]
  60. Wei, L.Q.; Yan, L.F.; Wang, T. Deep sequencing on genome-wide scale reveals the unique composition and expression patterns of microRNAs in developing pollen of Oryza sativa. Genome Biol. 2011, 12, R53. [Google Scholar] [CrossRef]
  61. Li, D.; Wang, L.; Liu, X.; Cui, D.; Chen, T.; Zhang, H.; Jiang, C.; Xu, C.; Li, P.; Li, S. Deep sequencing of maize small RNAs reveals a diverse set of microRNA in dry and imbibed seeds. PLoS ONE 2013, 8, e55107. [Google Scholar] [CrossRef]
  62. Shen, Y.; Zhang, Z.; Lin, H.; Liu, H.; Chen, J.; Peng, H.; Cao, M.; Rong, T.; Pan, G. Cytoplasmic male sterility-regulated novel microRNAs from maize. Funct. Integr. Genom. 2011, 11, 179–191. [Google Scholar] [CrossRef] [PubMed]
  63. Wei, M.; Wei, H.; Wu, M.; Song, M.; Zhang, J.; Yu, J.; Fan, S.; Yu, S. Comparative expression profiling of miRNA during anther development in genetic male sterile and wild type cotton. BMC Plant Biol. 2013, 13, 66. [Google Scholar] [CrossRef] [PubMed]
  64. Jiang, J.; Lv, M.; Liang, Y.; Ma, Z.; Cao, J. Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensi s by high-throughput sequencing and degradome analysis. BMC Genom. 2014, 15, 146. [Google Scholar]
  65. Kasschau, K.D.; Fahlgren, N.; Chapman, E.J.; Sullivan, C.M.; Cumbie, J.S.; Givan, S.A.; Carrington, J.C. Genome-wide profiling and analysis of Arabidopsis siRNAs. PLoS Biol. 2007, 5, e57. [Google Scholar] [CrossRef]
  66. Morin, R.D.; Aksay, G.; Dolgosheina, E.; Ebhardt, H.A.; Magrini, V.; Mardis, E.R.; Sahinalp, S.C.; Unrau, P.J. Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa. Genome Res. 2008, 18, 571–584. [Google Scholar] [CrossRef]
  67. Szittya, G.; Moxon, S.; Santos, D.M.; Jing, R.; Fevereiro, M.P.; Moulton, V.; Dalmay, T. High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families. BMC Genom. 2008, 9, 593. [Google Scholar] [CrossRef] [PubMed]
  68. Zhao, C.-Z.; Xia, H.; Frazier, T.P.; Yao, Y.-Y.; Bi, Y.-P.; Li, A.-Q.; Li, M.-J.; Li, C.-S.; Zhang, B.-H.; Wang, X.-J. Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.). BMC Plant Biol. 2010, 10, 3. [Google Scholar] [CrossRef]
  69. Lertpanyasampatha, M.; Gao, L.; Kongsawadworakul, P.; Viboonjun, U.; Chrestin, H.; Liu, R.; Chen, X.; Narangajavana, J. Genome-wide analysis of microRNAs in rubber tree (Hevea brasiliensis L.) using high-throughput sequencing. Planta 2012, 236, 437–445. [Google Scholar] [CrossRef]
  70. Cuperus, J.T.; Fahlgren, N.; Carrington, J.C. Evolution and functional diversification of MIRNA genes. Plant Cell 2011, 23, 431–442. [Google Scholar] [CrossRef]
  71. Ma, Z.; Coruh, C.; Axtell, M.J. Arabidopsis lyrata small RNAs: Transient MIRNA and small interfering RNA loci within the A. rabidopsis genus. Plant Cell 2010, 22, 1090–1103. [Google Scholar] [CrossRef]
  72. Zhang, J.-Z.; Ai, X.-Y.; Guo, W.-W.; Peng, S.-A.; Deng, X.-X.; Hu, C.-G. Identification of miRNAs and their target genes using deep sequencing and degradome analysis in trifoliate orange [Poncirus trifoliate (L.) Raf]. Mol. Biotechnol. 2012, 51, 44–57. [Google Scholar] [CrossRef] [PubMed]
  73. Chambers, C.; Shuai, B. Profiling microRNA expression in Arabidopsis pollen using microRNA array and real-time PCR. BMC Plant Biol. 2009, 9, 87. [Google Scholar] [CrossRef] [PubMed]
  74. Quinn, C.R.; Iriyama, R.; Fernando, D.D. Expression patterns of conserved microRNAs in the male gametophyte of loblolly pine (Pinus taeda). Plant Reprod. 2014, 27, 69–78. [Google Scholar] [CrossRef] [PubMed]
  75. Axtell, M.J.; Snyder, J.A.; Bartel, D.P. Common functions for diverse small RNAs of land plants. Plant Cell 2007, 19, 1750–1769. [Google Scholar] [CrossRef]
  76. Chen, X. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 2004, 303, 2022–2025. [Google Scholar] [CrossRef]
  77. Unver, T.; Parmaksız, I.; Dündar, E. Identification of conserved micro-RNAs and their target transcripts in opium poppy (Papaver somniferum L.). Plant Cell Rep. 2010, 29, 757–769. [Google Scholar] [CrossRef]
  78. Frazier, T.P.; Xie, F.; Freistaedter, A.; Burklew, C.E.; Zhang, B. Identification and characterization of microRNAs and their target genes in tobacco (Nicotiana tabacum). Planta 2010, 232, 1289–1308. [Google Scholar] [CrossRef]
  79. Yang, J.-H.; Qi, X.-H.; Zhang, M.-F.; Yu, J.-Q. MADS-box genes are associated with cytoplasmic homeosis in cytoplasmic male-sterile stem mustard as partially mimicked by specifically inhibiting mtETC. Plant Growth Regul. 2008, 56, 191–201. [Google Scholar] [CrossRef]
  80. Somers, D.E.; Kim, W.-Y.; Geng, R. The F-box protein ZEITLUPE confers dosage-dependent control on the circadian clock, photomorphogenesis, and flowering time. Plant Cell 2004, 16, 769–782. [Google Scholar] [CrossRef]
  81. Yan, J.; Zhang, H.; Zheng, Y.; Ding, Y. Comparative expression profiling of miRNAs between the cytoplasmic male sterile line MeixiangA and its maintainer line MeixiangB during rice anther development. Planta 2015, 241, 109–123. [Google Scholar] [CrossRef]
Horticulturae 09 00515 g001 550
Figure 1. Phenotypic characterization and cytological characterization of the anther. Anther of MF line (A). Sterile anther of CMS line (B). Bars = 0.5 cm. Fertile anther of MF line (C). Sterile anther of CMS line (D).
Figure 1. Phenotypic characterization and cytological characterization of the anther. Anther of MF line (A). Sterile anther of CMS line (B). Bars = 0.5 cm. Fertile anther of MF line (C). Sterile anther of CMS line (D).
Horticulturae 09 00515 g001
Horticulturae 09 00515 g002 550
Figure 2. Distribution of common and unique small RNAs between MF and CMS libraries. (A) Total sRNA sequences. (B) Unique sRNA sequences.
Figure 2. Distribution of common and unique small RNAs between MF and CMS libraries. (A) Total sRNA sequences. (B) Unique sRNA sequences.
Horticulturae 09 00515 g002
Horticulturae 09 00515 g003 550
Figure 3. The size distribution of the small RNAs between MF and CMS libraries of cabbage.
Figure 3. The size distribution of the small RNAs between MF and CMS libraries of cabbage.
Horticulturae 09 00515 g003
Horticulturae 09 00515 g004 550
Figure 4. Predicted secondary structures of representative novel miRNAs in the flower buds of cabbage. (A) bol-miR0001. (B) bol-miR0023.
Figure 4. Predicted secondary structures of representative novel miRNAs in the flower buds of cabbage. (A) bol-miR0001. (B) bol-miR0023.
Horticulturae 09 00515 g004
Horticulturae 09 00515 g005 550
Figure 5. Expression analysis of 8 miRNAs in MF and CMS of cabbage by qRT-PCR.
Figure 5. Expression analysis of 8 miRNAs in MF and CMS of cabbage by qRT-PCR.
Horticulturae 09 00515 g005
Horticulturae 09 00515 g006 550
Figure 6. Gene categories and distribution of miRNAs targets in cabbage. (A) Gene categories and distribution of target genes for known miRNAs. (B) Gene categories and distribution of target genes for novel miRNAs.
Figure 6. Gene categories and distribution of miRNAs targets in cabbage. (A) Gene categories and distribution of target genes for known miRNAs. (B) Gene categories and distribution of target genes for novel miRNAs.
Horticulturae 09 00515 g006
Table
Table 1. Distribution of small RNAs in cabbage flower buds from MF and CMS lines.
Table 1. Distribution of small RNAs in cabbage flower buds from MF and CMS lines.
CategoryMFCMS
UniquePercentRedundantPercent (%)UniquePercentRedundantPercent (%)
exon_antisense89,7442.84%127,7212.48%84,9562.60%124,3972.33%
exon_sense101,5503.21%136,0542.64%97,8022.99%139,2592.61%
intron_antisense33,7201.07%40,7350.79%30,2720.93%38,3990.72%
intron_sense31,7811.00%46,9200.91%28,2670.86%45,7520.86%
rRNA75,0672.37%385,2777.47%63,9931.96%389,1067.29%
snRNA8200.03%37690.07%8170.02%37920.07%
snoRNA7130.02%35760.07%6890.02%31680.06%
tRNA57680.18%169,1113.28%46120.14%225,7074.23%
miRNA2730.01%89840.17%3030.01%94260.18%
Others2,825,65289.27%4,235,93382.12%2,957,56690.47%4,359,79881.66%
Total3,165,088100.00%5,158,080100.00%3,269,277100.00%5,338,804100.00%
Table
Table 2. Identification of known miRNAs in cabbage flower buds from they MF and CMS lines.
Table 2. Identification of known miRNAs in cabbage flower buds from they MF and CMS lines.
miRNAAccession No.miRNA-SeqCount
MFCMS
bol-miR157aMIMAT0010169TTGACAGAAGATAGAGAGCAC1730868
bol-miR171aMIMAT0010170TTGAGCCGTGCCAATATCACG152256
bol-miR172aMIMAT0010171AGAATCTTGATGATGCTGCAT6981100
bol-miR172bMIMAT0010172AGAATCTTGATGATGCTGCAT5987
bol-miR398a-3pMIMAT0010174TGTGTTCTCAGGTCACCCCTT2140
bol-miR398a-5pMIMAT0010173GGAGTGTCATGAGAACACGGA2335
bol-miR824MIMAT0005597TAGACCATTTGTGAGAAGGGA31242908
miRBase database (miRNA Registry, Release 22.1, March 2018).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sajad, S.; Dai, Q.; Yang, J.; Song, J. Identification of miRNAs Involved in Male Fertility and Pollen Development in Brassica oleracea var. capitata L. by High-Throughput Sequencing. Horticulturae 2023, 9, 515. https://doi.org/10.3390/horticulturae9040515

AMA Style

Sajad S, Dai Q, Yang J, Song J. Identification of miRNAs Involved in Male Fertility and Pollen Development in Brassica oleracea var. capitata L. by High-Throughput Sequencing. Horticulturae. 2023; 9(4):515. https://doi.org/10.3390/horticulturae9040515

Chicago/Turabian Style

Sajad, Shoukat, Qian Dai, Jing Yang, and Jianghua Song. 2023. "Identification of miRNAs Involved in Male Fertility and Pollen Development in Brassica oleracea var. capitata L. by High-Throughput Sequencing" Horticulturae 9, no. 4: 515. https://doi.org/10.3390/horticulturae9040515

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop