Next Article in Journal
Fungal β-Glucan-Based Nanotherapeutics: From Fabrication to Application
Next Article in Special Issue
Adding Metal Ions to the Bacillus mojavensis D50 Promotes Biofilm Formation and Improves Ability of Biocontrol
Previous Article in Journal
Uniparental Inheritance and Recombination as Strategies to Avoid Competition and Combat Muller’s Ratchet among Mitochondria in Natural Populations of the Fungus Amanita phalloides
Previous Article in Special Issue
Biocontrol of Diseases Caused by Phytophthora capsici and P. parasitica in Pepper Plants
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries

1
State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Zhejiang-Malaysia Joint Research Laboratory for Agricultural Product Processing and Nutrition, College of Food and Pharmaceutical Sciences, Ningbo University, Ningbo 315800, China
2
Henry Fok School of Food Science and Engineering, Shaoguan University, Shaoguan 512005, China
*
Author to whom correspondence should be addressed.
J. Fungi 2023, 9(4), 474; https://doi.org/10.3390/jof9040474
Submission received: 28 March 2023 / Revised: 7 April 2023 / Accepted: 10 April 2023 / Published: 15 April 2023
(This article belongs to the Special Issue Isolation and Control of Fruit and Vegetable Rot Fungi)

Abstract

:
The marine yeast Scheffersomyeces spartinae W9 is a promising biocontrol agent for gray mold caused by Botrytis cinerea in strawberries. Improving the biocontrol efficacy of S. spartinae W9 is necessary for its commercial application. In this study, different concentrations of β-glucan were added to the culture medium to evaluate its effect on the biocontrol efficacy of S. spartinae W9. The results showed that 0.1% β-glucan could increase the biocontrol effect of S. spartinae W9 against B. cinerea in strawberries and in vitro. We found that adding 0.1% β-glucan to the culture medium promoted the growth of S. spartinae W9 in wounds of strawberries, enhanced biofilm formation ability, and secreted more β-1,3-glucanase. In addition, 0.1% β-glucan increased the survival rate of S. spartinae W9 under oxidative, thermal, osmotic, and plasma membrane stressors. Transcriptome analysis revealed 188 differential expressed genes in S. spartinae W9 cultured with or without 0.1% β-glucan, including 120 upregulated and 68 downregulated genes. The upregulated genes were associated with stress response, cell wall formation, energy production, growth, and reproduction. Thus, culturing with 0.1% β-glucan is an effective way to improve the biocontrol ability of S. spartinae W9 against gray mold in strawberries.

1. Introduction

Gray mold caused by Botrytis cinerea is the primary fungal disease of strawberry fruit during planting and postharvest storage [1]. Chemical fungicides have been used as the most effective method to control gray mold for decades. However, frequent use of chemical fungicides has increased the resistance of fungal pathogens and has had a negative influence on human health and environmental safety [2,3]. In recent years, researchers have been actively seeking alternatives to chemical fungicides. Biological control using microbial agents is considered to be a promising candidate in the management of postharvest diseases. Antagonistic yeasts are widely used to control postharvest diseases because of their biosafety, well-defined mechanism of action, and good commercial potential [4,5,6]. A variety of antagonistic yeasts have been reported to control gray mold decay of fruits, including Pichia guilliermondii [7], Wickerhamomyces anomalus [8], Metschnikowia pulcherrima [9], Candida pseudolambica [10], Metarhizium anisopliae [11], Scheffersomyeces spartinae [12], and so on. However, antagonistic yeasts have not been able to achieve the effect of traditional chemical fungicides in controlling postharvest diseases of fruit [13]. Therefore, it is important to improve the biocontrol efficacy of antagonistic yeasts.
Adding polysaccharides to the culture media may increase the biocontrol activity of antagonistic yeasts. β-glucan is a natural polysaccharide and the main component of yeast cell walls and has various biological activities [14]. β-glucan has been reported to improve various stress tolerances and biocontrol efficacy of Cryptococcus laurentii (Papiliotrema laurentii) [15,16] and enhance the biocontrol efficacy of Cryptococcus podzolicus (Saitozyma podzolica) [16] against postharvest decay of apples [17] and pears [18] by upregulating the genes related to cell wall synthesis and increasing its tolerance to oxidative stress. S. spartinae W9 is an antagonistic yeast isolated from the intertidal zone marine sediment by our laboratory and a promising biocontrol agent for gray mold in strawberries [12]. To promote the commercial application process, improving the biocontrol efficacy of S. spartinae W9 is urgent. Whether β-glucan can enhance the biocontrol efficacy of marine yeast S. spartinae W9 has yet to be studied.
Therefore, this study aimed to investigate the effect of β-glucan on the biocontrol efficacy of marine yeast S. spartinae W9 and reveal its possible mechanism. In this study, we investigated (1) the effect of different concentrations of β-glucan on antagonistic activities of S. spartinae W9 against B. cinerea in vitro and in strawberry fruit, (2) the effect of β-glucan on the colonization ability and biofilm forming ability of S. spartinae W9, (3) the effect of β-glucan on extracellular hydrolase activity of S. spartinae W9, (4) the effect of β-glucan on various forms of stress tolerance of S. spartinae W9, and (5) the effect of β-glucan on the transcriptome of S. spartinae W9.

2. Materials and Methods

2.1. Antagonistic Yeast and Fungal Pathogen

The antagonistic yeast S. spartinae W9 was preserved in our laboratory and had previously been isolated from the marine sediment in the South China Sea [12]. Consistent with the method used by Wang et al. (2018) and Zhao et al. (2020) [17,18], the activated yeast was suspended in NYDB (nutrient yeast dextrose broth medium) or NYDB supplemented with 0.1%, 0.5%, 1%, and 2% β-glucan (w/v), and incubated in an oscillating incubator at 28 °C for 24 h.
B. cinerea was isolated from infected strawberry fruit and preserved in our laboratory. The strain was maintained and propagated on PDA (potato dextrose agar medium). Spore suspensions were washed from the mycelium, cultured for 7 d, and adjusted to 1 × 105 spores mL/L using a hemocytometer.

2.2. Fruit

Commercially mature strawberries (Fragaria ananassa Duch. cv. Zhangji) were harvested from a greenhouse in the Meishan District, Ningbo, China. Strawberries with uniform color and size and absence of visual injury or lesion were selected for experiments. The strawberries were wiped with 75% ethanol (v/v) for disinfection and air-dried at 20 °C [19].

2.3. Biocontrol Efficacy of S. spartinae W9 Cultured with Different Concentrations of β-Glucan against B. cinerea in Strawberries

This experiment was conducted according to the method described by Fu et al. (2015) [15]. A uniform wound was made at the strawberry equator with a sterilized nail (3 mm deep × 3 mm wide), and each wound was inoculated with 10 µL of any one of the following solutions: (1) sterile water (control), (2) S. spartinae W9 cell suspension cultured in NYDB medium (1 × 108 cells/mL), or (3) S. spartinae W9 cell suspension cultured in NYDB medium with 0.1%, 0.5%, 1%, and 2% β-glucan (w/v) (1 × 108 cells/mL). After two hours, each wound was injected with 10 µL of B. cinerea spore suspension (1 × 105 spores/mL). Then all strawberries were stored in a thermostatic chamber at 20 °C with 90% relative humidity. The incidence of gray mold and the diameter of each lesion were observed every day. Every treatment was replicated three times, with 20 fruits selected at random in each replicate.

2.4. Antagonistic Activity of S. spartinae W9 Cultured with β-Glucan against B. cinerea In Vitro

For the mycelia growth test, 100 µL of S. spartinae W9 suspensions (cultured in NYDB and NYDB with 0.1%, 0.5%, 1%, and 2% β-glucan) at a concentration of 1 × 105 cells/mL was spread into the PDA medium. A total of 100 µL of sterile water was spread to the PDA and used as the control. Afterwards, a 9-mm diameter plug taken from the edge of the actively growing B. cinerea colony was inoculated into the center of each PDA plate. The plates were incubated at 28 °C for 5 d, and the mycelia diameters were measured daily. The experiment consisted of three replicates, with 5 plates per replicate.
For the spore germination test, cell suspensions of 1 × 109 cells/mL S. spartinae W9 (cultured in NYDB and NYDB with 0.1%, 0.5%, 1%, and 2% β-glucan) were prepared. Then 200 µL of yeast suspension was mixed with 200 µL of B. cinerea (1 × 106 spores/mL) spore suspension and added into a 1.6-µL PDB medium. An amount of 200 µL sterile water mixed with 200 µL B. cinerea spore suspension was used as the control. The spores were incubated for 6 h at 28 °C and 180 rpm on a shaker. The germination rate of B. cinerea spores were counted by light microscopy and hemocytometer. At least 100 spores were observed in each treatment, with 3 replicates per treatment.

2.5. Population of Yeasts in Strawberry Wounds

In accordance with the method of Zou et al. (2022) [10], strawberries were wounded as described in 2.3 and then inoculated with S. spartinae W9 or 0.1% β-glucan-treated S. spartinae W9. All strawberries were stored at 20 °C with 90% relative humidity. The amount of yeast at the strawberry fruit wounds was measured at 0 h, 12 h, 24 h, 48 h, and 72 h. The fruit wound tissue was removed with a sterile blade and homogenized in a mortar containing 10 mL of sterile water. A total of 100 µL of the homogenate diluted to the appropriate concentration was spread on NYDA and incubated at 28 °C for 48 h to count the number of colonies. The number of yeast colonies at each wound was expressed as log10CFU/wound. The experiment consisted of three replicates, with three strawberries per replicate.

2.6. The Effect of 0.1% β-Glucan on the Growth of S. spartinae W9

S. spartinae W9 cells (1 × 108 cells/mL) were cultured in NYDB or NYDB with 0.1% β-glucan at 28 °C. The growth of S. spartinae W9 was recorded by measuring the absorbance at 600 nm at 12 h, 24 h, 36 h, and 48 h. Three biological replicates were available for each treatment.

2.7. Determination of Biofilm Formation

The biofilm formation of S. spartinae W9 was assessed using the method of Qiu et al. (2022) [20] with some modifications. An amount of 100 μL of S. spartinae W9 suspension (1 × 107 cells/mL) was pipetted into 50 mL of YNB medium and cultured for about 12 h. Yeast precipitate was obtained by centrifugation at 8000 rpm, 4 °C, for 5 min and was washed twice to adjust the concentration of yeast to 1 × 108 cells/mL. Equal amounts of yeast suspension were injected into YNB or YNB containing 0.1% β-glucan and then were incubated at 28 °C, 75 rpm for 12, 18, 24, 36, and 48 h. For biofilm assay, the culture solutions were washed twice with phosphate buffer and treated with methanol for 15 min. Then, 200 μL of 0.4% crystalline violet was added for staining, and after 40 min, the excess dye was removed and washed with sterile water. Lastly, 200 μL of 33% glacial acetic acid was added and incubated for 30 min, and the supernatant was used to measure the absorbance at 590 nm.

2.8. Measurement of Extracellular Hydrolases

The ability of S. spartinae W9 to produce extracellular hydrolases, mainly including chitinase and β-1,3-glucanase (GLU), was determined by an extracellular hydrolase assay plate [21]. Chitinase and CLU can decompose the colloidal chitin and laminarin, respectively. If S. spartinae W9 secreted chitinase and CLU, the hyaline rings would appear in the plates.
According to the result of an extracellular hydrolase assay plate, we determined the GLU activity of S. spartinae W9. S. spartinae W9 cultured in NYDB or NYDB with 0.1% β-glucan were sampled at 12, 16, 20, 24, 36, and 48 h. The fermentation broth was centrifuged at 6000 rpm for 10 min, and the supernatant was filtered through a sterile membrane for enzyme assay. The GLU activity was determined using the 3, 5-dinitrosalicylic acid method [22], and the absorbance at 540 nm was measured to calculate GLU activity. One unit (U) of GLU was defined as the amount of the enzyme required to produce 1 nmol of glucose per minute, and the results were expressed as U/mL. Each group contained three independent replicates.

2.9. Stress Resistance Assays of S. spartinae W9

As described by Huang et al. (2021) [23], high temperature, NaCl, H2O2, and sodium dodecyl sulfate (SDS) were used to simulate stress. S. spartinae W9 were cultured in NYDB or NYDB with 0.1% β-glucan for 24 h, and the yeast suspensions (1 × 108 cells/mL) were prepared.
To determine the tolerance of S. spartinae W9 to high temperatures, the yeast suspensions were placed into a water bath at 40 °C, 45 °C, and 50 °C for 30 min. The heat-treated yeast suspensions were cooled at room temperature for 10 min and diluted to the appropriate concentration. Then, 0.1 mL of each yeast suspension was spread on a NYDA plate to calculate the survival rate.
S. spartinae W9 or β-glucan-treated S. spartinae W9 yeast suspensions were injected into NYDB (control) and a selective medium (NYDB-4% NaCl, NYDB-7% NaCl, NYDB-10% NaCl, NYDB-1.25mM H2O2, NYDB-2.5mM H2O2, NYDB-5mM H2O2, NYDB-10mM H2O2, NYDB-0.1‰ SDS, NYDB-0.5‰ SDS, NYDB-1‰ SDS). Yeasts were incubated at 28 °C and 180 rpm for 24 h and then diluted to the appropriate concentration to spread on NYDA plates. All plates were incubated at 28 °C for 48 h, and the numbers of yeast colony were recorded. The survival rates of S. spartinae W9 or β-glucan-treated S. spartinae W9 without stress treatment were used as respective controls. Each treatment contained three independent replicates.

2.10. Transcriptomic Analysis

RNA from S. spartinae W9 cultured in NYDB with or without 0.1% β-glucan was isolated using TRIzol (Thermofisher, MA, USA) according to the manufacturer’s instructions. The mRNA with PolyA (polyadenylation) was specifically captured and fragmented with a magnesium ion interruption kit (NEBNextR Magnesium RNA Fragmentation Module, cat. E6150S, New England Biolabs, MA, USA). The fragmented RNA was synthesized into cDNA. Then, double-stranded DNA were synthesized and repaired. The fragment sizes were screened and purified using magnetic beads, and the cDNA library was enriched with PCR. RNA-seq was performed by LC-Bio Technology CO., Ltd. Hangzhou, China. Genes with a fold change in expression level ≥ 1.2 and adjusted p < 0.01 were identified as differentially expressed genes (DEGs). The DEGs’ data was analyzed for GO and KEGG enrichment analysis.

2.11. Real-Time Quantitative PCR

RNA extracted from S. spartinae W9 cultured in NYDB with or without 0.1% β-glucan were first reverse transcribed to cDNA. RT-qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). Twelve DEGs were randomly selected for validation by qPCR, and ACT1 was used as an internal reference gene. Relative gene expression was calculated according to the 2−ΔΔCt method. Table 1 contains a list of the selected genes and the specific primers.

2.12. Statistical Analysis

SPSS statistics software version 20 was used to analyze the data. When the number of comparisons within the group was three or more, the data were compared with the mean by implementing Duncan’s multiple analysis using ANOVA; when the number of comparisons within the group was two, the mean was compared using the independent samples t-test. Significance was assessed when p < 0.05. Data were expressed as mean ± standard deviation.

3. Results

3.1. Biocontrol Efficacy of S. spartinae W9 Cultured with β-Glucan against B. cinerea in Strawberries

As shown in Figure 1A, gray mold decay of strawberries in all groups was observed at the fourth day after inoculation, and S. spartinae W9 cultured with or without β-glucan reduced the disease incidence of strawberries. S. spartinae W9 cultured with 0.1% β-glucan significantly reduced the disease incidence when compared to yeast without β-glucan after the fourth day (p < 0.05). At the end of storage, the disease incidence was 96.7% in the control group, 63.3% in the S. spartinae W9 group, and only 40% in the 0.1% β-glucan-treated S. spartinae W9 group (Figure 1A,B). Adding 0.1% β-glucan into NYDB effectively improved the biocontrol efficacy of S. spartinae W9.

3.2. In Vitro Inhibition of S. spartinae W9 Cultured with β-Glucan against B. cinerea

As shown in Figure 2A, β-glucan enhanced the antagonistic effect of S. spartinae W9 against B. cinerea in vitro. On the fourth day, the mycelia of B. cinerea in the control group covered almost the whole plate, while B. cinerea mycelia in the other groups were significantly inhibited (p < 0.05). Compared to the S. spartinae W9 cultured without β-glucan, 0.1% and 1% β-glucan were effective in increasing the inhibition of B. cinerea mycelial growth, for which the diameter of B. cinerea plaques in the S. spartinae W9 treatment group was 23.4 mm, while the diameters of the 0.1% and 1% β-glucan-induced S. spartinae W9 treated groups were 18.8 mm and 18 mm, respectively.
Figure 2B shows that S. spartinae W9 cultured with or without β-glucan significantly inhibited spore germination of B. cinerea (p < 0.05). S. spartinae W9 cultured with different concentrations of glucan showed different inhibitory effects on spore germination of B. cinerea. The germination rate of B. cinerea spores in 0.1% β-glucan-treated S. spartinae W9 was 9.5%, which was significantly lower than the 17.1% in the S. spartinae W9 group (p < 0.05). Only 0.1% β-glucan increased the ability of S. spartinae W9 to inhibit spore germination of B. cinerea.

3.3. Effects of 0.1% β-Glucan on the Growth of S. spartinae W9 In Vitro

S. spartinae W9 yeasts were cultured in NYDB and NYDB containing 0.1% β-glucan at a concentration of 0.1% for 48 h, respectively. The OD600 of S. spartinae W9 in both media showed no significant difference (p > 0.05; Table 2). The results indicated that 0.1% β-glucan had no significant effect on the growth of S. spartinae W9 in vitro.

3.4. Effects of 0.1% β-Glucan on Colonization Ability in Strawberries and Biofilm Forming Ability of S. spartinae W9

S. spartinae W9 cultured with or without β-glucan was able to grow rapidly in the wounds of strawberries, and its population levels reached the highest value at 24 h (Figure 3A). The population of the β-glucan-induced S. spartinae W9 increased from 6.1 log10 CFU wound−1 to 7.7 log10 CFU wound−1 at 24 h, which was significantly higher than that of S. spartinae W9 cultured in NYDB (p < 0.05). The growth rate of the β-glucan-treated S. spartinae W9 within 24 h was higher than S. spartinae W9 cultured in NYDB.
Crystal violet staining was used to further evaluate the biofilm formation capacity of S. spartinae W9. During the 24 h of yeast culture, the biofilm formation capacity remained stable in each group (Figure 3B). The OD590 of S. spartinae W9 cultured with β-glucan was consistently higher than that of S. spartinae W9 cultured without β-glucan. This indicated that β-glucan promoted the formation of biofilm for S. spartinae W9 and enhanced its biofilm formation capacity.

3.5. Effects of 0.1% β-Glucan on Extracellular Hydrolase of S. spartinae W9

The extracellular hydrolase assay plates showed that S. spartinae W9 could secrete GLU but not chitinase (Figure 4A). The 0.1% β-glucan could not induce S. spartinae W9 to secrete chitinase. The extracellular GLU activities of S. spartinae W9 cultured in NYDB with 0.1% β-glucan were significantly higher than those of S. spartinae W9 cultured in NYDB during the culture period (Figure 4B), indicating that β-glucan could induce S. spartinae W9 to secrete more GLU.

3.6. 0.1% β-Glucan Increased the Survival rate of S. spartinae W9 under Different Stresses

S. spartinae W9 cells harvested from NYDB with 0.1% β-glucan showed higher survival rates under oxidative, thermal, osmotic, and plasma membrane stresses, compared with the yeast cells harvested from NYDB (Figure 5). The survival rate of S. spartinae W9 under 10 mM H2O2, 10% NaCl, 1% SDS, and 50 °C were 66.2%, 68.2% 67.7%, and 76.3%, respectively, while those of β-glucan-treated S. spartinae W9 were 87.4%, 71.0%, 70.6%, and 81.63%, respectively (Figure 5). The 0.1% β-glucan increased the survival rate of S. spartinae W9 under the 10 mM H2O2 environment by 32% compared to the control and significantly improved its tolerance to oxidative stress.

3.7. RNA-seq Analysis and RT-qPCR Validation

A total of 40.87 G clean reads were obtained from S. spartinae W9 cultured in NYDB with or without β-glucan. The Q30 levels were both higher than 70%, indicating that the base quality was up to standard. GC contents were both above 40%, and the percentage of valid reads exceeded 95%, which indicated that the data were reliable. By comparing the gene expression levels between S. spartinae W9 cultured in NYDB with and without β-glucan, 188 genes were identified as DEGs, including 120 upregulated genes and 68 downregulated genes.
A total of 172 DEGs were able to be annotated in the GO database and were enriched into three major categories (Figure 6A). In the biological process category, the DEGs were involved in translation, the biological process, the oxidation-reduction process, and so on. The highly enriched DEGs of the cellular components were involved in cell organelles and cell membranes. The subclass with the most enriched DEGs by molecular function was the structural constituent of ribosome (34 DEGs) subclass, followed by RNA binding (12 DEGs). The DEGs were classified into five categories by KEGG enrichment analysis (Figure 6B). Among them, the pathway with the most DEGs was translation, involving 40 genes. The second pathway was the carbohydrate metabolism pathway, with 13 DEGs.
RT-qPCR was performed on 12 genes to validate the results of RNA-seq. The transcript levels of all selected genes determined by RT-qPCR were consistent with those obtained using RNA-seq (Figure 7).

4. Discussion

A bottleneck in the development of antagonistic yeasts has been the limited biocontrol effect in practical application. Therefore, it is very important to enhance the biocontrol efficacy of antagonistic yeasts. It has been reported that β-glucan could improve the biocontrol efficacy of C. laurentii and C. podzolicus against postharvest blue mold of pears [24]. In the present study, our results also confirmed that β-glucan was an effective elicitor to improve the biocontrol ability of S. spartinae W9 on gray mold of strawberry fruit. The 0.1% β-glucan enhanced the biocontrol efficacy and antagonistic activity of S. spartinae W9 against B. cinerea (Figure 1 and Figure 2). Despite the differences in PDA medium and in fruit [25], the increased antagonistic effects of S. spartinae W9 by β-glucan were consistent. Therefore, we selected 0.1% β-glucan to culture S. spartinae W9 and reveal the involved mechanism.
The key factor affecting the biocontrol activity of antagonistic yeasts has been proposed to be the rate of colonization [26]. Yeasts rapidly consume limited nutrients, thereby inhibiting spore germination of fungal pathogens [27]. This study showed that the addition of β-glucan to the medium had no effect on the growth and reproduction of S. spartinae W9 in vitro, while β-glucan could promote the colonization of S. spartinae W9 in strawberry wounds within 24 h of storage (Figure 3A). Wang et al. (2018) also found that β-glucan increased the growth ability of C. podzolicus in apple wounds [28]. Di Francesco et al. (2017) found that the colonization ability of yeast on the wounds has a certain correlation with the biofilm-forming ability [28]. High-density yeast forms exopolysaccharide capsules, which can more firmly adhere to fruit wounds and prevent pathogen infection [29,30]. Our results showed that the addition of 0.1% β-glucan to the culture medium effectively improved the biofilm formation capacity of S. spartinae W9 (Figure 3B). β-glucan improved the colonization ability in strawberries and biofilm forming ability of S. spartinae W9, which inhibited the growth of B. cinerea, thus reducing the incidence of gray mold in strawberries. Our findings are similar to the previous reports, which showed that some exogenous nutrients could induce antagonistic yeasts to enhance the biocontrol efficacy by improving the growth ability at fruit wounds and biofilm formation ability [31,32].
The ability of antagonistic yeast to resist pathogens also depends on the secretion of extracellular hydrolase. GLU can hydrolyze glucan, which is the major component of fungal cell walls, leading to cell malformation and cytoplasmic leakage, and is one of the possible mechanisms of biocontrol of antagonistic yeasts [33]. GLU is an inducible hydrolase enzyme, and the presence of β-glucan could induce the secretion of GLU from antagonistic yeasts. Our results showed that S. spartinae W9 could secret GLU, and 0.1% β-glucan induced the higher extracellular GLU activities (Figure 4). This suggests that 0.1% β-glucan could induce S. spartinae W9 to secrete more GLU, which might be an important factor for the enhanced biocontrol efficacy of S. spartinae W9. This finding is consistent with the report of Zhao et al. (2020), which showed that higher GLU activity of C. podzolicus is an important factor for the increased biocontrol effect of C. podzolicus cultured with β-glucan [17,18].
In practical application environments such as orchards and postharvest storage, various abiotic stressors could decrease the biocontrol efficacy of antagonistic yeasts [34]. Thus, improving the ecological adaptability and resistance of antagonistic yeasts is an effective way to ensure their biocontrol efficacy. SDS is an organic compound that penetrates cell membranes, causes damage to the plasma membrane, and limits cell growth [35,36]. Oxidative adversity was simulated using hydrogen peroxide because a fruit wound is an environment with high levels of reactive oxygen species [37], which cause oxidative damage to the cell membrane component membrane lipids, thereby destroying the integrity of the cell [38]. NaCl is a common osmotic stressor, and high NaCl has the effect of inhibiting cell growth [39]. The present study showed that the growth of S. spartinae W9 was significantly inhibited under these stressors, while S. spartinae W9 cultured with 0.1% β-glucan could enhance tolerance under these stressors (Figure 5). Fu et al. (2015) also found that 0.5%-β-glucan-induced C. laurentii can survive better under heat and oxidative stress [15]. These findings suggest that β-glucan could improve the stress tolerance of antagonistic yeasts and help to improve their biocontrol efficacy in practical applications.
The transcriptome analysis was conducted to explore the molecular mechanism of β-glucan, enhancing the biocontrol efficacy of S. spartinae W9. The results showed that β-glucan caused 188 DEGs, and the DEGs were related to cell wall formation and cell integrity, energy production, growth, and reproduction (Figure 6). Some upregulated DEGs are associated with stress response, including GRE2, CYS3, AOX2, and ERG3. GRE2 has been reported to be induced in yeast cells in response to oxidative stress [40] and osmotic stress [41]. Similarly, elevated AOX2 implies an acceleration of oxidative processes in mitochondria and limitation of ROS production [42]. The upregulation of the ERG3 gene due to β-glucan was beneficial for maintaining the stability of yeast cell plasma membranes and improving the resistance of yeast to oxidative stress [43]. CYS3 can play a protective role for yeast in a state of oxidative stress and promote the efficiency of yeast cell proliferation [44,45,46]. The upregulation of GRE2, CYS3, AOX2, and ERG3 could explain the increased oxidative stress tolerance of S. spartinae W9 cultured with 0.1% β-glucan.
The yeast cell wall serves a variety of biological functions, including protecting against environmental stresses. It also affects the permeability of the cell wall when it is attacked by substances that disrupt cell integrity [47]. The genes TDH1 and ECM4 have been shown to be involved in cell wall structure [48,49]. Compared to the control, the higher expression of TDH1 and ECM4 in S. spartinae W9 cultured with 0.1% β-glucan promoted cell wall biosynthesis and biocontrol efficacy.
Intracellular energy is heavily depleted when yeast cells are under abiotic stress [50]. ACH1 provides acetyl coenzyme A (acetyl-CoA) to mitochondria by transferring the CoA group to acetate, which may accelerate metabolism in the TCA cycle and glycolysis [51]. The gene ADH1 encodes alcohol dehydrogenase, which is the primary enzyme for the reoxidation of NADH in yeast. Zhong et al. (2021) showed that inactivation of ADH1 caused the accumulation of NADH, resulting in the imbalance of NADH/NAD and growth retardation [52]. The upregulation of ACH1 and ADH1 in S. spartinae W9 cells cultured with 0.1% β-glucan led to higher colonization ability in strawberry wounds and improved biocontrol efficacy. In addition, upregulation of the RNR2 gene required for DNA repair may be helpful for maintaining cellular integrity [53]. In brief, β-glucan increased the energy metabolism and cellular integrity of S. spartinae W9 cells.
The transcriptome analysis demonstrated that the 0.1 % β-glucan-induced S. spartinae W9 achieved better proliferation and enhanced biological activity by altering cellular processes, energy metabolism, and stress responses. Similarly, Zhao et al. (2020) used transcriptomic analysis to reveal that β-glucan accelerated the synthesis of cell walls and energy of C. podzolicus, enhanced its antioxidant ability, and thus improved the biological control efficacy [18].

5. Conclusions

Adding 0.1% β-glucan into the culture medium significantly enhanced the biocontrol efficacy of S. spartinae W9 against B. cinerea in strawberries. β-glucan improved the colonization ability of yeast in strawberries, the biofilm forming ability, and the stress tolerance of S. spartinae W9. β-glucan also upregulated the genes involved in stress responses, cell wall formation, energy metabolism, growth, and reproduction of S. spartinae W9.

Author Contributions

Conceptualization, X.C. and Y.W.; methodology, X.C., X.Z. and Z.Z.; software, X.C. and S.J.; validation, X.C., X.Z. and Z.Z.; formal analysis, Y.C. and F.X.; investigation, X.C.; data curation, X.C. and Y.W.; writing—original draft preparation, X.C. and Y.W.; writing—review and editing, X.C., Y.W. and X.S; visualization, X.C. and Y.C.; supervision, Y.W. and X.S.; project administration, Y.W.; funding acquisition, Y.W., X.Z. and Z.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32202122), Ningbo Public Welfare Technology Project (No. 2022S143 and No. 2021S064), and the Research Innovation Foundation for Graduate Students of Ningbo University (IF2022173).

Data Availability Statement

The data presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Haile, Z.M.; Guzman, N.D.; Grace, E.; Moretto, M.; Sonego, P.; Engelen, K.; Zoli, L.; Moser, C.; Baraldi, E. Transcriptome Profiles of Strawberry (Fragaria vesca) Fruit Interacting With Botrytis cinerea at Different Ripening Stages. Front. Plant Sci. 2019, 10, 1131. [Google Scholar] [CrossRef] [PubMed]
  2. Janisiewicz, W.J.; Korsten, L. Biological control of postharvest diseases of fruits. Annu. Rev. Phytopathol. 2002, 40, 411–441. [Google Scholar] [CrossRef] [Green Version]
  3. Morales, H.; Marín, S.; Ramos, A.J.; Sanchis, V. Influence of post-harvest technologies applied during cold storage of apples in Penicillium expansum growth and patulin accumulation: A review. Food Control 2010, 21, 953–962. [Google Scholar] [CrossRef]
  4. Sharma, R.R.; Singh, D.; Singh, R. Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: A review. Biol. Control 2009, 50, 205–221. [Google Scholar] [CrossRef]
  5. Zhang, X.; Li, B.; Zhang, Z.; Chen, Y.; Tian, S. Antagonistic Yeasts: A Promising Alternative to Chemical Fungicides for Controlling Postharvest Decay of Fruit. J. Fungi 2020, 6, 158. [Google Scholar] [CrossRef] [PubMed]
  6. Muccilli, S.; Restuccia, C. Bioprotective Role of Yeasts. Microorganisms 2015, 3, 588–611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Sadeghi, R.; Aminian, H.; Remize, F.; Sheikh, M.; Ebrahimi, L. Integrated control of blue and gray molds of apples with antagonistic yeasts combined with carbon dioxide or ozone. J. Plant Pathol. 2021, 103, 943–953. [Google Scholar] [CrossRef]
  8. Lanhuang, B.; Yang, Q.; Godana, E.A.; Zhang, H. Efficacy of the Yeast Wickerhamomyces anomalus in Biocontrol of Gray Mold Decay of Tomatoes and Study of the Mechanisms Involved. Foods 2022, 11, 720. [Google Scholar] [CrossRef]
  9. Millan, A.F.-S.; Gamir, J.; Farran, I.; Larraya, L.; Veramendi, J. Identification of new antifungal metabolites produced by the yeast Metschnikowia pulcherrima involved in the biocontrol of postharvest plant pathogenic fungi. Postharvest Biol. Technol. 2022, 192, 111995. [Google Scholar] [CrossRef]
  10. Zou, X.; Wei, Y.; Jiang, S.; Cao, Z.; Xu, F.; Wang, H.; Zhan, P.; Shao, X. Volatile organic compounds and rapid proliferation of Candida pseudolambica W16 are modes of action against gray mold in peach fruit. Postharvest Biol. Technol. 2021, 183, 111751. [Google Scholar] [CrossRef]
  11. Guigón-López, C.; Holguín-Ibarra, P.D.; Torres-Zapien, J.H.; Cruz, I.G.; Villapando, I.; Salas-Salazar, N.A. Metarhizium anisopliae reduces conidial germination and mycelium growth of the apple gray mold Botrytis cinerea. Biol. Control 2021, 160, 104660. [Google Scholar] [CrossRef]
  12. Zou, X.; Wei, Y.; Dai, K.; Xu, F.; Wang, H.; Shao, X. Yeasts from intertidal zone marine sediment demonstrate antagonistic activities against Botrytis cinerea in vitro and in strawberry fruit. Biol. Control 2021, 158, 104612. [Google Scholar] [CrossRef]
  13. Roca-Couso, R.; Flores-Félix, J.D.; Rivas, R. Mechanisms of Action of Microbial Biocontrol Agents against Botrytis cinerea. J. Fungi 2021, 7, 1045. [Google Scholar] [CrossRef] [PubMed]
  14. Dai, H.; Han, X.Q.; Gong, F.Y.; Dong, H.; Tu, P.F.; Gao, X.M. Structure elucidation and immunological function analysis of a novel beta-glucan from the fruit bodies of Polyporus umbellatus (Pers.) Fries. Glycobiology 2012, 22, 1673–1683. [Google Scholar] [CrossRef] [Green Version]
  15. Fu, D.; Zeng, L.; Zheng, X.; Yu, T. Effect of β-glucan on stress tolerances and biocontrol efficacy of Cryptococcus laurentii against Penicillium expansum in pear fruit. Biocontrol 2015, 60, 669–679. [Google Scholar] [CrossRef]
  16. Liu, X.Z.; Wang, G.M.; Göker, M.; Groenewald, M.; Kachalkin, A.V.; Lumbsch, H.T.; Millanes, A.M.; Wedin, M.; Yurkov, A.M.; Bai, F.Y.; et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 2015, 81, 85–147. [Google Scholar] [CrossRef] [Green Version]
  17. Wang, Y.; Li, Y.; Xu, W.; Zheng, X.; Zhang, X.; Abdelhai, M.H.; Zhao, L.; Li, H.; Diao, J.; Zhang, H. Exploring the effect of β-glucan on the biocontrol activity of Cryptococcus podzolicus against postharvest decay of apples and the possible mechanisms involved. Biol. Control 2018, 121, 14–22. [Google Scholar] [CrossRef]
  18. Zhao, L.; Wang, Y.; Wang, Y.; Li, B.; Gu, X.; Zhang, X.; Boateng, N.A.S.; Zhang, H. Effect of β-glucan on the biocontrol efficacy of Cryptococcus podzolicus against postharvest decay of pears and the possible mechanisms involved. Postharvest Biol. Technol. 2019, 160, 111057. [Google Scholar] [CrossRef]
  19. Hassan, H.; Mohamed, M.; Yusoff, S.; Hata, E.; Tajidin, N. Selecting Antagonistic Yeast for Postharvest Biocontrol of Colletotrichum gloeosporioides in Papaya Fruit and Possible Mechanisms Involved. Agronomy 2021, 11, 760. [Google Scholar] [CrossRef]
  20. Qiu, J.-E.; Zhao, L.; Jiang, S.; Godana, E.A.; Zhang, X.; Zhang, H. Efficacy of Meyerozyma caribbica in the biocontrol of blue mold in kiwifruit and mechanisms involved. Biol. Control 2022, 173, 105000. [Google Scholar] [CrossRef]
  21. Agirman, B.; Erten, H. Biocontrol ability and action mechanisms of Aureobasidium pullulans GE17 and Meyerozyma guilliermondii KL3 against Penicillium digitatum DSM2750 and Penicillium expansum DSM62841 causing postharvest diseases. Yeast 2020, 37, 437–448. [Google Scholar] [CrossRef] [PubMed]
  22. Zhou, Y.; Zhang, L.; Zeng, K. Efficacy of Pichia membranaefaciens combined with chitosan against Colletotrichum gloeosporioides in citrus fruits and possible modes of action. Biol. Control 2016, 96, 39–47. [Google Scholar] [CrossRef]
  23. Huang, Y.; Fan, Z.; Cai, Y.; Jin, L.; Yu, T. The influence of N-acetylglucosamine: Inducing Rhodosporidium paludigenum to enhance the inhibition of Penicillium expansum on pears. Postharvest Biol. Technol. 2021, 176, 111486. [Google Scholar] [CrossRef]
  24. Zeng, L.; Yu, C.; Fu, D.; Lu, H.; Zhu, R.; Lu, L.; Zheng, X.; Yu, T. Improvement in the effectiveness of Cryptococcus laurentii to control postharvest blue mold of pear by its culture in β-glucan amended nutrient broth. Postharvest Biol. Technol. 2015, 104, 26–32. [Google Scholar] [CrossRef]
  25. Millan, A.F.-S.; Larraya, L.; Farran, I.; Ancin, M.; Veramendi, J. Successful biocontrol of major postharvest and soil-borne plant pathogenic fungi by antagonistic yeasts. Biol. Control 2021, 160, 104683. [Google Scholar] [CrossRef]
  26. Yu, T.; Yu, C.; Chen, F.; Sheng, K.; Zhou, T.; Zunun, M.; Abudu, O.; Yang, S.; Zheng, X. Integrated control of blue mold in pear fruit by combined application of chitosan, a biocontrol yeast and calcium chloride. Postharvest Biol. Technol. 2012, 69, 49–53. [Google Scholar] [CrossRef]
  27. Rivas-Garcia, T.; Murillo-Amador, B.; Nieto-Garibay, A.; Rincon-Enriquez, G.; Chiquito-Contreras, R.G.; Hernandez-Montiel, L.G. Enhanced biocontrol of fruit rot on muskmelon by combination treatment with marine Debaryomyces hansenii and Stenotrophomonas rhizophila and their potential modes of action. Postharvest Biol. Technol. 2019, 151, 61–67. [Google Scholar] [CrossRef]
  28. Di Francesco, A.; Ugolini, L.; D’Aquino, S.; Pagnotta, E.; Mari, M. Biocontrol of Monilinia laxa by Aureobasidium pullulans strains: Insights on competition for nutrients and space. Int. J. Food Microbiol. 2017, 248, 32–38. [Google Scholar] [CrossRef]
  29. Klein, M.N.; Kupper, K.C. Biofilm production by Aureobasidium pullulans improves biocontrol against sour rot in citrus. Food Microbiol. 2018, 69, 1–10. [Google Scholar] [CrossRef] [Green Version]
  30. Dukare, A.S.; Paul, S.; Nambi, V.E.; Gupta, R.K.; Singh, R.; Sharma, K.; Vishwakarma, R.K. Exploitation of microbial antagonists for the control of postharvest diseases of fruits: A review. Crit. Rev. Food Sci. Nutr. 2018, 59, 1498–1513. [Google Scholar] [CrossRef]
  31. Wang, S.; Zhang, H.; Qi, T.; Deng, L.; Yi, L.; Zeng, K. Influence of arginine on the biocontrol efficiency of Metschnikowia citriensis against Geotrichum citri-aurantii causing sour rot of postharvest citrus fruit. Food Microbiol. 2021, 101, 103888. [Google Scholar] [CrossRef] [PubMed]
  32. Zhang, H.; Ge, L.; Chen, K.; Zhao, L.; Zhang, X. Enhanced Biocontrol Activity of Rhodotorula mucilaginosa Cultured in Media Containing Chitosan against Postharvest Diseases in Strawberries: Possible Mechanisms Underlying the Effect. J. Agric. Food Chem. 2014, 62, 4214–4224. [Google Scholar] [CrossRef]
  33. Masih, E.I.; Paul, B. Secretion of β-1,3-Glucanases by the Yeast Pichia membranifaciens and Its Possible Role in the Biocontrol of Botrytis cinerea Causing Grey Mold Disease of the Grapevine. Curr. Microbiol. 2002, 44, 391–395. [Google Scholar] [CrossRef]
  34. Sui, Y.; Wisniewski, M.; Droby, S.; Liu, J. Responses of Yeast Biocontrol Agents to Environmental Stress. Appl. Environ. Microbiol. 2015, 81, 2968–2975. [Google Scholar] [CrossRef] [Green Version]
  35. Schroeder, L.; Ikui, A.E. Tryptophan confers resistance to SDS-associated cell membrane stress in Saccharomyces cerevisiae. PLoS ONE 2019, 14, e0199484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Kono, K.; Al-Zain, A.; Schroeder, L.; Nakanishi, M.; Ikui, A.E. Plasma membrane/cell wall perturbation activates a novel cell cycle checkpoint during G1 in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 2016, 113, 6910–6915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Nie, X.; Zhang, C.; Jiang, C.; Zhang, R.; Guo, F.; Fan, X. Trehalose increases the oxidative stress tolerance and biocontrol efficacy of Candida oleophila in the microenvironment of pear wounds. Biol. Control 2019, 132, 23–28. [Google Scholar] [CrossRef]
  38. Reverter-Branchat, G.; Cabiscol, E.; Tamarit, J.; Ros, J. Oxidative damage to specific proteins in replicative and chronological-aged Saccharomyces cerevisiae: Common targets and prevention by calorie restriction. J. Biol. Chem. 2004, 279, 31983–31989. [Google Scholar] [CrossRef] [Green Version]
  39. Wang, Y.; Luo, Y.; Sui, Y.; Xie, Z.; Liu, Y.; Jiang, M.; Liu, J. Exposure of Candida oleophila to sublethal salt stress induces an antioxidant response and improves biocontrol efficacy. Biol. Control 2018, 127, 109–115. [Google Scholar] [CrossRef]
  40. Goud, B.S.; Kim, J.H.; Ulaganathan, K. Identification of Genes Associated with Stress Tolerance of High Ethanol–Producing Saccharomyces cerevisiae Strain, NCIM3186, by Differential Gene Expression Analysis. BioEnergy Res. 2022, 15, 1459–1471. [Google Scholar] [CrossRef]
  41. Perez-Martinez, M.E.; Benet, M.; Alepuz, P.; Tordera, V. Nut1/Hos1 and Sas2/Rpd3 control the H3 acetylation of two different sets of osmotic stress-induced genes. Epigenetics 2020, 15, 251–271. [Google Scholar] [CrossRef] [PubMed]
  42. She, X.; Zhang, P.; Gao, Y.; Zhang, L.; Wang, Q.; Chen, H.; Calderone, R.; Liu, W.; Li, D. A mitochondrial proteomics view of complex I deficiency in Candida albicans. Mitochondrion 2018, 38, 48–57. [Google Scholar] [CrossRef] [PubMed]
  43. Horstmann, C.; Campbell, C.; Kim, D.S.; Kim, K. Transcriptome profile with 20 nm silver nanoparticles in yeast. FEMS Yeast Res. 2019, 19, foz003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Matiach, A.; Schröder-Köhne, S. Yeast cys3 and gsh1 mutant cells display overlapping but non-identical symptoms of oxidative stress with regard to subcellular protein localization and CDP-DAG metabolism. Mol. Genet. Genom. 2001, 266, 481–496. [Google Scholar] [CrossRef]
  45. Nguyen, P.-T.; Toh-E, A.; Nguyen, N.-H.; Imanishi-Shimizu, Y.; Watanabe, A.; Kamei, K.; Shimizu, K. Identification and characterization of a sulfite reductase gene and new insights regarding the sulfur-containing amino acid metabolism in the basidiomycetous yeast Cryptococcus neoformans. Curr. Genet. 2020, 67, 115–128. [Google Scholar] [CrossRef] [PubMed]
  46. Gu, Z.; Sun, Y.; Wu, F.; Wu, X. Mechanism of Growth Regulation of Yeast Involving Hydrogen Sulfide From S-Propargyl-Cysteine Catalyzed by Cystathionine-γ-Lyase. Front. Microbiol. 2021, 12, 679563. [Google Scholar] [CrossRef]
  47. Klis, F.M.; Mol, P.; Hellingwerf, K.; Brul, S. Dynamics of cell wall structure in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 2002, 26, 239–256. [Google Scholar] [CrossRef]
  48. Delgado, M.L.; O’Connor, J.E.; Azorín, I.; Renau-Piqueras, J.; Gil, M.L.; Gozalbo, D. The glyceraldehyde-3-phosphate dehydrogenase polypeptides encoded by the Saccharomyces cerevisiae TDH1, TDH2 and TDH3 genes are also cell wall proteins. Microbiology 2001, 147, 411–417. [Google Scholar] [CrossRef] [Green Version]
  49. Terzioğlu, E.; Alkım, C.; Arslan, M.; Balaban, B.G.; Holyavkin, C.; Kısakesen, H.I.; Topaloğlu, A.; Şahin, Y.; Işık, S.G.; Akman, S.; et al. Genomic, transcriptomic and physiological analyses of silver-resistant Saccharomyces cerevisiae obtained by evolutionary engineering. Yeast 2020, 37, 413–426. [Google Scholar] [CrossRef]
  50. Dai, Y.; Wang, Z.; Leng, J.; Wang, Q.; Liu, J. Heat stress alters the transcriptome of Debaryomyces hansenii and reduces its biocontrol activity against postharvest gray mold on kiwifruit. Postharvest Biol. Technol. 2021, 178, 111541. [Google Scholar] [CrossRef]
  51. van Rossum, H.M.; Kozak, B.U.; Niemeijer, M.S.; Duine, H.J.; Luttik, M.A.H.; Boer, V.M.; Kötter, P.; Daran, J.-M.G.; van Maris, A.J.A.; Pronk, J.T. Alternative reactions at the interface of glycolysis and citric acid cycle in Saccharomyces cerevisiae. FEMS Yeast Res. 2016, 16, fow017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Zhong, W.; Yang, M.; Hao, X.; Sharshar, M.M.; Wang, Q.; Xing, J. Improvement of D-Lactic acid productivity by introducing Escherichia coli acetyl-CoA synthesis pathway in engineered Saccharomyces cerevi. J. Chem. Technol. Biotechnol. 2021, 96, 2509–2519. [Google Scholar] [CrossRef]
  53. Thakre, P.K.; Sv, A.; Golla, U.R.; Chauhan, S.; Tomar, R.S. Previously uncharacterized amino acid residues in histone H3 and H4 mutants with roles in DNA damage repair response and cellular aging. FEBS J. 2018, 286, 1154–1173. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Biocontrol efficacy of S. spartinae W9 cultured with different concentrations of β-glucan against B. cinerea in strawberries. (A) Disease incidence of gray mold in strawberries after the treatment with S. spartinae W9 cultured with different concentrations (0, 0.1%, 0.5%, 1%, and 2%) of β-glucan during storage. (B) Phenomenon of gray mold in strawberries in each group at day 6 and day 7 after inoculation with B. cinerea. Different lowercase letters indicate significant differences between different treatment groups according to Duncan’s test (p < 0.05).
Figure 1. Biocontrol efficacy of S. spartinae W9 cultured with different concentrations of β-glucan against B. cinerea in strawberries. (A) Disease incidence of gray mold in strawberries after the treatment with S. spartinae W9 cultured with different concentrations (0, 0.1%, 0.5%, 1%, and 2%) of β-glucan during storage. (B) Phenomenon of gray mold in strawberries in each group at day 6 and day 7 after inoculation with B. cinerea. Different lowercase letters indicate significant differences between different treatment groups according to Duncan’s test (p < 0.05).
Jof 09 00474 g001
Figure 2. In vitro inhibition of S. spartinae W9 cultured with different concentrations of β-glucan against B. cinerea. (A) Mycelia diameter of B. cinere after treatment with S. spartinae W9 cultured with different concentrations (0, 0.1%, 0.5%, 1%, and 2%) of β-glucan. (B) Spore germination rate of B. cinerea after treatment with S. spartinae W9 cultured with different concentrations (0, 0.1%, 0.5%, 1%, and 2%) of β-glucan. Different lowercase letters indicated significant differences between different treatment groups according to Duncan’s test (p < 0.05).
Figure 2. In vitro inhibition of S. spartinae W9 cultured with different concentrations of β-glucan against B. cinerea. (A) Mycelia diameter of B. cinere after treatment with S. spartinae W9 cultured with different concentrations (0, 0.1%, 0.5%, 1%, and 2%) of β-glucan. (B) Spore germination rate of B. cinerea after treatment with S. spartinae W9 cultured with different concentrations (0, 0.1%, 0.5%, 1%, and 2%) of β-glucan. Different lowercase letters indicated significant differences between different treatment groups according to Duncan’s test (p < 0.05).
Jof 09 00474 g002
Figure 3. Effects of 0.1% β-glucan on colonization ability in strawberries and biofilm forming ability of S. spartinae W9. (A) Population dynamics of S. spartinae W9 cultured in NYDB or NYDB with 0.1% β-glucan in wounds of strawberries at 20 °C. (B) Biofilm forming ability of S. spartinae W9 cultured with or without 0.1% β-glucan stained with crystal violet. * indicate a significant difference between S. spartinae W9 cultured with or without 0.1% β-glucan identified by the t-test (*, p < 0.05; **, p < 0.01).
Figure 3. Effects of 0.1% β-glucan on colonization ability in strawberries and biofilm forming ability of S. spartinae W9. (A) Population dynamics of S. spartinae W9 cultured in NYDB or NYDB with 0.1% β-glucan in wounds of strawberries at 20 °C. (B) Biofilm forming ability of S. spartinae W9 cultured with or without 0.1% β-glucan stained with crystal violet. * indicate a significant difference between S. spartinae W9 cultured with or without 0.1% β-glucan identified by the t-test (*, p < 0.05; **, p < 0.01).
Jof 09 00474 g003
Figure 4. Effects of 0.1% β-glucan on extracellular hydrolase activity of S. spartinae W9. (A) Results of the extracellular hydrolase assay plates of S. spartinae W9 cultured with or without 0.1% β-glucan. (B) GLU activity of S. spartinae W9 cultured in NYDB or NYDB containing 0.1% β-glucan. * indicate a significant difference between S. spartinae W9 cultured with or without 0.1% β-glucan identified by the t-test (p < 0.05).
Figure 4. Effects of 0.1% β-glucan on extracellular hydrolase activity of S. spartinae W9. (A) Results of the extracellular hydrolase assay plates of S. spartinae W9 cultured with or without 0.1% β-glucan. (B) GLU activity of S. spartinae W9 cultured in NYDB or NYDB containing 0.1% β-glucan. * indicate a significant difference between S. spartinae W9 cultured with or without 0.1% β-glucan identified by the t-test (p < 0.05).
Jof 09 00474 g004
Figure 5. Effects of 0.1% β-glucan on the survival rate of S. spartinae W9 under different stresses. (A) The survival rate of S. spartinae W9 under oxidative stress caused by H2O2. (B) The survival rate of S. spartinae W9 under plasma membrane stress caused by SDS. (C) The survival rate of S. spartinae W9 under hyperosmotic stress caused by NaCl. (D) The survival rate of S. spartinae W9 under high temperature stressor. Asterisks indicate a significant difference between S. spartinae W9 cultured with or without 0.1% β-glucan identified by the t-test (*, p < 0.05; **, p < 0.01).
Figure 5. Effects of 0.1% β-glucan on the survival rate of S. spartinae W9 under different stresses. (A) The survival rate of S. spartinae W9 under oxidative stress caused by H2O2. (B) The survival rate of S. spartinae W9 under plasma membrane stress caused by SDS. (C) The survival rate of S. spartinae W9 under hyperosmotic stress caused by NaCl. (D) The survival rate of S. spartinae W9 under high temperature stressor. Asterisks indicate a significant difference between S. spartinae W9 cultured with or without 0.1% β-glucan identified by the t-test (*, p < 0.05; **, p < 0.01).
Jof 09 00474 g005
Figure 6. GO (A) and KEGG (B) enrichment analysis of DEGs in S. spartinae W9 cultured with and without 0.1% β-glucan. The numbers behind the bars stand for the number of genes involved in the metabolism.
Figure 6. GO (A) and KEGG (B) enrichment analysis of DEGs in S. spartinae W9 cultured with and without 0.1% β-glucan. The numbers behind the bars stand for the number of genes involved in the metabolism.
Jof 09 00474 g006
Figure 7. Results of verification of differently expressed genes by RT-qPCR. A: Relative gene expression level of S. spartinae W9 cultured in NYDB. B: Relative gene expression level of S. spartinae W9 cultured in NYDB with 0.1% β-glucan. Fold Change: Transcriptome sequencing results. Bars represent standard errors.
Figure 7. Results of verification of differently expressed genes by RT-qPCR. A: Relative gene expression level of S. spartinae W9 cultured in NYDB. B: Relative gene expression level of S. spartinae W9 cultured in NYDB with 0.1% β-glucan. Fold Change: Transcriptome sequencing results. Bars represent standard errors.
Jof 09 00474 g007
Table 1. Primers used for RT-qPCR analysis of S. spartinae genes.
Table 1. Primers used for RT-qPCR analysis of S. spartinae genes.
Gene IDGene NameForward and Reverse Primers (5′ to 3′)
gene-KQ657_000363CYS3F: TGGGTGTTTTGGCAACCAAC
R: ACCTCTGTGAGCCAACCAAG
gene-KQ657_002550GRE2_4F: TTTCACATTGCGTCTCCCGT
R: GCTGAGGTGCCTTATCCGTT
gene-KQ657_002037ERG3F: CGGATGGTCTCTTCCACTCC
R: CTGTTGCCCATATCGAGGGT
gene-KQ657_001934ACH1F: CGTTTCTACGCCAACTGGGA
R: GGTGGAGTTAGCATGAGCGT
gene-KQ657_000095AOX2F: CATGCCGCACCTGTTTTAGT
R: GGCTCTTTAACCGGTGGTGT
gene-KQ657_001274TDH1F: ACAAGGACTGGAGAGGTGGT
R: TTACCGACAGCCTTAGCAGC
gene-KQ657_000537ECM4_1F: TTCGCTTCCGACCAAGAGAC
R: TGACCACCAGCAGTGTGAAT
gene-KQ657_001686KRI1F: AGGCCGAGACCATTGAAGTC
R: CTGGTGCTTCTTGGTCGCTA
gene-KQ657_001371IRS4F: GCTACGAAGCTTGTGGGAGT
R: GCAGACAATCGAGCAGCAAC
gene-KQ657_001105RRP36F: ACCTGTTTCGGTAGTCAGGG
R: CATCTTGCTCCGTTGCTTGG
gene-KQ657_000758ADH1_1F: ATGGGTTGCAGTCTCTGGTG
R: CCTTCTCTTCGCCACCATCA
gene-KQ657_003270RNR2F: AGATGCCCTTCCAGTGTCTT
R: AGGAGAAAGCATTGGCTGCT
gene-KQ657_004479ACT1F:CAGACCTGCTGACTTGGGTT
R:AGAGGATGGGGCCAACAAAG
Table 2. Growth of S. spartinae W9 in NYDB or NYDB containing 0.1% β-glucan.
Table 2. Growth of S. spartinae W9 in NYDB or NYDB containing 0.1% β-glucan.
Culture ConditionsOD600
12 h24 h36 h48 h
NYDB1.25 ± 0.011 a2.22 ± 0.006 a2.42 ± 0.005 a2.51 ± 0.001 a
NYDB with 0.1%β-glucan1.27 ± 0.009 a2.23 ± 0.014 a2.41 ± 0.007 a2.51 ± 0.018 a
Same letter in each column means no significant difference according to the independent samples t-test (p > 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, X.; Wei, Y.; Zou, X.; Zhao, Z.; Jiang, S.; Chen, Y.; Xu, F.; Shao, X. β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries. J. Fungi 2023, 9, 474. https://doi.org/10.3390/jof9040474

AMA Style

Chen X, Wei Y, Zou X, Zhao Z, Jiang S, Chen Y, Xu F, Shao X. β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries. Journal of Fungi. 2023; 9(4):474. https://doi.org/10.3390/jof9040474

Chicago/Turabian Style

Chen, Xueyan, Yingying Wei, Xiurong Zou, Zichang Zhao, Shu Jiang, Yi Chen, Feng Xu, and Xingfeng Shao. 2023. "β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries" Journal of Fungi 9, no. 4: 474. https://doi.org/10.3390/jof9040474

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop