Next Article in Journal
Variation in Hydric Response of Two Industrial Hemp Varieties (Cannabis sativa) to Induced Water Stress
Previous Article in Journal
Genome-Wide Identification and Expression Analysis of the fw2.2-like Gene Family in Pear
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 4
10.3390/horticulturae9040430
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Analysis of Gene Expression between Early Maturation Mutant ‘Beni Shogun’ and ‘Fuji’ Cultivars during Fruit Development and Ripening

by
Yu Jin Kim
1,†,
Seunghyun Ban
2,†,
Hye Jeong Cho
1,
A Reum Han
1 and
Cheol Choi
1,*
1
Department of Horticulture, College of Agriculture and Life Science, Kyungpook National University, Daegu 41566, Republic of Korea
2
Smart Farm Research Center, Korea Institute of Science and Technology (KIST), Gangneung 25451, Republic of Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2023, 9(4), 430; https://doi.org/10.3390/horticulturae9040430
Submission received: 23 February 2023 / Revised: 22 March 2023 / Accepted: 25 March 2023 / Published: 25 March 2023
(This article belongs to the Section Developmental Physiology, Biochemistry, and Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
We aimed to compare the maturation and ripening characteristics of two apple cultivars, early maturation mutant ‘Beni Shogun’ and ‘Fuji’. The study revealed that both cultivars reached full bloom on the same day, but ‘Beni Shogun’ matured earlier than ‘Fuji’. In addition, differences were observed in fruit size, length, width, sweetness, acidity, and ethylene production levels. The study also examined the expression patterns of genes involved in ethylene biosynthesis and signal transduction, as well as those involved in auxin signal transduction and transcriptional regulation, to investigate the putative molecular mechanism behind the distinct fruit development, maturation, and ripening. The expression of the MdACO1 gene showed a sharp increase after the maturation date, whereas the expression of the MdACO7 gene was higher in the early and middle stages of fruit development. The clustering analysis provided insights into the correlation between the phenotypic traits and expression levels of the key genes. They were categorized into three clusters, and the third cluster consisted of six phenotypes, including fruit size, length, width, sweetness, starch content, and ethylene production, as well as the one gene MdACO1. These findings suggest that ‘Beni Shogun’ and ‘Fuji’ have distinct fruit development and ripening behaviors, with ‘Beni Shogun’ maturing earlier than ‘Fuji’.

1. Introduction

Somatic mutation is a phenomenon that occurs in plants, causing genetic diversity. However, because it is a process that does not involve reproduction, it cannot be passed on to the next generation [1]. In the case of fruit crops such as apples, grapes, citrus, peaches, plums, pears, and persimmons, they are commonly found in the form of bud sports [2]. Bud sports are discovered by breeders when they exhibit noticeable differences from the original cultivar in fruit color [3,4,5], size [6,7], shape [8,9], and maturation time [10,11,12,13], and can be developed into new cultivars through vegetative propagation. The ‘Fuji’ apple is a widely grown and consumed cultivar with notable commercial importance attributed to its distinct characteristics, such as its crisp texture, sweet flavor, and extended shelf life. Given its significance, studies have been conducted on the cultivar, resulting in the discovery of 91 somatic mutations in ‘Fuji’ [14].
‘Beni Shogun’ is a bud mutation that occurred in ‘Yataka’, a sport of ‘Fuji’ [15,16]. Its full bloom date is similar to ‘Fuji’, but it is known to mature about three weeks earlier than ‘Fuji’ [15], and its color is described as blushed [16]. Because fruit maturation is a complicated process that involves the interaction of multiple genes responsible for fruit development pathways, it poses a significant challenge for research. The current state of research on the reasons behind the earlier maturation of ‘Beni Shogun’ compared to ‘Fuji’ and related factors is still limited. Various approaches have been attempted to uncover the molecular mechanisms of somatic mutation in bud sports related to fruit maturation and ripening, as follows: One such approach involves using PCR-based DNA fingerprinting techniques [17,18,19] to identify differences between the original cultivar and the bud sport, as well as to detect genomic DNA differences [20,21], including SNPs and insertions/deletions. Another approach involves comparing differences in the expression levels of key genes during fruit development [12,13,22].
Hormones are key regulators involved in the major fruit development processes [23,24,25]. In particular, in climacteric fruits such as apples, ethylene plays a very important role in transitioning from fruit maturation to the ripening stage [26,27]. The ethylene biosynthesis pathway involves several enzymes, including 1-aminocyclopropane-1-carboxylate oxidase 1 (ACO1) and serine/threonine-protein kinase CTR1 [27,28]. The downstream effects of ethylene are mediated by transcription factors such as ETHYLENE INSENSITIVE 3-like 1 protein (EIL1) [29] and ethylene-responsive transcription factor RAP2-3-like (ERF1) [30,31]. Understanding the regulation of ethylene in apple fruit maturation and ripening is essential for improving fruit quality and post-harvest storage.
Another hormone, auxin, is widely recognized as a key regulator of fruit growth and maturation [23,28]. In particular, auxin also plays a role in fruit maturation, with a decrease in auxin levels being a prerequisite for this process in many fruit crops [32,33,34]. The interplay between auxin and other hormones, such as ethylene, is also crucial for fruit development [28]. In addition, transcription factors such as NAC [35] and MADS [36,37] are known to have a significant role in fruit development and maturation.
Based on these significant roles of hormones and transcription factors in fruit development and maturation, we selected ethylene-related genes, auxin-related genes, and transcription factors for expression profiling in our study. Ethylene is a key regulator of climacteric fruit ripening, and we focused on the genes involved in ethylene biosynthesis, perception, and downstream signaling, including ACO1, CTR1, EIL1, and ERF1 [26,27,28,29,30,31]. Auxin is also an important hormone for fruit growth and maturation, and we chose to investigate the expression levels of auxin-related genes, which are involved in auxin biosynthesis, transport, and signaling [32,33,34]. Furthermore, we included transcription factors, such as NAC and MADS, which are known to regulate fruit development and maturation [35,36,37]. By analyzing the expression levels of these key genes during fruit development and ripening, we aimed to elucidate the molecular mechanisms underlying the earlier maturation of ‘Beni Shogun’ compared to ‘Fuji’ and provide valuable insights for improving fruit quality and post-harvest storage.

2. Materials and Methods

2.1. Plant Materials

‘Beni Shogun’ and ‘Fuji’ apples were planted in an orchard belonging to the Apple Research Institute of the Rural Development Administration in Gunwi, Korea (N36°17′, E128°28′). For the experiment, a total of nine ‘Beni shogun’ and nine ‘Fuji’ trees were selected. These trees were all 10 years old and grown on M9 rootstock with a slender spindle bush form. The distance between the plants was 2 m, and the inter-row spacing was 4 m. Although the two cultivars had the same full bloom date (23 April 2018), the final harvest time of ‘Beni Shogun’ was more than a month earlier compared with that of the ‘Fuji’ apple. The weather conditions during the experiment from April to October were as follows: Average temperature (°C) for April, 13.2; May, 18.1; June, 22.3; July, 27.4; August, 27.1; September, 19.1; and October, 10.9. Cumulative precipitation (mm) for April, 119; May, 138.5; June, 101.5; July, 166.5; August, 240.5; September, 102.5; and October, 160. Due to the difference in harvest time, sampling was conducted at 10 points for ‘Fuji’ and 7 points for ‘Beni Shogun’ (Figure 1).
At each sampling point, a minimum of nine biological replicates were obtained from three trees for each cultivar for phenotype measurements and three replicates for gene expression comparisons. The fruit was divided into wedges at random, and the peels and cores were removed. The fruit flesh was immediately frozen using liquid nitrogen and stored at −80 °C until RNA extraction. Prior to RNA extraction, the samples were pulverized using a 6870 Freezer/Mill (SPEX SamplePrep., Metuchen, NJ, USA).

2.2. Fruit Quality Analysis and Internal Ethylene Measurement

Eight traits were measured, including fruit weight, fruit height, fruit width, soluble solids content (SSC), starch–sugar interconversion, titratable acidity (TA), firmness, and internal ethylene concentration (IEC). We randomly selected nine fruits to observe their characteristics at different developmental stages. The weight of the fruits was determined using a scale (CPA 4202S, Sartorius, Germany). The length and width of the fruits were measured using digital 500-197-20/30 200mm/ 8” Absolute Digital Digimatic Vernier calipers (Mitutoyo, Kawasaki, Kanagawa, Japan) at the shoulder and equatorial axis, respectively. The SSC was measured using a PAL-1 digital refractometer (Atago, Minato-ku, Tokyo, Japan). The interconversion between starch and sugar was measured using a 5% potassium iodide (KI) solution and 1% iodide and determined using the Cornell starch–iodine index [38], where a score of 1 indicates 100% starch and a score of 8 indicates 0% starch. The juice of the pulp was squeezed, and 1 mL was used for the TA measurement. TA was determined by titrating 5 mL of juice with 0.1 N NaOH. Firmness was measured on 3 sides of each fruit by penetration with a digital fruit firmness tester (FT327, EFFEGI, Alfonsine, Italy) using an 11 mm diameter plunger. Internal ethylene concentration (IEC) was measured at each stage by using gas chromatography (Agilent 7820A, Agilent Technologies, Santa Clara, CA, USA). We inserted a 1 mL syringe into the calyx area and collected 1 mL of gas from inside the core. The collected gas was injected into the inlet and analyzed by the instrument.

2.3. RNA Extraction

RNA was extracted from the ground fruit cortex powder using the cetyltrimethylammonium bromide (CTAB) method [39]. Initially, a tube containing 2 g of powder was mixed with 20 mL of extraction buffer. After that, 12 mL of chloroform: isoamyl alcohol (24:1) (C:I) was added, and the mixture was separated into phases by centrifugation (12,000 RPM, 30 min, 4 °C). Then, an equal volume of C:I was added to the supernatant, and the mixture was centrifuged again (12,000 RPM, 10 min, 4 °C). The supernatant was collected and mixed with an equal volume of C:I and then re-centrifuged. To the resulting supernatant, 5 mL of 8 M lithium chloride (LiCl) was added, and the samples were incubated overnight. After centrifugation and discarding the supernatant, the pellet was dissolved in sodium dodecyl sulfate–Tris-HCl–EDTA (SSTE) buffer and extracted once again with an equal volume of C:I. The pellet was washed with EtOH, dried, and dissolved in Tris-EDTA (TE) buffer. RNA quality and quantity were evaluated using spectrophotometry at 240 nm and electrophoresis with a 0.8% agarose gel.

2.4. Reverse Transcription

A QuantiTect Reverse Transcription Kit (QIAGEN, Germany) was used for reverse transcription. The reverse transcription reaction involved incubation at 42 °C for 10 min and 4 °C for 5 min to eliminate gDNA, followed by 42 °C for 20 min and 95 °C for 3 min to synthesize complementary DNA (cDNA). The resulting cDNA was stored at −20 °C.

2.5. Quantitative Real-Time PCR

Quantitative real-time PCR (Rotor-Gene Q, QIAGEN, Germany) was conducted in triplicate using 50 ng of cDNA as a template in a 20 µL reaction mixture containing 2X qPCRBIO SyGreen Blue Mix Lo-ROX. The reaction involved an initial denaturation at 95 °C for 5 min, followed by 40 cycles of reaction at 95 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s. Genes associated with fruit maturation and ripening were selected, and ACTIN [40] was used as an internal standard. Primer pairs were designed using the Primer-BLAST program of the National Center for Biotechnology Information. In this experiment, qPCR results were validated using Rotor-Gene Q Series Software 2.3.1. The successful amplification was confirmed only in the sample, without amplification in the negative control. The specificity of the qPCR reaction was also checked by examining the melt curve. Only primers that passed these tests were used in this experiment. The gene information and primer sequences are shown in Table 1.

2.6. Statistical Analysis

Significant differences between samples were examined by using Student’s t-test (p < 0.05: *, p < 0.01: **). Statistical analyses were performed using SAS 9.4 software.

3. Results

3.1. Fruit Quality Analysis during Maturation of ‘Beni Shogun’ and ‘Fuji’

Both ‘Fuji’ and ‘Beni Shogun’ reached full bloom on April 23, 2018. The maturation of fruits was determined based on the Cornell starch index [38], and ‘Beni Shogun’ reached the index of 4 at 116 days after full bloom (DAFB), while ‘Fuji’ reached it at 153 DAFB. After this point, the fruits were considered to be in the ripening stage (Figure 2a).
‘Beni Shogun’ fruits reached the starch index of 8 on 22 September, while ‘Fuji’ fruits reached the Cornell starch index of 8 on 22 October, which was 183 DAFB. The fruit weight, length, and width of both ‘Fuji’ and ‘Beni Shogun’ grew similarly until 153 DAFB. Afterward, the size of the ‘Fuji’ fruit grew very slowly, increasing by only about 18 g from 237 g to 255 g over a period of 30 days (Figure 2b–d).
In terms of acidity, ‘Beni Shogun’ was generally lower than ‘Fuji’ at all stages, but there was no significant difference between the two (‘Beni Shogun’, 0.51%; ‘Fuji’, 0.53%; p = 0.26) at the maturation stage (‘Beni Shogun’, 116 DAFB; ‘Fuji’, 153 DAFB) (Figure 2e). As for sweetness measured by SSC, both showed a similar trend in increase until 153 DAFB, but ‘Fuji’ had a higher sugar content (‘Beni Shogun’, 10.1%; ‘Fuji’, 11.9%; p < 0.0001) compared to ‘Beni Shogun’ at the maturation stage (Figure 2f). The firmness of ‘Beni Shogun’ was lower than ‘Fuji’ at all stages, even at the maturation stage (‘Beni Shogun’, 64 N; ‘Fuji’, 70 N; p < 0.0001) (Figure 2g). When comparing the ethylene production levels, a statistically significant difference was observed at the maturation stage (‘Beni Shogun’, 0.7 μL/L; ‘Fuji’, 0.5 μL/L; p = 0.026), and this difference became greater at the last sampling point (‘Beni Shogun’, 4.2 μL/L; ‘Fuji’, 2.2 μL/L; p = 0.0003) (Figure 2h).

3.2. Comparison of Gene Expression Associated with Ethylene

The ripening behaviors of ‘Beni Shogun’ and ‘Fuji’ apples were investigated at the molecular level by comparing the expression levels of genes involved in ethylene biosynthesis. ‘Beni Shogun’ showed continued fruit growth and increased ethylene production even during the ripening stage (136~153 DAFB), while ‘Fuji’ exhibited limited fruit growth and lower ethylene production compared to ‘Beni Shogun’ during the ripening stage (159~183 DAFB) (Figure 2a–c,h).
The ethylene biosynthesis genes, MdACO1 and MdACO7, showed distinct and contrasting patterns from each other. In MdACO1, the expression levels were low in the early and middle stages of fruit development for both apple varieties but sharply increased after the maturation date of each variety, with much higher expression levels in ‘Beni Shogun’ compared to ‘Fuji’ (Figure 3a).
On the other hand, MdACO7 showed higher expression levels in the early and middle stages of fruit development and lower levels after the maturation date, with much higher expression in ‘Fuji’ compared to ‘Beni Shogun’ (Figure 3b). Genes associated with ethylene signal transduction reached their highest expression levels in ‘Beni Shogun’ at 116 DAFB, whereas in ‘Fuji’, they peaked at 136 DAFB, with higher expression levels in ‘Beni Shogun’ at the peak (Figure 3c–e). The difference in expression levels of ethylene-biosynthesis-related genes between the two apple varieties suggests that there are variations in the molecular pathways responsible for ethylene production, which may explain the differences in ripening behavior.

3.3. Comparison of Gene Expression Linked to Auxin and Developmental Regulation

Ethylene is a significant factor in the regulation of ripening, although maturity is not entirely dependent on ethylene alone. MdARF1 is a gene involved in auxin signal transduction, and its expression levels in ‘Beni Shogun’, which suppresses auxin production, continuously increased from the early stages of fruit development to the final sampling period, except at 136 DAFB (Figure 4a).
In contrast, the expression levels of MdARF1 in ‘Fuji’ showed a more monotonic change and peaked at 100 DAFB, which is lower than that of ‘Beni Shogun’ (Figure 4a). Similarly involved in auxin signal transduction, the gene, MdIAA11, which promotes auxin production, showed a decreasing trend after peaking at 46 DAFB in ‘Beni Shogun’, whereas in ‘Fuji’, it peaked at 100 DAFB and then decreased (Figure 4b).
An analysis of the expression levels of transcription factor genes, MdNAC3, MdNAC5, MdMADS7, and MdMADS8, which regulate fruit development and ripening, was also conducted. Both MdNAC3 and MdNAC5 showed a continuous increase in expression levels from the early stage of fruit development, with MdNAC3 reaching its peak at 116 DAFB and being higher in ‘Beni Shogun’, while MdNAC5 reached its peak at 136 DAFB and was higher in ‘Fuji’ (Figure 4c,d). As for the expression levels of MdMADS7 and MdMADS8, ‘Beni Shogun’ reached its highest level at 116 DAFB, while ‘Fuji’ reached its highest level at 136 DAFB and sharply decreased at 153 DAFB (Figure 4e,f). Before that stage, ‘Beni Shogun’ tended to show higher expression levels than ‘Fuji’.

3.4. Clustering Analysis of Phenotyping Trait and Expression Data

When analyzing the phenotypes and expression patterns of key hormone and fruit development and ripening-related transcription factor genes observed in ‘Beni Shogun’ and ‘Fuji’ separately, it is difficult to determine the correlation between them. Therefore, clustering analysis was conducted to discover the hidden relationships between them. As a result, three major clusters were identified: C1, consisting of two genes and two phenotypes, totaling four; C2, consisting of only eight genes; and C3, consisting of six phenotypes and one gene, totaling seven (Figure 5).
In C1, MdACO7 and MdIAA11 were clustered with fruit acidity and firmness, and they both showed higher levels at 100 DAFB in ‘Fuji’ compared to the other stages. Regarding the eight genes belonging to C2, MdNAC5 and MdMADS7 showed relatively high values at 136 DAFB in ‘Fuji’, which is right before the maturation stage of ‘Fuji’, while the other six genes (MdNAC3, MdEIL1, MdMADS8, MdERF1, MdCTR1, and MdARF1) showed high values at 116 DAFB in ‘Beni Shogun’, which is the maturation stage of ‘Beni Shogun’. Such data imply that these genes play a role in fruit maturation. Lastly, C3 included six phenotypes related to fruit size, length, width, sweetness (SSC), starch content, and ethylene production (IEC), along with one gene, MdACO1. This suggests that the MdACO1 gene may have a diverse role in overall fruit quality.

4. Discussion

4.1. Fruit Quality and Ripening Behavior Difference between Two Cultivars

The present study aimed to compare the fruit development, maturation, and ripening characteristics of two apple cultivars, ‘Beni Shogun’ and ‘Fuji’. The results show that both cultivars reached full bloom on the same day in 2018, but ‘Beni Shogun’ matured earlier than ‘Fuji’, reaching the Cornell starch index of 4 at 116 DAFB, while ‘Fuji’ reached it at 153 DAFB (Figure 2a). This early maturation in ‘Beni Shogun’ is consistent with previous results [15]. Moreover, the fruit weight, length, and width of both cultivars grew similarly until 153 DAFB, but ‘Fuji’ grew very slowly afterward (Figure 2b–d). Although there were no statistically significant differences in acidity at the maturation stage (Figure 2e), significant differences were observed in other fruit quality parameters such as SSC, firmness, and IEC, and these differences were observed throughout the entire fruit development process (Figure 2f–h). These findings suggest that ‘Beni Shogun’ and ‘Fuji’ have distinct fruit development and ripening behaviors, with ‘Beni Shogun’ maturing earlier than ‘Fuji’. This information could be useful for growers to optimize the harvest time for ‘Beni Shogun’ and ‘Fuji’. Moreover, the differences in acidity, sugar content, and firmness at different stages of fruit development could help inform the processing and storage of apples for different purposes.

4.2. Putative Molecular Mechanism behind Distinct Fruit Development, Maturation, and Ripening

The regulation of fruit development and ripening is a complex process involving multiple signaling pathways [29,30,31], hormones [23,24,25], and transcription factors [35,36,37]. The results of our study show that the expression patterns of genes involved in ethylene biosynthesis and signal transduction (Figure 3), as well as those involved in auxin signal transduction and transcriptional regulation (Figure 4), differ between the two apple varieties, ‘Beni Shogun’ and ‘Fuji’.
Our analysis of the ethylene biosynthesis genes, MdACO1 and MdACO7, revealed distinct and contrasting patterns from each other in both varieties (Figure 3a,b). The higher expression levels of MdACO1 in ‘Beni Shogun’ compared to ‘Fuji’ after maturation suggest that ‘Beni Shogun’ produces more ethylene than ‘Fuji’, which could explain the difference in ethylene production (Figure 2h). Although ethylene is an important regulator of fruit ripening, it is not the only factor involved. In fact, other factors such as auxin have been found to play a significant role in fruit maturation [23,28]. Specifically, a decrease in auxin levels has been shown to be a prerequisite for the maturation process in diverse fruit crops [32,33,34]. For example, according to Ireland et al. (2013) and Schaffer et al. (2013), the initiation of ripening was postponed and high levels of auxin were maintained during the maturation period in transgenic apples that inhibited the ripening inhibitor (rin)-like MADS-box gene [32,33]. The interplay between auxin and other hormones, such as ethylene, is also crucial for fruit development. It was discovered that the regulation of auxin transport and homeostasis affects the ripening time in apples by potentially activating the ethylene biosynthesis pathway [41]. When the MdARF gene was overexpressed or treated with auxin, ethylene production increased in apples, indicating the effect of auxin on ethylene production in apples [42]. Our analysis of the expression levels of MdARF1 and MdIAA11, genes involved in auxin signal transduction, showed that their expression patterns also differed between the two varieties. In ‘Beni Shogun’, the expression of MdARF1 continuously increased from the early stages of fruit development, while MdIAA11 decreased after peaking at 46 DAFB (Figure 4a,b). In contrast, in ‘Fuji’, both genes showed a more monotonic change, peaking at 100 DAFB for MdARF1 and MdIAA11. These results suggest that the regulation of auxin signaling pathways may also contribute to the differences in ripening behavior between the two varieties.
We also analyzed the expression levels of the transcription factor genes, MdNAC3, MdNAC5, MdMADS7, and MdMADS8, which regulate fruit development and ripening [35,36,37]. The higher expression levels of MdNAC3 in ‘Beni Shogun’ and MdNAC5 in ‘Fuji’ suggest that these transcription factors may play a role in the differential regulation of fruit ripening between the two varieties (Figure 4c,d). Additionally, the higher expression levels of MdMADS7 and MdMADS8 in ‘Beni Shogun’ at 116 DAFB may contribute to the earlier and faster ripening of this variety compared to ‘Fuji’ (Figure 4e,f).

4.3. Clustering Analysis Reveals Hidden Relationships between Gene Expression Patterns and Fruit Phenotypes in Two Apple Varieties

The results of the clustering analysis provide insights into the correlation between the phenotypic traits and expression levels of the key hormone and fruit development and ripening-related genes in ‘Beni Shogun’ and ‘Fuji’ apples. The three major clusters identified suggest that the genes and traits within each cluster may play a role in the same developmental or ripening process.
Cluster C1, consisting of MdACO7 and MdIAA11 along with fruit acidity and firmness, showed high values in ‘Fuji’ at 85 or 100 DAFB (Figure 5). This suggests that the expression levels of these genes may be associated with fruit quality in ‘Fuji’ apples. The eight genes in cluster C2, including MdNAC5 and MdMADS7, showed high expression levels in ‘Fuji’ just before the maturation stage, indicating that these genes may be involved in the regulation of fruit maturation in ‘Fuji’ apples. The six genes in C2, including MdNAC3, MdEIL1, MdMADS8, MdERF1, MdCTR1, and MdARF1, had high expression levels at the maturation stage of ‘Beni Shogun’, indicating their role in the regulation of maturation in this variety. Cluster C3 included six phenotypic traits related to fruit size, length, width, sweetness, starch content, and ethylene production, as well as one gene, MdACO1. This suggests that MdACO1 may play a diverse role in overall fruit quality [23,24,25].
Overall, the clustering analysis provides a more comprehensive understanding of the relationships between gene expression patterns and phenotypic traits in these two apple varieties. These findings could be useful for further studies on apple development and ripening, as well as for developing strategies for apple breeding and genetic modification to enhance fruit quality. We anticipate further studies to be conducted to identify the co-expressed genes with those identified in this study, and to investigate their functions through over-expression or knockdown experiments. Through these additional experiments, it is anticipated that a higher level of understanding of the molecular differences between the commercially valuable ‘Fuji’ apple and its bud mutation ‘Beni Shogun’ will be possible.

4.4. A Working Model for How ‘Beni Shogun’ and ‘Fuji’ Showed Different Fruit Development, Maturation, and Ripening Behaviors

Based on the results and discussions presented above, the following working model can be suggested for the regulation of fruit development, maturation, and ripening in ‘Beni Shogun’ and ‘Fuji’ apples:
(1)
Multiple signaling pathways, hormones, and transcription factors regulate fruit development and ripening in apples.
(2)
Ethylene biosynthesis and signal transduction play an essential role in the ripening process of both ‘Beni Shogun’ and ‘Fuji’ apples.
(3)
The higher expression of MdACO1 in ‘Beni Shogun’ suggests that this variety produces more ethylene than ‘Fuji’, which could explain the difference in ethylene production between the two varieties.
(4)
Auxin also plays a significant role in fruit maturation, and its interplay with ethylene is crucial for fruit development.
(5)
The regulation of auxin transport and homeostasis-related genes including MdARF1 and MdIAA11 affects the ripening time in apples by potentially activating the ethylene biosynthesis pathway.
(6)
The higher expression levels of MdNAC3, MdNAC5, MdMADS7, and MdMADS8 in ‘Beni Shogun’ and MdNAC5 in ‘Fuji’ suggest that these transcription factors may play a role in the differential regulation of fruit ripening between the two varieties.

5. Conclusions

Based on the findings of our study, it is clear that the regulation of fruit development and ripening in apples is a complex process that involves multiple signaling pathways, hormones, and transcription factors. Ethylene biosynthesis and signal transduction are essential for the ripening process in both ‘Beni Shogun’ and ‘Fuji’ apples. Additionally, auxin has a significant role in fruit maturation, and its interplay with ethylene is crucial for fruit development. The regulation of auxin transport and homeostasis-related genes including MdARF1 and MdIAA11 affects the ripening time in apples by potentially activating the ethylene biosynthesis pathway. Finally, the higher expression levels of MdNAC3, MdNAC5, MdMADS7, and MdMADS8 in ‘Beni Shogun’ and MdNAC5 in ‘Fuji’ suggest that these transcription factors may play a role in the differential regulation of fruit ripening between the two varieties. These findings provide molecular insights into the differences in fruit qualities and ripening behaviors of ‘Beni Shogun’ and ‘Fuji’ apples, which could have implications for apple breeding and cultivation practices. However, further studies are needed to determine how these differences can be exploited to improve the quality and shelf-life of apples.

Author Contributions

Conceptualization, Y.J.K. and H.J.C.; methodology, H.J.C. and Y.J.K.; validation, H.J.C. and S.B.; formal analysis, Y.J.K. and H.J.C.; investigation, Y.J.K. and A.R.H.; resources, Y.J.K. and H.J.C.; data curation, S.B.; writing—original draft preparation, S.B.; writing—review and editing, S.B.; visualization, Y.J.K. and S.B.; supervision, C.C.; project administration, C.C.; funding acquisition, C.C. All authors have read and agreed to the published version of the manuscript.

Funding

We were supported by the Cooperative Research Program for Agriculture Science and Technology Development (project no. PJ01311503) of the Rural Development Administration, the Republic of Korea.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Schoen, D.J.; Schultz, S.T. Somatic Mutation and Evolution in Plants. Ann. Rev. Ecol. Evol. Syst. 2019, 50, 49–73. [Google Scholar] [CrossRef]
  2. Foster, T.M.; Aranzana, M.J. Attention sports fans! The far-reaching contributions of bud sport mutants to horticulture and plant biology. Hortic. Res. 2018, 5, 44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Kobayashi, S.; Goto-Yamamoto, N.; Hirochika, H. Retrotransposon-induced mutations in grape skin color. Science 2004, 304, 982. [Google Scholar] [CrossRef] [PubMed]
  4. El-Sharkawy, I.; Liang, D.; Xu, K. Transcriptome analysis of an apple (Malus x domestica) yellow fruit somatic mutation identifies a gene network module highly associated with anthocyanin and epigenetic regulation. J. Exp. Bot. 2015, 66, 7359–7376. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Xu, Y.S.; Jiang, N.; Zhang, Y.G.; Wang, M.; Ren, J.P.; Tao, J.M. A SNP in the promoter region of theVvmybA1 gene is responsible for differences in grape berry color between two related bud sports of grape. Plant Growth Regul. 2017, 82, 457–465. [Google Scholar] [CrossRef]
  6. Nashima, K.; Terakami, S.; Nishitani, C.; Yamamoto, T.; Habu, T.; Takahashi, H.; Nakazono, M.; Isuzugawa, K.; Hanada, T.; Takashina, T.; et al. Transcriptome analysis of flower receptacles of the European pear (Pyrus communis L.) ‘La France’ and its giant fruit sport using next-generation sequencing technology. J. Hortic. Sci. Biotechnol. 2014, 89, 293–300. [Google Scholar] [CrossRef]
  7. Huang, J.; Zhang, G.; Li, Y.; Lyu, M.; Zhang, H.; Zhang, N.; Chen, R. Integrative genomic and transcriptomic analyses of a bud sport mutant ‘Jinzao Wuhe’ with the phenotype of large berries in grapevines. PeerJ 2023, 11, e14617. [Google Scholar] [CrossRef] [PubMed]
  8. Lopez-Girona, E.; Zhang, Y.; Eduardo, I.; Mora, J.R.H.; Alexiou, K.G.; Arus, P.; Aranzana, M.J. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach. Sci. Rep.-UK 2017, 7, 6714. [Google Scholar] [CrossRef] [Green Version]
  9. Tan, Q.; Liu, X.; Gao, H.; Xiao, W.; Chen, X.; Fu, X.; Li, L.; Li, D.; Gao, D. Comparison Between Flat and Round Peaches, Genomic Evidences of Heterozygosity Events. Front. Plant Sci. 2019, 10, 592. [Google Scholar] [CrossRef]
  10. Liu, Y.Z.; Liu, Q.; Xiong, J.J.; Deng, X.X. Difference of a citrus late-ripening mutant (Citrus sinensis) from its parental line in sugar and acid metabolism at the fruit ripening stage. Sci. China Ser. C-Life Sci. 2007, 50, 511–517. [Google Scholar] [CrossRef]
  11. Wang, A.D.; Tan, D.M.; Tatsuki, M.; Kasai, A.; Li, T.Z.; Saito, H.; Harada, T. Molecular mechanism of distinct ripening profiles in ‘Fuji’ apple fruit and its early maturing sports. Postharvest. Biol. Technol. 2009, 52, 38–43. [Google Scholar] [CrossRef]
  12. Ban, S.; El-Sharkawy, I.; Zhao, J.; Fei, Z.; Xu, K. An apple somatic mutation of delayed fruit maturation date is primarily caused by a retrotransposon insertion-associated large deletion. Plant J. 2022, 111, 1609–1625. [Google Scholar] [CrossRef]
  13. Zhang, M.; Du, T.T.; Yin, Y.R.; Cao, H.Y.; Song, Z.H.; Ye, M.; Liu, Y.T.; Shen, Y.H.; Zhang, L.B.; Yang, Q.; et al. Synergistic effects of plant hormones on spontaneous late-ripening mutant of ‘Jinghong’ peach detected by transcriptome analysis. Food Qual. Saf. 2022, 6. [Google Scholar] [CrossRef]
  14. Du, X.; Wang, Y.; Liu, M.; Liu, X.; Jiang, Z.; Zhao, L.; Tang, Y.; Sun, Y.; Zhang, X.; Liu, D.; et al. The assessment of epigenetic diversity, differentiation, and structure in the ‘Fuji’ mutation line implicates roles of epigenetic modification in the occurrence of different mutant groups as well as spontaneous mutants. PLoS ONE 2020, 15, e0235073. [Google Scholar] [CrossRef]
  15. Dong, Q.L.; Yan, Z.Y.; Liu, Z.; Yao, Y.X. Early ripening events caused by bud mutation in Beni Shogun apple. Russ. J. Plant Physl+ 2011, 58, 439–447. [Google Scholar] [CrossRef]
  16. Cho, H.J.; Kim, G.H.; Choi, C. Differential gene expression and epigenetic analyses between striped and blushed skinned sports of ‘Fuji’ apple. Sci. Hortic.-Amsterdam. 2020, 261, 108944. [Google Scholar] [CrossRef]
  17. Hubbard, M.; Kelly, J.; Rajapakse, S.; Abbott, A.; Ballard, R. Restriction-Fragment-Length-Polymorphisms in Rose and Their Use for Cultivar Identification. Hortscience 1992, 27, 172–173. [Google Scholar] [CrossRef] [Green Version]
  18. Aranzana, M.J.; Carbo, J.; Arus, P. Microsatellite variability in peach [Prunus persica (L.) Batsch]: Cultivar identification, marker mutation, pedigree inferences and population structure. Appl. Genet. 2003, 106, 1341–1352. [Google Scholar] [CrossRef]
  19. Oliveira, E.J.D.; Costa, J.L.; Santos, L.F.D.; Carvalho, F.M.d.; Silva, A.d.S.; Dantas, J.L.L. Molecular characterization of papaya genotypes using AFLP markers. Rev. Bras. Frutic. 2011, 33, 849–858. [Google Scholar] [CrossRef]
  20. Lee, H.S.; Kim, G.H.; Kwon, S.I.; Kim, J.H.; Kwon, Y.S.; Choi, C. Analysis of ‘Fuji’ apple somatic variants from next-generation sequencing. Genet. Mol. Res. 2016, 15, gmr.15038185. [Google Scholar] [CrossRef]
  21. Fernandez, I.M.A.; Saski, C.A.; Manganaris, G.A.; Gasic, K.; Crisosto, C.H. Genomic Sequencing of Japanese Plum (Prunus salicina Lindl.) Mutants Provides a New Model for Rosaceae Fruit Ripening Studies. Front. Plant Sci. 2018, 9, 21. [Google Scholar] [CrossRef] [Green Version]
  22. Wei, L.Z.; Cao, Y.H.; Cheng, J.H.; Xiang, J.; Shen, B.W.; Wu, J. Comparative transcriptome analyses of a table grape ‘Summer Black’ and its early-ripening mutant ‘Tiangong Moyu’ identify candidate genes potentially involved in berry development and ripening. J. Plant Interact. 2020, 15, 213–222. [Google Scholar] [CrossRef]
  23. Kumar, R.; Khurana, A.; Sharma, A.K. Role of plant hormones and their interplay in development and ripening of fleshy fruits. J. Exp. Bot. 2014, 65, 4561–4575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Forlani, S.; Masiero, S.; Mizzotti, C. Fruit ripening: The role of hormones, cell wall modifications, and their relationship with pathogens. J. Exp. Bot. 2019, 70, 2993–3006. [Google Scholar] [CrossRef]
  25. Fenn, M.A.; Giovannoni, J.J. Phytohormones in fruit development and maturation. Plant J. 2021, 105, 446–458. [Google Scholar] [CrossRef] [PubMed]
  26. Costa, F.; Stella, S.; Van de Weg, W.E.; Guerra, W.; Cecchinel, M.; Dalla Via, J.; Koller, B.; Sansavini, S. Role of the genes Md-ACO1 and Md-ACS1 in ethylene production and shelf life of apple (Malus domestica Borkh). Euphytica 2005, 141, 181–190. [Google Scholar] [CrossRef]
  27. Yang, X.T.; Song, J.; Campbell-Palmer, L.; Fillmore, S.; Zhang, Z.Q. Effect of ethylene and 1-MCP on expression of genes involved in ethylene biosynthesis and perception during ripening of apple fruit. Postharvest. Biol. Technol. 2013, 78, 55–66. [Google Scholar] [CrossRef]
  28. Busatto, N.; Tadiello, A.; Trainotti, L.; Costa, F. Climacteric ripening of apple fruit is regulated by transcriptional circuits stimulated by cross-talks between ethylene and auxin. Plant Signal. Behav. 2017, 12, e1268312. [Google Scholar] [CrossRef] [Green Version]
  29. An, J.P.; Wang, X.F.; Li, Y.Y.; Song, L.Q.; Zhao, L.L.; You, C.X.; Hao, Y.J. EIN3-LIKE1, MYB1, and ETHYLENE RESPONSE FACTOR3 Act in a Regulatory Loop That Synergistically Modulates Ethylene Biosynthesis and Anthocyanin Accumulation. Plant Physiol. 2018, 178, 808–823. [Google Scholar] [CrossRef] [Green Version]
  30. Feng, J.X.; Liu, D.; Pan, Y.; Gong, W.; Ma, L.G.; Luo, J.C.; Deng, X.W.; Zhu, Y.X. An annotation update via cDNA sequence analysis and comprehensive profiling of developmental, hormonal or environmental responsiveness of the Arabidopsis AP2/EREBP transcription factor gene family. Plant Mol. Biol. 2005, 59, 853–868. [Google Scholar] [CrossRef]
  31. Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [Green Version]
  32. Ireland, H.S.; Yao, J.L.; Tomes, S.; Sutherland, P.W.; Nieuwenhuizen, N.; Gunaseelan, K.; Winz, R.A.; David, K.M.; Schaffer, R.J. Apple SEPALLATA1/2-like genes control fruit flesh development and ripening. Plant J. 2013, 73, 1044–1056. [Google Scholar] [CrossRef] [PubMed]
  33. Schaffer, R.J.; Ireland, H.S.; Ross, J.J.; Ling, T.J.; David, K.M. SEPALLATA1/2-suppressedmature apples have lowethylene, high auxin and reduced transcription of ripening-related genes. Aob. Plants 2013, 5, pls047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Liao, X.; Li, M.; Liu, B.; Yan, M.; Yu, X.; Zi, H.; Liu, R.; Yamamuro, C. Interlinked regulatory loops of ABA catabolism and biosynthesis coordinate fruit growth and ripening in woodland strawberry. Proc. Natl. Acad. Sci. USA 2018, 115, E11542–E11550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Forlani, S.; Mizzotti, C.; Masiero, S. The NAC side of the fruit: Tuning of fruit development and maturation. BMC Plant Biol. 2021, 21, 238. [Google Scholar] [CrossRef]
  36. Wang, B.; Hu, W.; Fang, Y.; Feng, X.; Fang, J.; Zou, T.; Zheng, S.; Ming, R.; Zhang, J. Comparative Analysis of the MADS-Box Genes Revealed Their Potential Functions for Flower and Fruit Development in Longan (Dimocarpus longan). Front. Plant Sci. 2021, 12, 813798. [Google Scholar] [CrossRef]
  37. Dong, T.; Chen, G.; Tian, S.; Xie, Q.; Yin, W.; Zhang, Y.; Hu, Z. A non-climacteric fruit gene CaMADS-RIN regulates fruit ripening and ethylene biosynthesis in climacteric fruit. PLoS ONE 2014, 9, e95559. [Google Scholar] [CrossRef]
  38. Blanpied GD, S.K. Predicting harvest date windows for apples. In Information Bulletin 221, Cornell Cooperative Extension; Cornell University: Ithaca, NY, USA, 1992. [Google Scholar]
  39. Chang, S.; Puryear, J.; Cairney, J. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 1993, 11, 113–116. [Google Scholar] [CrossRef]
  40. Singh, V.; Weksler, A.; Friedman, H. Different Preclimacteric Events in Apple Cultivars with Modified Ripening Physiology. Front. Plant Sci. 2017, 8, 1502. [Google Scholar] [CrossRef] [Green Version]
  41. Shin, S.; Lee, J.; Rudell, D.; Evans, K.; Zhu, Y.M. Transcriptional Regulation of Auxin Metabolism and Ethylene Biosynthesis Activation During Apple (Malus x domestica) Fruit Maturation. J. Plant Growth Regul. 2016, 35, 655–666. [Google Scholar] [CrossRef]
  42. Yue, P.; Lu, Q.; Liu, Z.; Lv, T.; Li, X.; Bu, H.; Liu, W.; Xu, Y.; Yuan, H.; Wang, A. Auxin-activated MdARF5 induces the expression of ethylene biosynthetic genes to initiate apple fruit ripening. New Phytol. 2020, 226, 1781–1795. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Horticulturae 09 00430 g001 550
Figure 1. Surface and cross-sectional images of fruit at ten developmental stages. ‘Fuji’ and ‘Beni Shogun’ apples were harvested, periodically after full bloom (DAFB), at days 25, 46, 85, 100, 116, 136, 153, 159, 169, and 183 from trees grown at the Apple Research Institute in Gunwi, Republic of Korea. The full bloom date was 23 April 2018. The last developmental stage is the commercial harvest period for each cultivar. Bars represent 1 cm.
Figure 1. Surface and cross-sectional images of fruit at ten developmental stages. ‘Fuji’ and ‘Beni Shogun’ apples were harvested, periodically after full bloom (DAFB), at days 25, 46, 85, 100, 116, 136, 153, 159, 169, and 183 from trees grown at the Apple Research Institute in Gunwi, Republic of Korea. The full bloom date was 23 April 2018. The last developmental stage is the commercial harvest period for each cultivar. Bars represent 1 cm.
Horticulturae 09 00430 g001
Horticulturae 09 00430 g002 550
Figure 2. Fruit quality changes in ‘Fuji’ and ‘Beni Shogun’ during developmental stages. Starch–iodine index (a), fruit weight (b), length (c), width (d), titratable acidity (TA) (e), soluble solids content (SSC) (f), firmness (g), and internal ethylene concentration (IEC) (h) were measured until maturity. The starch–iodine index values are based on the Cornell index chart. Error bars indicate the ±SE (n = 9), where the IEC and starch–iodine index were n = 15. Single stars (*) indicate statistical significance at p < 0.05, while double stars (**) indicate significance at p < 0.01.
Figure 2. Fruit quality changes in ‘Fuji’ and ‘Beni Shogun’ during developmental stages. Starch–iodine index (a), fruit weight (b), length (c), width (d), titratable acidity (TA) (e), soluble solids content (SSC) (f), firmness (g), and internal ethylene concentration (IEC) (h) were measured until maturity. The starch–iodine index values are based on the Cornell index chart. Error bars indicate the ±SE (n = 9), where the IEC and starch–iodine index were n = 15. Single stars (*) indicate statistical significance at p < 0.05, while double stars (**) indicate significance at p < 0.01.
Horticulturae 09 00430 g002
Horticulturae 09 00430 g003 550
Figure 3. Relative gene expression patterns related to ethylene in ‘Beni Shogun’ and ‘Fuji’ during fruit development. Genes are grouped as ethylene synthesis (a,b) (MdACO1 and MdACO7) and signal transduction (c–e) (MdCTR1, MdEIL1, and MdERF1) genes. All genes were analyzed by using qRT-PCR and normalized relative to the expression reference gene, ACTIN. Relative expression levels were normalized to 25 DAFB values. Error bars indicate the ±SE (n = 3). Double stars (**) indicate significance at p < 0.01.
Figure 3. Relative gene expression patterns related to ethylene in ‘Beni Shogun’ and ‘Fuji’ during fruit development. Genes are grouped as ethylene synthesis (a,b) (MdACO1 and MdACO7) and signal transduction (c–e) (MdCTR1, MdEIL1, and MdERF1) genes. All genes were analyzed by using qRT-PCR and normalized relative to the expression reference gene, ACTIN. Relative expression levels were normalized to 25 DAFB values. Error bars indicate the ±SE (n = 3). Double stars (**) indicate significance at p < 0.01.
Horticulturae 09 00430 g003
Horticulturae 09 00430 g004 550
Figure 4. Relative gene expression patterns related to auxin and developmental regulation of ‘Beni Shogun’ and ‘Fuji’. Genes are grouped as auxin signal transduction (a,b) and developmental regulation (c–f) genes. All genes were analyzed by using qRT-PCR and normalized relative to the expression reference gene, ACTIN. Relative expression levels were normalized to 25 DAFB values. Error bars indicate the ±SE (n = 3). Single stars (*) indicate statistical significance at p < 0.05, while double stars (**) indicate significance at p < 0.01.
Figure 4. Relative gene expression patterns related to auxin and developmental regulation of ‘Beni Shogun’ and ‘Fuji’. Genes are grouped as auxin signal transduction (a,b) and developmental regulation (c–f) genes. All genes were analyzed by using qRT-PCR and normalized relative to the expression reference gene, ACTIN. Relative expression levels were normalized to 25 DAFB values. Error bars indicate the ±SE (n = 3). Single stars (*) indicate statistical significance at p < 0.05, while double stars (**) indicate significance at p < 0.01.
Horticulturae 09 00430 g004
Horticulturae 09 00430 g005 550
Figure 5. Hierarchical clustering heatmap analysis of 8 phenotypes and 11 genes related to fruit development, maturation, and ripening between ‘Beni Shogun’ and ‘Fuji’. They are divided into 3 clusters (C1 to C3). Unit variance scaling is applied to rows.
Figure 5. Hierarchical clustering heatmap analysis of 8 phenotypes and 11 genes related to fruit development, maturation, and ripening between ‘Beni Shogun’ and ‘Fuji’. They are divided into 3 clusters (C1 to C3). Unit variance scaling is applied to rows.
Horticulturae 09 00430 g005
Table
Table 1. Gene information and primer pairs related to fruit maturation and used in qRT-PCR.
Table 1. Gene information and primer pairs related to fruit maturation and used in qRT-PCR.
Gene
Name		Gene
ID		Ch.Forward Primer
(5′-3′)		Reverse Primer
(5′-3′)		Description
Ethylene synthesis and
signal transduction
MdACO1MDP000019588510CAGAATGTCGATAGCCTCGTGCAGTCCAGAATACAGCTTC1-aminocyclopropane-1-carboxylate oxidase 1
MdACO7MDP000020089615GGTGGAAAGGGTCCTTCTGTCACCAGCATCAGTGTGCTCT1-aminocyclopropane-1-carboxylate oxidase 1
MdCTR1MDP000023030812ACAAGATTTTCATGCCGAACTATGGACAAGTTTGGAGGCTSerine/threonine-protein kinase CTR1
MdEIL1MDP000042388115GTTCGATGCTTCGGGACTTACCTGACTGGTTCACTGGTTGETHYLENE INSENSITIVE 3-like 1 protein
MdERF1MDP000012897913TCAGATCTTGACACCATCTCTCACTTGTCACTACTTTGGTGATAGEthylene-responsive transcription factor RAP2-3-like
Auxin signal transduction
MdARF1MDP00001946037AAAGATTGGTTGCTGGTGACTCACTGACGAGGGTATCTGAADP-ribosylation factor 1
MdIAA11MDP00001640959TTCGTAAGTGCAGTTCCTCCTCCATCTCAGTGGCCATATCTAuxin-responsive protein IAA26-like
Transcription factors
MdNAC5MDP00008684193CATGCAGTTCTGGGGTCACTTCAAGCGCTAAATGATACGTGCNAC domain-containing protein 18
MdNAC3MDP00001736365GACCACTAGGAGATGGGGTTACGTTACCCGTATATCGTTGCTNAC transcription factor 25-like
MdMADS8MDP000036602217GCAAAGGAACTTGAGAGCAGCAATGGACCCAAGTCCTCACCDevelopmental protein SEPALLATA 1
MdMADS7MDP000032639014AACCTACCAGCCAACGAGACCCTTTGTGTTCAGGTGGGACMADS-box protein CMB1-like
Housekeeping gene
MdACTINMDP00001701747GGCTCTATTCCAACCATCCATAGAAGCAGTGCCACCACACActin-related protein 7
Relative expression levels were determined using the delta–delta Ct relative quantitation method.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kim, Y.J.; Ban, S.; Cho, H.J.; Han, A.R.; Choi, C. Comparative Analysis of Gene Expression between Early Maturation Mutant ‘Beni Shogun’ and ‘Fuji’ Cultivars during Fruit Development and Ripening. Horticulturae 2023, 9, 430. https://doi.org/10.3390/horticulturae9040430

AMA Style

Kim YJ, Ban S, Cho HJ, Han AR, Choi C. Comparative Analysis of Gene Expression between Early Maturation Mutant ‘Beni Shogun’ and ‘Fuji’ Cultivars during Fruit Development and Ripening. Horticulturae. 2023; 9(4):430. https://doi.org/10.3390/horticulturae9040430

Chicago/Turabian Style

Kim, Yu Jin, Seunghyun Ban, Hye Jeong Cho, A Reum Han, and Cheol Choi. 2023. "Comparative Analysis of Gene Expression between Early Maturation Mutant ‘Beni Shogun’ and ‘Fuji’ Cultivars during Fruit Development and Ripening" Horticulturae 9, no. 4: 430. https://doi.org/10.3390/horticulturae9040430

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop