Next Article in Journal
From Waste to Taste: Application of Fermented Spent Rootlet Ingredients in a Bread System
Previous Article in Journal
The Effect of Erythritol on the Physicochemical Properties of Reformulated, High-Protein, and Sugar-Free Macarons Produced from Whey Protein Isolate Intended for Diabetics, Athletes, and Physically Active People
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 12
Issue 7
10.3390/foods12071548
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

High Genetic Diversity and Virulence Potential in Bacillus cereus sensu lato Isolated from Milk and Cheeses in Apulia Region, Southern Italy

by
Angelica Bianco
1,
Giovanni Normanno
2,*,
Loredana Capozzi
1,
Laura Del Sambro
1,
Laura Di Fato
1,
Angela Miccolupo
1,
Pietro Di Taranto
1,
Marta Caruso
1,
Fiorenza Petruzzi
2,
Ashraf Ali
2 and
Antonio Parisi
1
1
Experimental Zooprophylactic Institute of Apulia and Basilicata, Via Manfredonia 20, 71121 Foggia, Italy
2
Department of Sciences of Agriculture, Food, Natural Resources and Engineering (DAFNE), University of Foggia, Via Napoli 25, 71122 Foggia, Italy
*
Author to whom correspondence should be addressed.
Foods 2023, 12(7), 1548; https://doi.org/10.3390/foods12071548
Submission received: 9 February 2023 / Revised: 14 March 2023 / Accepted: 16 March 2023 / Published: 6 April 2023
(This article belongs to the Section Food Quality and Safety)
Browse Figures
Review Reports Versions Notes

Abstract

:
The Bacillus cereus group includes species that act as food-borne pathogens causing diarrheal and emetic symptoms. They are widely distributed and can be found in various foods. In this study, out of 550 samples of milk and cheeses, 139 (25.3%) were found to be contaminated by B. cereus sensu lato (s.l.). One isolate per positive sample was characterized by Multilocus Sequence Typing (MLST) and for the presence of ten virulence genes. Based on MLST, all isolates were classified into 73 different sequence types (STs), of which 12 isolates were assigned to new STs. Virulence genes detection revealed that 90% and 61% of the isolates harboured the nheABC and the hblCDA gene cluster, respectively. Ninety-four percent of the isolates harboured the enterotoxin genes entS and entFM; 8% of the isolates possessed the ces gene. Thirty-eight different genetic profiles were identified, suggesting a high genetic diversity. Our study clearly shows the widespread diffusion of potentially toxigenic isolates of B. cereus s.l. in milk and cheeses in the Apulia region highlighting the need to adopt GMP and HACCP procedures along every step of the milk and cheese production chain in order to reduce the public health risk linked to the consumption of foods contaminated by B. cereus s.l.

1. Introduction

The Bacillus cereus group, also named B. cereus sensu lato (s.l.), includes numerous closely related species widespread in the environment [1]; among these, B. cereus is the most important species from the food safety point of view. As a matter of fact, B. cereus, an anaerobic-facultative spore-forming bacteria, is able to survive in the food production environment and subsequently is able to contaminate a wide range of foodstuff: it has been found in milk [2,3,4], dairy products [3,5,6,7], ice cream [8], fresh vegetables [9,10,11], meat [12], spices [13], seafood [14,15], cereal and derivatives [16], and rice [17]. In addition, its capability to form biofilm and viscous heat-resistant spores makes this organism very difficult to remove from food preparation surfaces and food production environments [18,19].
From 2007 to 2014, 413 foodborne outbreaks were reported to be caused by B. cereus (s.l.), accounting for 6657 cases and 352 hospitalizations [20]. According to the EFSA/ECDC during 2018, 2019, 2020 and 2021, 1539, 1636, 835, and 679 cases, 98, 155, 71, and 87 outbreaks, 111, 44, 10, and 9 hospitalisations and one, seven, one, and one deaths were reported, respectively [2,21,22,23,24].
B. cereus can cause two main types of human foodborne disease: a diarrheal and an emetic illness [25,26]. Furthermore, it has been reported that B. cereus causes serious extra-intestinal infections, such as severe eye infections, osteomyelitis, hepatitis and inflammatory responses [27,28] and even death [29,30]. The pathogenicity of B. cereus is strictly associated with the production of different exotoxins, including pore forming non-hemolytic enterotoxin (NHE), hemolysin BL (HBL), cytotoxin K (CytK), enterotoxins FM (entFM) and S (entS) [31,32] and the emetic toxin cereulide, which is synthesized by non-ribosomal peptide synthetases encoded by the ces gene cluster [33]. Unlike the enterotoxins that are synthetized in the intestine after the ingestion of the organism [34,35], the cereulide is a thermo-resistant, proteolysis-resistant, and acid-stable dodecadepsipeptide [19,36] and it is synthesized in contaminated foods.
During the period between 2015 and 2018, in Italy, about 1,200,000 t of milk and about 130,000 t of cheeses were produced each year [37]; despite this large production and the popularity of a lot of traditional well-known cheeses, the foodborne risk associated with B. cereus has not been thoroughly evaluated. The aims of this study were: (i) to assess the prevalence of B. cereus in milk and dairy products from the Apulia region in southern Italy; (ii) to investigate the genetic diversity of the isolates; and (iii) to assess the potential pathogenicity of the isolates.

2. Materials and Methods

2.1. Sample Collection

During the period between 2016 and 2017 a total of 550 samples of milk and cheese products in Apulia region (southern Italy) were sampled at retail level, comprising 390 samples of hard cheese (Caciocavallo), 128 samples of soft cheeses (83 samples of mozzarella and 45 samples of ricotta cheese), 27 samples of raw milk and five samples of pasteurized milk. All samples belonged to different manufacturing lots.

2.2. Detection and Isolation of B. cereus (s.l.)

The detection of B. cereus s.l. was performed by the protocol reported in the European standard ISO 21871:2006 [38]. The qualitative detection was performed using the Mannitol Egg Yolk Polymyxin Agar (MYP) (Biolife Italiana srl—Milan, Italy) as solid mediumincubated at 30 °C for 18–24 h. Suspect colonies were confirmed by the haemolysis test.

2.3. Multi-Locus Sequence Typing (MLST)

One isolate per positive sample was characterized by MLST. Genomic DNA was extracted from the B. cereus isolates by the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), according to manufacturer’s protocol. Seven housekeeping genes were amplified with different primers and conditions, according to the MLST protocol for B. cereus in the PubMLST database [39]. The PCR products were purified using ExoSAP-IT according to the supplier’s recommendations (GE Healthcare, Chicago, IL, USA). Sequence reactions were carried out using BigDye 3.1 Ready reaction mix (Life Technologies, Thermo Fischer Scientific Carlsbad, CA, USA) according to the manufacturer’s instructions. The sequenced products were separated with a 3130 Genetic Analyzer (Life Technologies, Thermo Fischer Scientific Carlsbad, CA, USA). Sequences were imported and assembled with Bionumerics 7.6 software (Applied Maths, Saint Marteen-Latem, Belgium). Any new alleles and STs were assigned by submitting the DNA sequences to the B. cereus MLST database].

2.4. Detection of Enterotoxin and Emetic Genes

PCR amplification was performed to detect ten genes (hblA, hblC, hblD, nheA, nheB, nheC, cytK-2, entFM, entS and ces) with a 25 µL reaction mixture consisting of ~50 ng of genomic DNA, 12.5 µL PCR Buffer, 2 U of enzyme Taq Polymerase, 0.2 mM dNTPs mix and 1 µM each primer. All the primers used in this study are listed in Table 1. The PCR amplifications were performed as previously described [32,40,41,42,43,44]. The data were combined in Microsoft Excel and uploaded to BioNumerics version 7.6 (Applied Maths, Saint Marteen-Latem, Belgium).

2.5. Statistical Analysis

STs versus toxin gene profile were compared by Spearman correlation (GraphPad Prism 8.1.1).

3. Results

3.1. Detection Rate of B. cereus s.l.

B. cereus s.l. was detected in 139 of 550 (25.3%) of the analysed samples (Table 2): out of 139 positive samples, three (2.1%) were in raw milk, one (0.7%) was in pasteurized milk and 135 (97.1%) were in cheeses. Among cheeses, B. cereus s.l. was detected in: 83 (59.7%) samples of Cacio cavallo, 36 (25.9%) samples of mozzarella cheese and 16 (11.5%) samples of ricotta cheese. The highest contamination rate was detected in mozzarella cheese (36 positive samples/83 analysed samples; 43.3%), the lowest in raw milk samples (three positive samples/27 analysed samples; 1.1%). A contamination rate of 21.2% (83/390), 35.5% (16/45) and 20% (1/5) were detected in Caciocavallo, ricotta cheese and pasteurized milk, respectively.

3.2. Strains Characterization by MLST

The results of the isolates characterization are summarized in Table 2 and Figure 1. A total of 139 isolates were characterized by the MLST and 73 STs were assigned; 12 isolates were assigned to new STs. Twenty-two isolates were grouped into nine clonal complexes (CCs). The dominant STs among all positive samples were ST 1986 and ST 34, instead, ST34, ST12 and ST26 were the dominant STs in Caciocavallo, ricotta cheese and mozzarella, respectively. The new detected STs were: ST2491, ST2667, ST2660, ST2661, ST2683, ST2664, ST2669, ST2666, ST2671, ST2675, ST2670 and ST2682.

3.3. Distribution of Enterotoxin Genes

The distribution of virulence genes is reported in Table 2 and Figure 2. According to the pathogenic characteristics of B. cereus s.l. the virulence genes were divided into two categories, namely enterotoxin coding genes (hblACD, nheABC, cytK, entFM, entS) and cereulide synthetase gene (ces). Among the enterotoxin genes, the genes of the nheABC cluster were detected in 90% of the isolates and in most of them was recovered the entire nheABC gene cluster; only three isolates were lacking the entire nheABC gene cluster. The gene cluster hblCDA was found in 61% of isolates, with a frequency not much different among the three genes detected: 68% of isolates harboured the hblA gene, 64% of isolates harboured the hblC gene and 75% of isolates harboured the hblD gene. The entFM and entS genes were detected in 94% of isolates; the cytK gene was identified in 44%. The ces gene was detected in 8% of the total isolates. Based on the distribution of both, enterotoxin and emetic genes, we divided our isolates in thirty-eight (1-38) different genetic profiles (Table 2).

3.4. Statistical Analysis

When we compared the STs versus toxin gene profile by Spearman correlation (GraphPad Prism 8.1.1), no statistical significance was shown (r = −0.01462; p = 0.87144).

4. Discussion

B. cereus is a ubiquitous spore-forming bacterium widespread in the environment and frequently detected in a wide range of foodstuffs, including milk and cheeses, where it can act as foodborne pathogen. Because of the ubiquitous presence of B. cereus spores, dairy products can become contaminated during milking, processing or storage stages [45,46]. As a matter of fact, during 2007–2014, dairy products were responsible for 11 outbreaks due to B. cereus registered in EU [20]. The aim of our survey was to investigate the presence of B. cereus s.l., the genetic profile and the distribution of genetic virulence markers in the isolates obtained from milk (raw and pasteurized) and traditional cheeses from the Apulia region, southern Italy. In our study we found that 25.3% of all samples were contaminated by B. cereus s.l.; to the best of our knowledge, in Italy, data on the prevalence and the genetic characterization of B. cereus in milk and dairy products are scarce, thus it is not possible to make any comparison with previous reports. Other countries reported similar results that we found here: in China [2,47], Abidjan [48] and Brazil [49], B. cereus was detected in 27% of the milk and dairy products analysed. Recently, Adame-Gomez and colleagues reported a frequency of 29.5% of B. cereus contamination in artisanal cheese made with raw milk product in Mexico [50], whereas, in Ghana [3], Slovakia [51], India [4] and Northeast China [52], B. cereus was reported with a contamination level that ranged from 14 to 55%. Notably, among the food samples considered in this survey, we identified B. cereus s.l. in pasteurized milk; considering the ability of B. cereus to form spores that are able to survive heat treatment commonly applied in milk pasteurization [53,54], this result is not surprising. Although it is not possible to ascertain if the contamination occurs before, during the pasteurization or the filling process, spore germination and vegetative cells replication is a remote possibility, given that pasteurized milk must be stored under refrigeration and also considering its short shelf-life. In addition, psychrotrophic strains of B. cereus are known, but these isolates are generally recognized as not able to produce cereulide, thus the presence of this contamination should not pose a risk in refrigerated foods [55].
We analysed 390 samples of Caciocavallo, and 21.2% of these were contaminated by B. cereus s.l.. Caciocavallo is a very appreciated traditional curd-stretching cheese which has a large distribution in southern Italy, where it is produced from raw or pasteurized bovine milk; the season can last from two to six or more months [56].
In our survey, mozzarella and ricotta (soft cheeses) resulted contaminated in 25.8% and 11.5%, respectively, among all samples considered. These soft cheeses showed the highest rate of contamination compared other samples, with a contamination rate of 43.3% for mozzarella and 35.5% for ricotta. Mozzarella is the most famous Italian curd-stretching cheese, produced from raw or pasteurized cow or water buffalo milk [56]; in fact, some mozzarella cheeses have been awarded the protected designation of origin (POD). Ricotta is a much-appreciated food which is largely employed for direct consumption or as an ingredient for bakery and pastries products. The production process of this unripened acid-heat coagulated dairy originating from the whey obtained from draining cheese curds from curdling of other cheeses [57], includes a step in which it is applied a temperature that is able to reduce the pathogenic vegetative flora [58]. However, spore-forming bacteria could survive at these steps and, if other favourable conditions occur, they could germinate and multiply causing an active infection or an intoxication. In addition, it is not possible to establish whether the contamination occurs in the pre- or post-process steps, considering the heath resistance of B. cereus spores. Our results showed for the first time the high prevalence of B. cereus s.l. in milk and dairy products from Italy; it is known that dairy products, that are subjected to a mild heat treatment and are characterized by an extended shelf life under refrigeration, could be at risk because the competitive vegetative microflora is inactivated either by heat treatment or by reduced water activity, but enables the survival of the spores of B. cereus [53]. The high prevalence identified in our study supports the potential risk due to the consumption of B. cereus-contaminated dairy products; despite the existence of B. cereus psychrotolerant isolates capable to produce emetic toxin at low temperature [59], the main management option for controlling the growth of the organism in foodstuff remains the chill chain (storage temperature between <4 °C and 7 °C) that could be maintained during the entire production until the consumers receive them [49,54].
In our study, we did not assess the quantification of the samples contamination; on the other hand, it is known that it is very difficult to estimate the number of Colony Forming Unit (CFU) of B. cereus per g of food that could represent a risk for consumers: in literature cases in which 103 CFU/g were responsible of diseases are reported [20], although a concentration of B. cereus above 105 CFU/g is considered hazardous [60,61,62]. In the EU food law, B. cereus is considered as Process Hygiene Criterion for dried infant formulae and dried dietary foods for medical purposes intended for infants below six months of age; in case of exceeding the established limits (between 50 and 500 CFU/g), the food operator must improve his hygiene production procedures and prevent recontamination. In addition, they must carry out a selection of the raw material which has been used [63].
Based on the MLST profile, our isolates showed a high genetic diversity. Indeed, 12 of 73 MLST profiles (16.4% of the studied strains) were detected for the first time in this study; whereas the remaining profiles were already present in the MLST B. cereus database and, among these, twenty-three STs were previously identified in milk and milk products [64,65,66]. The other STs were previously identified in other foods or in the environment [65,67,68,69,70]. B. cereus isolates related with emetic food poisoning, were generally associated with ST26 [33,42,43,71,72]; in our study, among the four isolates belonging to ST26, three harboured ces gene, supporting the hypothesis that this genotype frequently harbour the potential emetic strains; however, these strains did not carry the hbl cluster gene, as was already reported [33]. Interestingly, we identified nine additional STs (ST4, ST33, ST142, ST1936, ST2031, ST2045, ST2062, ST2667 and ST2666) that may become important to define the potential emetic strains for the presence of ces gene. Moreover, we noticed that all the isolates belonging to the CC18 and CC205 harboured the same virulence profile (profile 2). Furthermore, we identified an isolate that carried the ces gene and among the enterotoxin genes we detected only the entS gene. Based on genetic profile, we supposed that the infection due to the two isolates belonging to profile 1 (ST4; ST33) could be associated to a worst-case scenario [73,74], since they harboured all the genes investigated. The genetic profiles 2 and 5 represented the largest group, which included a total of 39 and 27 isolates, respectively. The isolates that belonged to genetic profile 2, including 19 STs, harboured all the enterotoxigenic genes, suggesting their enterotoxigenic potential; whereas the isolates that belonged to genetic profile 5, that included 21 STs, harboured eight of the nine enterotoxin genes, since they did not carry the cytK gene. This finding confirms that the health risk for consumers is strongly strain dependent, owing to the various pathogenic potential [20].
B. cereus diarrhoeal disease is due to the synthesis of different enterotoxins in the small intestine [29]; according to EFSA, about all strains of B. cereus carry the non-haemolytic enterotoxin complex genes (nhe), whereas about 30–70% of the isolates harboured the hbl and cytK-2 genes [20]. In our study, nine enterotoxigenic genes were detected and the proportion of hblACD, nheABC and cytK genes in B. cereus s.l. isolates were found to be, 61%, 90% and 44%, respectively. These frequencies were similar to previous studies [2,75,76,77], suggesting that the diarrheagenic isolates have a high distribution among foods. Moreover, we detected two other enterotoxin genes (entFM and entS), which contribute to the severity of diarrheal illness [78]. Differently, the emesis is due to the heat-stable dodecadepsipeptide cereulide, that, similarly to other reports [3,79] we observed in 8% of the isolates. A number of studies failed to detect ces genes from food isolates [77,80], probably because the emetic isolates of B. cereus belong to a specific lineage that has a different geographical circulation [81]; however, it is difficult to give a conclusive opinion about the potential pathogenicity of the isolates because it is known that a large variability in synthesis of these enterotoxins exist among the B. cereus isolates, as well as it is still unknown why isolates that show the same genetic profile show differences in the amount of toxin production [19,47]. The strain’s growth and the cereulide production are due to the composition of the food and the environment in different way; Ellouze recently demonstrated that in some food matrices (i.e., cereal-based foods) the growth rate of B. cereus is smaller than in other foods (i.e., milk-based products) but the cereulide production is faster than in foods where the growth is faster [82].

5. Conclusions

We believe that the potential hazard associated with contaminated foods by B. cereus s.l. should not be ignored. To ensure the protection of the public health, it is therefore necessary to develop procedures to prevent contamination of raw ingredients, to implement a plan based on hazard analysis and critical control point procedures during the manufacturing process of dairy products and strictly to respect the chill chain during their commercial and home storage.
The lack of information about the acidity, salinity, water activity, moisture and the cultures used for the production of the samples we analysed, factors that affect the growth of B. cereus, represent a weakness in our survey; further studies aimed at correlating these critical factors with the growth and toxin production by B. cereus in such foods are needed [44].

Author Contributions

Conceptualization: A.B. and A.P.; methodology, A.B. and A.P. software, A.B. and A.P.; data curation, A.B., A.P., G.N., L.C., L.D.S., L.D.F., A.M., M.C., F.P., P.D.T. and A.A.; writing—original draft preparation, A.B., A.P., G.N., A.M., L.C., L.D.F., L.D.S. and M.C.; writing—review and editing, F.P., P.D.T. and A.A.; supervision, G.N.; funding acquisition, A.B. and A.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was founded by Ministero della Salute-Ricerca corrente IZS PB 04/16 RC and by Consiglio Nazionale delle Ricerche-Flagship project Interomics.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Carroll, L.M.; Wiedmann, M.; Kovac, J. Proposal of a taxonomic nomenclature for the Bacillus cereus group which reconciles genomic definitions of bacterial species with clinical and industrial phenotypes. MBio 2020, 11, e00034-20. [Google Scholar] [CrossRef] [Green Version]
  2. Gao, T.; Ding, Y.; Wu, Q.; Wang, J.; Zhang, J.; Yu, S.; Yu, P.; Liu, C.; Kong, L.; Feng, Z.; et al. Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Bacillus cereus isolated from pasteurized milk in China. Front. Microbiol. 2018, 9, 533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Owusu-Kwarteng, J.; Wuni, A.; Akabanda, F.; Tano-Debrah, K.; Jespersen, L. Prevalence, virulence factor genes and antibiotic resistance of Bacillus cereus sensu lato isolated from dairy farms and traditional dairy products. BMC Microbiol. 2017, 17, 65. [Google Scholar] [CrossRef] [Green Version]
  4. Rather, M.; Aulakh, R.S.; Gill, J.P.S.; Verma, R.; Rao, T.S. Enterotoxigenic profile of Bacillus cereus strains isolated from raw and pasteurized milk. Indian J. Anim. Sci. 2011, 81, 16–20. [Google Scholar]
  5. Dréan, P.; McAuley, C.M.; Moore, S.C.; Fegan, N.; Fox, E.M. Characterization of the spore-forming Bacillus cereus sensu lato group and Clostridium perfringens bacteria isolated from the Australian dairy farm environment. BMC Microbiol. 2015, 15, 38. [Google Scholar] [CrossRef] [Green Version]
  6. Saleh-Lakha, S.; Leon-Velarde, C.; Chen, S.; Lee, S.; Shannon, K.; Fabri, M.; Downing, G.; Keown, B. A study to assess the numbers and prevalence of Bacillus cereus and its toxins in pasteurized fluid milk. J. Food Prot. 2017, 80, 1085–1089. [Google Scholar] [CrossRef] [PubMed]
  7. Hammad, A.M.; Eltahan, A.; Khalifa, E.; Abbas, N.H.; Shimamoto, T. Toxigenic potential of Bacillus cereus strains isolated from retail dairy products in Egypt. Foodborne Pathog. Dis. 2021, 20, 20. [Google Scholar] [CrossRef]
  8. Fraccalvieri, R.; Bianco, A.; Difato, L.M.; Capozzi, L.; Del Sambro, L.; Simone, D.; Catanzariti, R.; Caruso, M.; Galante, D.; Normanno, G.; et al. Toxigenic genes, pathogenic potential and antimicrobial resistance of Bacillus cereus group isolated from ice cream and characterized by whole genome sequencing. Foods 2022, 11, 2480. [Google Scholar] [CrossRef]
  9. Flores-Urbán, K.A.; Natividad-Bonifacio, I.; Vázquez-Quiñones, C.R.; Vázquez-Salinas, C.; Quiñones-Ramírez, E.I. Detection of toxigenic Bacillus cereus strains isolated from vegetables in Mexico City. J. Food Prot. 2014, 77, 2144–2147. [Google Scholar] [CrossRef] [PubMed]
  10. Kim, Y.J.; Kim, H.S.; Kim, K.Y.; Chon, J.W.; Kim, D.H.; Seo, K.H. High occurrence rate and contamination level of Bacillus cereus in organic vegetables on sale in retail markets. Foodborne Pathog. Dis. 2016, 13, 656–660. [Google Scholar] [CrossRef]
  11. Yu, P.; Yu, S.; Wang, J.; Guo, H.; Zhang, Y.; Liao, X.; Zhang, J.; Wu, S.; Gu, Q.; Xue, L.; et al. Bacillus cereus isolated from vegetables in China: Incidence, genetic diversity, virulence genes, and antimicrobial resistance. Front. Microbiol. 2019, 10, 948. [Google Scholar] [CrossRef]
  12. Smith, D.P.; Berrang, M.E.; Feldner, P.W.; Phillips, R.W.; Meinersmann, R.J. Detection of Bacillus cereus on selected retail chicken products. J. Food Prot. 2004, 67, 1770–1773. [Google Scholar] [CrossRef] [PubMed]
  13. Choo, E.; Jang, S.S.; Kim, K.; Lee, K.G.; Heu, S.; Ryu, S. Prevalence and genetic diversity of Bacillus cereus in dried red pepper in Korea. J. Food Prot. 2007, 70, 917–922. [Google Scholar] [CrossRef]
  14. Wijnands, L.M.; Dufrenne, J.B.; Rombouts, F.M.; In’t Veld, P.H.; van Leusden, F.M. Prevalence of potentially pathogenic Bacillus cereus in food commodities in The Netherlands. J. Food Prot. 2006, 69, 2587–2594. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, Y.; Chen, M.; Yu, P.; Yu, S.; Wang, J.; Guo, H.; Zhang, J.; Zhou, H.; Chen, M.; Zeng, H.; et al. Prevalence, virulence feature, antibiotic resistance and MLST typing of Bacillus cereus isolated from retail aquatic products in China. Front. Microbiol. 2020, 11, 1513. [Google Scholar] [CrossRef] [PubMed]
  16. Te Giffel, M.C.; Beumer, R.R.; Granum, P.E.; Rombouts, F.M. Isolation and characterisation of Bacillus cereus from pasteurised milk in household refrigerators in The Netherlands. Int. J. Food Microbiol. 1997, 34, 307–318. [Google Scholar] [CrossRef] [PubMed]
  17. Berthold-Pluta, A.; Pluta, A.; Garbowska, M.; Stefańska, I. Prevalence and toxicity characterization of Bacillus cereus in food products from Poland. Foods 2019, 8, 269. [Google Scholar] [CrossRef] [Green Version]
  18. Yu, S.; Yu, P.; Wang, J.; Li, C.; Guo, H.; Liu, C.; Kong, L.; Yu, L.; Wu, S.; Lei, T.; et al. A study on prevalence and characterization of Bacillus cereus in ready-to-eat foods in China. Front. Microbiol. 2020, 10, 3043. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Jeßberger, N.; Krey, V.M.; Rademacher, C.; Böhm, M.E.; Mohr, A.K.; Ehling-Schulz, M.; Scherer, S.; Märtlbauer, E. From genome to toxicity: A combinatory approach highlights the complexity of enterotoxin production in Bacillus cereus. Front. Microbiol. 2015, 6, 560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. EFSA. Risks for public health related to the presence of Bacillus cereus and other Bacillus spp. including Bacillus thuringiensis in foodstuffs. EFSA J. 2016, 14, e04524. [Google Scholar] [CrossRef]
  21. EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control). The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, 276. [Google Scholar] [CrossRef] [Green Version]
  22. EFSA. The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, e06406. [Google Scholar] [CrossRef]
  23. EFSA and ECDC (European Food Safety Authority and European Centre for Disease Prevention and Control). The European Union One Health 2020 Zoonoses Report. EFSA J. 2021, 19, 324. [Google Scholar] [CrossRef]
  24. EFSA. The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, 273. [Google Scholar] [CrossRef]
  25. Drobniewski, F.A. Bacillus cereus and related species. Clin. Microbiol. Rev. 1993, 6, 324–338. [Google Scholar] [CrossRef]
  26. Ghelardi, E.; Celandroni, F.; Salvetti, S.; Barsotti, C.; Baggiani, A.; Senesi, S. Identification and characterization of toxigenic Bacillus cereus isolates responsible for two food-poisoning outbreaks. FEMS Microbiol. Lett. 2002, 208, 129–134. [Google Scholar] [CrossRef] [Green Version]
  27. Bottone, E.J. Bacillus cereus, a volatile human pathogen. Clin. Microbiol. Rev. 2010, 23, 382–398. [Google Scholar] [CrossRef] [Green Version]
  28. Rishi, E.; Rishi, P.; Sengupta, S.; Jambulingam, M.; Madhavan, H.N.; Gopal, L.; Therese, K.L. Acute postoperative Bacillus cereus endophthalmitis mimicking toxic anterior segment syndrome. Ophthalmology 2013, 120, 181–185. [Google Scholar] [CrossRef] [PubMed]
  29. Lund, T.; De Buyser, M.L.; Granum, P.E. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol. Microbiol. 2000, 38, 254–261. [Google Scholar] [CrossRef]
  30. Pósfay-Barbe, K.M.; Schrenzel, J.; Frey, J.; Studer, R.; Korff, C.; Belli, D.C.; Parvex, P.; Rimensberger, P.C.; Schäppi, M.G. Food poisoning as a cause of acute liver failure. Pediatr. Infect. Dis. J. 2008, 27, 846–847. [Google Scholar] [CrossRef] [PubMed]
  31. Ehling-Schulz, M.; Guinebretiere, M.H.; Monthán, A.; Berge, O.; Fricker, M.; Svensson, B. Toxin gene profiling of enterotoxic and emetic Bacillus cereus. FEMS Microbiol. Lett. 2006, 260, 232–240. [Google Scholar] [CrossRef] [Green Version]
  32. Fagerlund, A.; Ween, O.; Lund, T.; Hardy, S.P.; Granum, P.E. Genetic and functional analysis of the cytK family of genes in Bacillus cereus. Microbiol.-SGM 2004, 150, 2689–2697. [Google Scholar] [CrossRef] [Green Version]
  33. Ehling-Schulz, M.; Svensson, B.; Guinebretiere, M.H.; Lindbäck, T.; Andersson, M.; Schulz, A.; Fricker, M.; Christiansson, A.; Granum, P.E.; Märtlbauer, E.; et al. Emetic toxin formation of Bacillus cereus is restricted to a single evolutionary lineage of closely related strains. Microbiology 2005, 151, 183–197. [Google Scholar] [CrossRef] [Green Version]
  34. Clavel, T.; Carlin, F.; Lairon, D.; Nguyen-The, C.; Schmitt, P. Survival of Bacillus cereus spores and vegetative cells in acid media simulating human stomach. J. Appl. Microbiol. 2004, 97, 214–219. [Google Scholar] [CrossRef] [PubMed]
  35. Ceuppens, S.; Uyttendaele, M.; Drieskens, K.; Heyndrickx, M.; Rajkovic, A.; Boon, N.; Van de Wiele, T. Survival and germination of Bacillus cereus spores without outgrowth or enterotoxin production during in vitro simulation of gastrointestinal transit. Appl. Environ. Microbiol. 2012, 78, 7698–7705. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Rajkovic, A.; Uyttendaele, M.; Vermeulen, A.; Andjelkovic, M.; Fitz-James, I.; In’t Veld, P.; Denon, Q.; Vérhe, R.; Debevere, J. Heat resistance of Bacillus cereus emetic toxin, cereulide. Lett. Appl. Microbiol. 2008, 46, 536–541. [Google Scholar] [CrossRef] [PubMed]
  37. ISTAT. 2020. Available online: http://dati.istat.it/Index.aspx?QueryId=25520 (accessed on 18 January 2023).
  38. ISO 21871:2006; Microbiology of Food and Animal Feeding Stuffs Horizontal Method for the Determination of Low Numbers of Presumptive Bacillus cereus Most Probable Number Technique and Detection Method. ISO: Geneva, Switzerland, 2006.
  39. PubMLST Database. Available online: https://pubmlst.org/bcereus/ (accessed on 18 January 2023).
  40. Guinebretière, M.-H.; Broussolle, V.; Nguyen-The, C. Enterotoxigenic profiles of food-poisoning and food-borne Bacillus cereus strains. J. Clin. Microbiol. 2002, 40, 3053–3056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Asano, S.I.; Nukumizu, Y.; Bando, H.; Iizuka, T.; Yamamoto, T. Cloning of novel enterotoxin genes from Bacillus cereus and Bacillus thuringiensis. Appl. Environ. Microbiol. 1997, 63, 1054–1057. [Google Scholar] [CrossRef] [Green Version]
  42. Fricker, M.; Messelhäusser, U.; Busch, U.; Scherer, S.; Ehling-Schulz, M. Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl. Environ. Microbiol. 2007, 73, 1892–1898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Ehling-Schulz, M.; Vukov, N.; Schulz, A.; Shaheen, R.; Andersson, M.; Märtlbauer, E.; Scherer, S. Identification and partial characterization of the nonribosomal peptide synthetase gene responsible for cereulide production in emetic Bacillus cereus. Appl. Environ. Microbiol. 2005, 71, 105–113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Hansen, B.M.; Hendriksen, N.B. Detection of enterotoxic Bacillus cereus and Bacillus thuringiensis strains by PCR analysis. Appl. Environ. Microbiol. 2001, 67, 185–189. [Google Scholar] [CrossRef] [Green Version]
  45. Andersson, A.; Ronner, U.; Granum, P.E. What problems does the food industry have with the spore-forming pathogens Bacillus cereus and Clostridium perfringens? Int. J. Food Microbiol. 1995, 28, 145–155. [Google Scholar] [CrossRef]
  46. Svensson, B.; Ekelund, K.; Ogura, H.; Christiansson, A. Characterisation of Bacillus cereus isolated from milk silo tanks at eight different dairy plants. Int. Dairy J. 2004, 14, 17–27. [Google Scholar] [CrossRef]
  47. Liu, X.Y.; Hu, Q.; Xu, F.; Ding, S.Y.; Zhu, K. Characterization of Bacillus cereus in dairy products in China. Toxins 2020, 12, 454. [Google Scholar] [CrossRef] [PubMed]
  48. Yobouet, B.; Kouamé-Sina, S.; Dadié, A.; Makita, K.; Grace, D.; Djè, K.; Bonfoh, B. Contamination of raw milk with Bacillus cereus from farm to retail in Abidjan, Côte d’Ivoire and possible health implications. Dairy Sci. Technol. 2013, 94, 51–60. [Google Scholar] [CrossRef] [Green Version]
  49. Reis, A.L.S.; Montanhini, M.T.M.; Bittencourt, J.V.M.; Destro, M.T.; Bersot, L.S. Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil. Braz. J. Microbiol. 2013, 44, 1195–1198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Adame-Gómez, R.; Muñoz-Barrios, S.; Castro-Alarcón, N.; Leyva-Vázquez, M.A.; Toribio-Jiménez, J.; Ramírez-Peralta, A. Prevalence of the strains of Bacillus cereus group in artisanal Mexican cheese. Foodborne Pathog. Dis. 2020, 17, 8–14. [Google Scholar] [CrossRef]
  51. Acai, P.; Valík, Ľ.; Liptáková, D. Quantitative risk assessment of Bacillus cereus in pasteurised milk produced in the Slovak Republic. Czech. J. Food Sci. 2014, 32, 122–131. [Google Scholar] [CrossRef] [Green Version]
  52. Fei, P.; Yuan, X.; Zhao, S.; Yang, T.; Xiang, J.; Chen, X.; Zhou, L.; Ji, M. Prevalence and genetic diversity of Bacillus cereus isolated from raw milk and cattle farm environments. Curr. Microbiol. 2019, 76, 1355–1360. [Google Scholar] [CrossRef]
  53. Lücking, G.; Stoeckel, M.; Atamer, Z.; Hinrichs, J.; Ehling-Schulz, M. Characterization of aerobic spore-forming bacteria associated with industrial dairy processing environments and product spoilage. Int. J. Food Microbiol. 2013, 166, 270–279. [Google Scholar] [CrossRef]
  54. Tirloni, E.; Ghelardi, E.; Celandroni, F.; Bernardi, C.; Stella, S. Effect of dairy product environment on the growth of Bacillus cereus. J. Dairy Sci. 2017, 100, 7026–7034. [Google Scholar] [CrossRef] [PubMed]
  55. Carlin, F.; Fricker, M.; Pielaat, A.; Heisterkamp, S.; Shaheen, R.; Salonen, M.S.; Svensson, B.; Nguyen-The, C.; Ehling-Schulz, M. Emetic toxin-producing strains of Bacillus cereus show distinct characteristics within the Bacillus cereus group. Int. J. Food Microbiol. 2006, 109, 132–138. [Google Scholar] [CrossRef] [Green Version]
  56. Regione Puglia. Available online: https://www.patpuglia.it/ (accessed on 18 January 2023).
  57. Tirloni, E.; Stella, S.; Bernardi, C.; Sand Rosshaug, P. A new predictive model for the description of the growth of Salmonella spp. in Italian fresh ricotta cheese. LWT 2021, 143, 111163. [Google Scholar] [CrossRef]
  58. Lorusso, V.; Dambrosio, A.; Quaglia, N.C.; Parisi, A.; La Salandra, G.; Lucifora, G.; Mula, G.; Virgilio, S.; Carosielli, L.; Rella, A.; et al. Verocytotoxin-producing Escherichia coli O26 in raw water buffalo (Bubalus bubalis) milk products in Italy. J. Food Prot. 2009, 72, 1705–1708. [Google Scholar] [CrossRef]
  59. Finlay, W.J.; Logan, N.A.; Sutherland, A.D. Bacillus cereus produces most emetic toxin at lower temperatures. Lett. Appl. Microbiol. 2000, 31, 385–389. [Google Scholar] [CrossRef] [PubMed]
  60. EFSA. Opinion of the Scientific Panel on biological hazards (BIOHAZ) on Bacillus cereus and other Bacillus spp. in foodstuffs. EFSA J. 2005, 3, 175. [Google Scholar] [CrossRef]
  61. Carlin, F.; Albagnac, C.; Rida, A.; Guinebretière, M.H.; Couvert, O.; Nguyen-The, C. Variation of cardinal growth parameters and growth limits according to phylogenetic affiliation in the Bacillus cereus group. Consequences for risk assessment. Food Microbiol. 2013, 33, 69–76. [Google Scholar] [CrossRef] [PubMed]
  62. Gilbert, R.J.; de Louvois, J.; Donovan, T.; Little, C.; Nye, K.; Ribeiro, C.D.; Richards, J.; Roberts, D.; Bolton, F.J. Guidelines for the microbiological quality of some ready-to-eat foods sampled at the point of sale. PHLS Advisory Committee for Food and Dairy Products. Commun. Dis. Public Health 2000, 3, 163–167. [Google Scholar] [PubMed]
  63. EU. COMMISSION REGULATION (EC) No 1441/2007 of 5 December 2007 amending Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs. Off. J. Eur. Union 2007, L 322/12. [Google Scholar]
  64. Cardazzo, B.; Negrisolo, E.; Carraro, L.; Alberghini, L.; Patarnello, T.; Giaccone, V. Multiple-locus sequence typing and analysis of toxin genes in Bacillus cereus food-borne isolates. Appl. Environ. Microbiol. 2008, 74, 850–860. [Google Scholar] [CrossRef] [Green Version]
  65. Didelot, X.; Barker, M.; Falush, D.; Priest, F.G. Evolution of pathogenicity in the Bacillus cereus group. Syst. Appl. Microbiol. 2009, 32, 81–90. [Google Scholar] [CrossRef] [PubMed]
  66. Yang, Y.; Yu, X.; Zhan, L.; Chen, J.; Zhang, Y.; Zhang, J.; Chen, H.; Zhang, Z.; Zhang, Y.; Lu, Y.; et al. Multilocus sequence type profiles of Bacillus cereus isolates from infant formula in China. Food Microbiol. 2017, 62, 46–50. [Google Scholar] [CrossRef] [PubMed]
  67. Collier, F.A.; Elliot, S.L.; Ellis, R.J. Spatial variation in Bacillus thuringiensis/cereus populations within the phyllosphere of broad-leaved dock (Rumex obtusifolius) and surrounding habitats. FEMS Microbiol. Ecol. 2005, 54, 417–425. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Helgason, E.; Caugant, D.A.; Lecadet, M.M.; Chen, Y.; Mahillon, J.; Lövgren, A.; Hegna, I.; Kvaløy, K.; Kolstø, A.B. Genetic diversity of Bacillus cereus/B. thuringiensis isolates from natural sources. Curr. Microbiol. 1998, 37, 80–87. [Google Scholar] [CrossRef]
  69. Priest, F.G.; Barker, M.; Baillie, L.W.; Holmes, E.C.; Maiden, M.C. Population structure and evolution of the Bacillus cereus group. J. Bacteriol. 2004, 186, 7959–7970. [Google Scholar] [CrossRef] [Green Version]
  70. Priest, F.G.; Goodfellow, M.; Todd, C. A numerical classification of the genus Bacillus. J. Gen. Microbiol. 1988, 134, 1847–1882. [Google Scholar] [CrossRef] [Green Version]
  71. Agata, N.; Ohta, M.; Yokoyama, K. Production of Bacillus cereus emetic toxin (cereulide) in various foods. Int. J. Food Microbiol. 2002, 73, 23–27. [Google Scholar] [CrossRef]
  72. Vassileva, M.; Torii, K.; Oshimoto, M.; Okamoto, A.; Agata, N.; Yamada, K.; Hasegawa, T.; Ohta, M. A new phylogenetic cluster of cereulide-producing Bacillus cereus strains. J. Clin. Microbiol. 2007, 45, 1274–1277. [Google Scholar] [CrossRef] [Green Version]
  73. Dierick, K.; Van Coillie, E.; Swiecicka, I.; Meyfroidt, G.; Devlieger, H.; Meulemans, A.; Hoedemaekers, G.; Fourie, L.; Heyndrickx, M.; Mahillon, J. Fatal family outbreak of Bacillus cereus-associated food poisoning. J. Clin. Microbiol. 2005, 43, 4277–4279. [Google Scholar] [CrossRef] [Green Version]
  74. Wetterhall, M.; Grönberg, A.; Grönlund, S.; Björkman, T.; Sandberg, L.; Musunuri, S.; Chaloupka, K.; Gammell, P. Removal of B. cereus cereulide toxin from monoclonal antibody bioprocess feed via two-step Protein A affinity and multimodal chromatography. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2019, 1118–1119, 194–202. [Google Scholar] [CrossRef]
  75. Cui, Y.; Liu, Y.; Liu, X.; Xia, X.; Ding, S.; Zhu, K. Evaluation of the toxicity and toxicokinetics of cereulide from an emetic Bacillus cereus strain of milk origin. Toxins 2016, 8, 156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Glasset, B.; Herbin, S.; Guillier, L.; Cadel-Six, S.; Vignaud, M.L.; Grout, J.; Pairaud, S.; Michel, V.; Hennekinne, J.A.; Ramarao, N.; et al. Bacillus cereus-induced food-borne outbreaks in France, 2007 to 2014: Epidemiology and genetic characterisation. Eurosurveillance 2016, 21, 30413. [Google Scholar] [CrossRef] [Green Version]
  77. Sánchez Chica, J.; Correa, M.M.; Aceves-Diez, A.E.; Rasschaert, G.; Heyndrickx, M.; Castañeda-Sandoval, L.M. Genomic and toxigenic heterogeneity of Bacillus cereus sensu lato isolated from ready-to-eat foods and powdered milk in day care centers in Colombia. Foodborne Pathog. Dis. 2020, 17, 340–347. [Google Scholar] [CrossRef] [Green Version]
  78. Castiaux, V.; Laloux, L.; Schneider, Y.J.; Mahillon, J. Screening of cytotoxic B. cereus on differentiated Caco-2 cells and in co-culture with mucus-secreting (HT29-MTX) Cells. Toxins 2016, 8, 320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  79. Biesta-Peters, E.G.; Dissel, S.; Reij, M.W.; Zwietering, M.H.; In’t Veld, P.H. Characterization and exposure assessment of emetic Bacillus cereus and cereulide production in food products on the Dutch market. J. Food Prot. 2016, 79, 230–238. [Google Scholar] [CrossRef] [PubMed]
  80. Sánchez-Chica, J.; Correa, M.M.; Aceves-Diez, A.E.; Castañeda-Sandoval, L.M. Enterotoxin gene distribution and genotypes of Bacillus cereus sensu lato isolated from Cassava starch. Toxins 2021, 13, 131. [Google Scholar] [CrossRef] [PubMed]
  81. Økstad, O.A.; Kolstø, A.-B. Genomics of Bacillus Species. In Genomics of Foodborne Bacterial Pathogens; Wiedmann, M., Zhang, W., Eds.; Springer: New York, NY, USA, 2011; pp. 29–53. [Google Scholar] [CrossRef]
  82. Ellouze, M.; Buss Da Silva, N.; Rouzeau-Szynalski, K.; Coisne, L.; Cantergiani, F.; Baranyi, J. Modeling Bacillus cereus growth and cereulide formation in cereal-, dairy-, meat-, vegetable-based food and culture medium. Front. Microbiol. 2021, 12, 639546. [Google Scholar] [CrossRef] [PubMed]
Foods 12 01548 g001 550
Figure 1. Minimum spanning tree analysis, using BioNumerics version 7.1, of the 139 B. cereus isolates based on allelic profiles of seven housekeeping genes. Each circle corresponds to a sequence type (ST) and the size of the circle is related to the number of isolates found with that profile. Each colour inside the circles represents the source origin of the strains (green, Caciocavallo; red, Mozzarella; indigo, Ricotta; yellow, milk).
Figure 1. Minimum spanning tree analysis, using BioNumerics version 7.1, of the 139 B. cereus isolates based on allelic profiles of seven housekeeping genes. Each circle corresponds to a sequence type (ST) and the size of the circle is related to the number of isolates found with that profile. Each colour inside the circles represents the source origin of the strains (green, Caciocavallo; red, Mozzarella; indigo, Ricotta; yellow, milk).
Foods 12 01548 g001
Foods 12 01548 g002 550
Figure 2. Bionumerics phylogenetic tree built on 139 B. cereus isolates. The tree is based on 73 ST profiles. The presence of virulence factors are marked in blue colour. The source and STs are listed next the tree.
Figure 2. Bionumerics phylogenetic tree built on 139 B. cereus isolates. The tree is based on 73 ST profiles. The presence of virulence factors are marked in blue colour. The source and STs are listed next the tree.
Foods 12 01548 g002
Table
Table 1. PCR primers targeting the virulence genes investigated in this study.
Table 1. PCR primers targeting the virulence genes investigated in this study.
TargetGenePrimer Sequence (5′-3′)Reference
hblAhblA_FGTGCAGATGTTGATGCCGAT[40]
HBLA_RATGCCACTGCGTGGACATAT
hblCL2A_FAATGGTCATCGGAACTCTAT[40]
L2B_RCTCGCTGTTCTGCTGTTAAT
hblDL1A_FAATCAAGAGCTGTCACGAAT[40]
L1B_RCACCAATTGACCATGCTAAT
nheAnheA_FTACGCTAAGGAGGGGCA[40]
nheA_RGTTTTTATTGCTTCATCGGCT
nheBnheB_FCTATCAGCACTTATGGCAG[32]
nheB_RACTCCTAGCGGTGTTCC
nheCnheC_FCGGTAGTGATTGCTGGG[32]
nheC_RCAGCATTCGTACTTGCCAA
cytKcytK_FACAGATATCGGKCAAAATGC[26]
cytK_RTCCAACCCAGTTWSCAGTTC
entFMentFM_FATGAAAAAAGTAATTTGCAGG[41]
entFM_RTTAGTATGCTTTTGTGTAACC
entSentS_FGGTTTAGCAGCAGCTTCTGTAGCTGGCG[41]
entFM_RCTTGTCCAACTACTTGTAGCACTTGGCC
cesces_FGGTGACACATTATCATATAAGGTG[42]
ces_RGTAAGCGAACCTGTCTGTAACAACA
Table
Table 2. Characterization and virulence genetic profile of the B. cereus s.l. isolated from cheeses and milk. The STs identified for the first time were indicated in bold.
Table 2. Characterization and virulence genetic profile of the B. cereus s.l. isolated from cheeses and milk. The STs identified for the first time were indicated in bold.
Source STCCGenes Encoding for EnterotoxinsCereulide Encoding GeneGenetic Profile
hblAhblChblDnheAnheBnheCcytKentFMentSces
Caciocavallo4ST-142 complex++++++++++1
Caciocavallo33 ++++++++++1
Caciocavallo1967 +++++++++-2
Mozzarella2491 +++++++++-2
Caciocavallo1967 +++++++++-2
Caciocavallo1967 +++++++++-2
Caciocavallo24 +++++++++-2
Caciocavallo800ST-111 complex+++++++++-2
Caciocavallo2010ST-142 complex+++++++++-2
Caciocavallo2010ST-142 complex+++++++++-2
Caciocavallo1967 +++++++++-2
Caciocavallo2010ST-142 complex+++++++++-2
Caciocavallo24 +++++++++-2
Caciocavallo2013ST-23 complex+++++++++-2
Ricotta1967 +++++++++-2
Caciocavallo2041 +++++++++-2
Caciocavallo24 +++++++++-2
Caciocavallo24 +++++++++-2
Caciocavallo24 +++++++++-2
Caciocavallo1355ST-18 complex+++++++++-2
Caciocavallo33 +++++++++-2
Caciocavallo33 +++++++++-2
Caciocavallo33 +++++++++-2
Caciocavallo2083 +++++++++-2
Caciocavallo15ST-8 complex+++++++++-2
Caciocavallo2095 +++++++++-2
Caciocavallo4ST-142 complex+++++++++-2
Caciocavallo197ST-23 complex+++++++++-2
Caciocavallo262 +++++++++-2
Caciocavallo205ST-205 complex+++++++++-2
Caciocavallo2031 +++++++++-2
Caciocavallo2031 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo1986 +++++++++-2
Caciocavallo500 +++++++++-2
Caciocavallo4ST-142 complex+++++++-+-3
Caciocavallo24 +++++++-+-3
Mozzarella142 ++++++-+++4
Mozzarella2667 ++++++-+++4
Caciocavallo2002 ++++++-++-5
Caciocavallo1833 ++++++-++-5
Mozzarella278 ++++++-++-5
Milk59 ++++++-++-5
Mozzarella1967 ++++++-++-5
Milk56 ++++++-++-5
Ricotta1355 ++++++-++-5
Mozzarella414 ++++++-++-5
Mozzarella24 ++++++-++-5
Mozzarella2660 ++++++-++-5
Mozzarella2661 ++++++-++-5
Ricotta142 ++++++-++-5
Mozzarella12 ++++++-++-5
Ricotta12ST-23 complex++++++-++-5
Ricotta2683 ++++++-++-5
Mozzarella818 ++++++-++-5
Mozzarella23ST-23 complex++++++-++-5
Mozzarella2038 ++++++-++-5
Mozzarella2038 ++++++-++-5
Ricotta2664 ++++++-++-5
Ricotta23 ++++++-++-5
Ricotta1756 ++++++-++-5
Milk1665 ++++++-++-5
Mozzarella12 ++++++-++-5
Mozzarella2683 ++++++-++-5
Mozzarella562ST-111 complex++++++-++-5
Ricotta24 ++++++-++-5
Caciocavallo2002 ++++++-+--6
Caciocavallo2026 ++++++-+--6
Caciocavallo632 ++++++-+--6
Mozzarella2660 ++++++-+--6
Caciocavallo2031 ++++++-+++7
Milk1810 ++++++-++-8
Mozzarella551 ++++++-++-8
Mozzarella2669 ++++++-++-8
Mozzarella2261 ++++++-++-8
Caciocavallo2036 ++++++--+-9
Caciocavallo2031 +++++--++-10
Caciocavallo33 +++-+++-+-11
Caciocavallo2036 +++----+--12
Mozzarella1986 ++-++++++-13
Caciocavallo8ST-8 complex++-++-+++-14
Caciocavallo4ST-142 complex+-+++++++-15
Caciocavallo33 +-+++++++-15
Ricotta12 +-++++-++-16
Mozzarella2666 +-++++-+++17
Mozzarella1578ST-97 complex+-++++-++-18
Caciocavallo12ST-23 complex+-++++--+-19
Caciocavallo2033ST-23 complex+-++++--+-19
Ricotta1063 +--+++-++-20
Caciocavallo1986 -+++++++++21
Caciocavallo2084ST-365 complex-+++-+-++-22
Caciocavallo34 --+++++++-23
Caciocavallo34 --+++++++-23
Caciocavallo34 --+++++++-23
Caciocavallo34 --+++++++-23
Caciocavallo509 --+++++-+-24
Caciocavallo1097 --++++-++-25
Caciocavallo1097 --++++-++-25
Caciocavallo2028 --++-+-+--26
Caciocavallo2062 --+-++-+++27
Caciocavallo2116 --+---+---28
Caciocavallo34 ---++++++-29
Caciocavallo34 ---++++++-29
Caciocavallo34 ---++++++-29
Caciocavallo34 ---++++++-29
Caciocavallo34 ---++++++-29
Mozzarella1420 ---+++-++-30
Ricotta120 ---+++-++-30
Mozzarella1655 ---+++-++-30
Mozzarella1007 ---+++-++-30
Caciocavallo92 ---+++-++-30
Mozzarella92 ---+++-++-30
Mozzarella2671 ---+++-++-30
Mozzarella92 ---+++-++-30
Ricotta 1223 ---+++-++-30
Mozzarella26 ---+++-+++31
Caciocavallo26 ---+++-+++31
Caciocavallo1097 ---+++-++-32
Ricotta 164 ---+++-++-32
Mozzarella1097 ---+++-++-32
Mozzarella26 ---+++-++-32
Ricotta2675 ---+++-++-32
Mozzarella2670 ---+++-++-32
Caciocavallo371 ---+++-++-32
Ricotta2682 ---+++-++-32
Mozzarella369 ---+++-++-33
Caciocavallo1097 ---+++-+--34
Caciocavallo34 ---++-+++-35
Caciocavallo996 ---++--++-36
Caciocavallo1263ST-365 complex---++--++-36
Caciocavallo2062 ----++-++-37
Caciocavallo2062 ----++-++-37
Mozzarella26 --------++38
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bianco, A.; Normanno, G.; Capozzi, L.; Del Sambro, L.; Di Fato, L.; Miccolupo, A.; Di Taranto, P.; Caruso, M.; Petruzzi, F.; Ali, A.; et al. High Genetic Diversity and Virulence Potential in Bacillus cereus sensu lato Isolated from Milk and Cheeses in Apulia Region, Southern Italy. Foods 2023, 12, 1548. https://doi.org/10.3390/foods12071548

AMA Style

Bianco A, Normanno G, Capozzi L, Del Sambro L, Di Fato L, Miccolupo A, Di Taranto P, Caruso M, Petruzzi F, Ali A, et al. High Genetic Diversity and Virulence Potential in Bacillus cereus sensu lato Isolated from Milk and Cheeses in Apulia Region, Southern Italy. Foods. 2023; 12(7):1548. https://doi.org/10.3390/foods12071548

Chicago/Turabian Style

Bianco, Angelica, Giovanni Normanno, Loredana Capozzi, Laura Del Sambro, Laura Di Fato, Angela Miccolupo, Pietro Di Taranto, Marta Caruso, Fiorenza Petruzzi, Ashraf Ali, and et al. 2023. "High Genetic Diversity and Virulence Potential in Bacillus cereus sensu lato Isolated from Milk and Cheeses in Apulia Region, Southern Italy" Foods 12, no. 7: 1548. https://doi.org/10.3390/foods12071548

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop