Next Article in Journal
What to Do with the New Antibiotics?
Next Article in Special Issue
The African Wastewater Resistome: Identifying Knowledge Gaps to Inform Future Research Directions
Previous Article in Journal
Predicted Environmental Risk Assessment of Antimicrobials with Increased Consumption in Portugal during the COVID-19 Pandemic; The Groundwork for the Forthcoming Water Quality Survey
Previous Article in Special Issue
The Impact of Tetracycline Pollution on the Aquatic Environment and Removal Strategies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 4
10.3390/antibiotics12040653
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater

by
Mohammad Irfan
*,
Alhomidi Almotiri
and
Zeyad Abdullah AlZeyadi
Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Shaqra University, Shaqra 11961, Saudi Arabia
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(4), 653; https://doi.org/10.3390/antibiotics12040653
Submission received: 28 February 2023 / Revised: 19 March 2023 / Accepted: 23 March 2023 / Published: 26 March 2023
(This article belongs to the Special Issue Antimicrobial Resistance and Environmental Health)
Versions Notes

Abstract

:
Hospital and municipal wastewater contribute to the spread of antibiotic-resistant bacteria and genes in the environment. This study aimed to examine the antibiotic resistance and β-lactamase production in clinically significant Gram-negative bacteria isolated from hospital and municipal wastewater. The susceptibility of bacteria to antibiotics was tested using the disk diffusion method, and the presence of extended-spectrum β-lactamases (ESBL) and carbapenemases was determined using an enzyme inhibitor and standard multiplex PCR. Analysis of antimicrobial resistance of total bacterial strains (n = 23) revealed that most of them were resistant to cefotaxime (69.56%), imipenem (43.47%), meropenem (47.82%) and amoxicillin-clavulanate (43.47%), gentamicin (39.13%), cefepime and ciprofloxacin (34.78%), trimethoprim-sulfamethoxazole (30.43%). A total of 8 of 11 phenotypically confirmed isolates were found to have ESBL genes. The blaTEM gene was present in 2 of the isolates, while the blaSHV gene was found in 2 of the isolates. Furthermore, the blaCTX-M gene was found in 3 of the isolates. In one isolate, both the blaTEM and blaSHV genes were identified. Furthermore, of the 9 isolates that have been phenotypically confirmed to have carbapenemase, 3 were confirmed by PCR. Specifically, 2 isolates have the blaOXA-48 type gene and 1 have the blaNDM-1 gene. In conclusion, our investigation shows that there is a significant rate of bacteria that produce ESBL and carbapenemase, which can promote the spread of bacterial resistance. Identifying ESBL and carbapenemase production genes in wastewater samples and their resistance patterns can provide valuable data and guide the development of pathogen management strategies that could potentially help reduce the occurrence of multidrug resistance.

1. Introduction

Hospital wastewater is considered potentially hazardous due to the presence of pharmaceutical residues, radioisotopes, and microbes, which could pose risks to human and environmental health. Antibiotics used in hospitals can end up in wastewater through patient urine and feces, selecting multidrug resistant (MDR) bacteria to thrive. This is because the human body is unable to fully metabolize some of the active ingredients in these drugs [1]. The sewer system in metropolitan areas transports antibiotic residues and resistant bacteria from people and/or animals to discharge sites, such as wastewater treatment facilities [2]. The MDR bacteria that produce hydrolyzing enzymes are found regularly in hospitals but have also been found in environmental sources such as rivers, seawater, and wastewater from both urban and hospital sources [3,4,5,6]. Studies have found that municipal wastewater treatment plants can harbor MDR bacteria that can spread to the environment [7,8]. The prevalence of antibiotic-resistant bacteria (ARB) varies over time and between hospitals and wastewater treatment plants (WWTP) in different locations [9]. The spread of extended-spectrum β-lactamases (ESBL) has become an important factor in the emergence of gram-negative MDR bacteria in hospitals, identified in Europe and then worldwide [10]. The β-lactam class of antibiotics is the most commonly prescribed group of antibacterial agents, accounting for approximately 70% of prescriptions, due to their ability to effectively target a wide range of bacteria [11]. These antibiotics are commonly used to treat severe infections, but their effectiveness has been compromised by the emergence of ESBL and carbapenemase, which have a negative impact on their clinical use [12].
The World Health Organization (WHO) has identified carbapenemase-producing Enterobacteriaceae (CRE) as a critical threat to human health and has included it in its list of priority diseases for which new treatments are urgently needed. CRE has become a major concern in recent years due to its resistance to antibiotics and the proliferation of antibiotic-resistant pathogens, which poses a significant challenge for Saudi Arabia [13]. The transmission of antibiotic-resistant strains of Enterobacteriaceae is a significant concern, and the large volume of human movement (pilgrim, tourism, work) within and outside the Gulf region is a major risk factor for their spread. These strains have been documented in several studies in various regions of Saudi Arabia [14,15,16,17,18,19]. There is a lack of data on the prevalence and patterns of antimicrobial resistant bacteria in hospital and municipal wastewater in Saudi Arabia. Therefore, we conducted this study to determine the resistance patterns of clinically significant isolates to various antibiotics and to investigate the presence of ESBL and carbapenemase-producing bacteria. The study also aimed to determine the presence of specific ESBL and carbapenemase genes in isolated organisms.

2. Results

2.1. Bacterial Isolation

In this study, 23 bacterial isolates from MacConkey agar containing 2 µg of meropenem were selected (as shown in Table 1). Of these isolates, 7 were obtained from hospital wastewater samples, 14 were obtained from municipal wastewater samples, and 2 were obtained from municipal treated wastewater samples. No isolates were obtained from treated wastewater samples collected from the hospital.

2.2. Identification of Isolates

Of 23 isolates, 13 were found to belong to the Enterobacteriaceae family, including 3 E. coli, 4 Klebsiella spp., 3 Enterobacter spp., 2 Citrobacter spp. and 1 Proteus spp. The remaining 11 strains were identified as non-Enterobacteriaceae, including 5 Acinetobacter spp. and 5 Pseudomonas spp. Of the total of seven isolates from hospital wastewater, the most predominant taxa were Acinetobacter spp. followed by Klebsiella spp., Enterobacter spp. and Pseudomonas spp. In the wastewater and treated wastewater samples collected from the municipality, we identified 16 strains of bacteria. The most common strains were Pseudomonas spp. followed by E. coli, Klebsiella spp., Acinetobacter spp., Enterobacter spp., Citrobacter spp., and Proteus spp. (Table S1, supplementary materials).

2.3. Determination of the Antimicrobial Susceptibility Pattern of the Isolates

In our study, the antibiotic susceptibility patterns of the Enterobacteriaceae strains were as follows: Enterobacter spp. (n = 3) Isolated from the hospital and municipal wastewater and treated wastewater were found resistant to amoxicillin-clavulanate (66.66%), cefotaxime (100%), imipenem (33.33%), meropenem (33.33%), gentamicin (66.66%), ciprofloxacin (33.33%) and trimethoprim-sulfamethoxazole (33.33%). Klebsiella spp. (n = 4) isolated from hospital and municipal wastewater showed resistance to amoxicillin-clavulanate (50%), cefotaxime (75%), cefepime (25%), imipenem (75%), meropenem (50%), ciprofloxacin (25%), gentamicin (25%) and trimethoprim-sulfamethoxazole (50%). E. coli spp. (n = 3) isolated from municipal wastewater showed resistance to ceftazidime (33.33%), cefotaxime (100%), imipenem (33.33%), meropenem (33.33%), ciprofloxacin (66.66%), gentamicin (33.33%) and trimethoprim-sulfamethoxazole (33.33%). Citrobacter spp. (n = 2) isolated from municipal wastewater were found to be resistant to amoxicillin-clavulanate (100%), ceftazidime (50%), cefepime (50%), cefotaxime (50%), imipenem (50%), meropenem (50%), ciprofloxacin (50%) and trimethoprim-sulfamethoxazole (50%). Proteus spp. (n = 1) isolated from municipal wastewater were resistant to amoxicillin-clavulanate (100%), ceftazidime (100%), cefotaxime (100%), cefepime (100%), meropenem (100%) and trimethoprim-sulfamethoxazole (100%). Analysis of 13 Enterobacteriaceae strains for antimicrobial resistance (AMR) showed that most of them were resistant to cefotaxime (84.61%), followed by amoxicillin-clavulanate (53.84%), imipenem and meropenem (46.15% each), trimethoprim-sulfamethoxazole (38.46%) and ciprofloxacin (30.76%).
The antibiotic susceptibility pattern of strains other than Enterobacteriaceae in our study was recorded as Acinetobacter spp. (n = 5) isolated from hospital and municipal wastewater were found to be resistant to cefotaxime (80%), cefepime (60%), imipenem (40%), meropenem (40%), ciprofloxacin (20%), gentamicin (20%) and trimethoprim-sulfamethoxazole (40%). Pseudomonas spp. (n = 5) isolated from hospital and municipal wastewater and from treated municipal wastewater were resistant to ceftazidime (40%), cefotaxime (20%), cefepime (40%), imipenem (40%), meropenem (60%), ciprofloxacin (60%) and gentamicin (80%). The AMR patterns of 10 strains of non-Enterobacteriaceae were also examined, and it was found that most showed resistance to cefotaxime, cefepime, Gentamicin, and Meropenem (50.00%), Imipenem and ciprofloxacin (40%).
An analysis of 23 bacterial strains found that most were resistant to cefotaxime (69.56%), followed by meropenem (47.82%), imipenem and amoxicillin-clavulanate (43.47%), gentamicin (39.13%), cefepime and ciprofloxacin (34.78%), and trimethoprim-sulfamethoxazole (30.43%). No bacteria were found to be resistant to colistin (Table S2, supplementary materials).

2.4. Screening for β-Lactamases

Of the 23 bacterial strains isolated from municipal and hospital wastewater and treated wastewater, 18 were resistant to cefotaxime/ceftazidime or both antibiotics. The 18 potential ESBL strains were further tested for confirmation of ESBL. 11 were confirmed to be producers of ESBL belonging to species Acinetobacter, Enterobacter, Pseudomonas, E. coli, Citrobacter, and Proteus. 13 isolates were found to be resistant to imipenem and/or meropenem; out of which 9 isolates were positive for Modified Hodge Test (MHT). The isolates were belonging to Klebsiella, Citrobacter, Enterobacter, Acinetobacter and Pseudomonas species (Figure S1 and S2, supplementary materials).

2.5. Detection of Resistance Genes by PCR

Of the 11 phenotypically confirmed ESBL isolates, 8 carried ESBL genes. The blaTEM gene was identified in a total of 2 strains, mainly harbored in the Pseudomonas and Enterobacter species. Furthermore, the blaSHV gene was identified in 2 strains mainly harbored by Citrobacter and Proteus species. The blaCTX-M gene was identified in 3 strains mainly harbored by Acinetobacter species. Of the total PCR-positive ESBL isolates, the coexistence of two different genes, that is, blaTEM and blaSHV, in a single isolate was revealed in a E. coli. The most common carbapenemase encoding gene found in this study was blaOXA-48 and blaNDM-1. It was present in 3 of the 9 phenotypically confirmed carbapenemase producing isolates. 2 of Klebsiella species were found to harbor blaOXA-48. These isolates came from the hospital and municipal wastewater. The second prevalent carbapenemase encoding gene found was blaNDM-1, which was present in 1 of Acinetobacter spp. which was isolated from municipal wastewater (Figures S3 and S4 Supplementary Materials).

3. Discussion

The overuse and abuse of antimicrobials in human and veterinary medicine, as well as environmental contamination, have contributed significantly to the emergence of AMR as a major threat to public health. The most common causes of AMR in healthcare facilities are the inappropriate use of antimicrobials and an inadequate infection control program. It has been recognized that aquatic environments can serve as a means of transmission of infection, and this is often related to the discharge of wastewater effluents from medical facilities, animal breeding farms, and sewer systems [20]. Despite this, there is a lack of conclusive information on the conditions or mechanisms that contribute to the development of drug-resistant strains in individuals [21]. Recent research has shown that bacteria and their genetic material can be easily transferred between humans, animals, and the environment [22,23,24].
In our study, the most predominant species identified in hospital wastewater were Klebsiella spp., Acinetobacter spp. Enterobacter spp. and Pseudomonas spp. The strains identified in municipal wastewater and treated wastewater samples were dominated by Pseudomonas spp., E. coli, Enterobacter spp., Citrobacter spp., Klebsiella spp., Acinetobacter spp. and Proteus species at the lowest abundance. Similarly, a study by Khaled et al. characterized bacterial species isolated from domestic wastewater treatment plants in Jazan, KSA, describing several enteric and non-enteric Gram-negative strains [25]. A study by Röderová et al. also found human and environmental bacteria in wastewater from hospitals and urban wastewater treatment plants [26].
We found that isolates from hospital wastewater, as well as municipal wastewater and treated wastewater, showed resistance to various antibiotics. The results of our analysis of the AMR of Enterobacteriaceae strains showed that most of them were resistant to cefotaxime (84.61%), amoxicillin-clavulanate (53.84%), imipenem and meropenem (46.15%) and trimethoprim-sulfamethoxazole (38.46%). Ciprofloxacin had a lower resistance level of 30.76%. The results of our study are consistent with previous research on resistance patterns of Enterobacteriaceae strains, such as a study conducted in Germany that found a high level of resistance to cefotaxime (89%), ceftazidime (95%) and ciprofloxacin (53%) [27]. The resistance pattern of the non-Enterobacteriaceae strains revealed that most of them showed resistance to cefotaxime, cefepime, Gentamicin and Meropenem (50.00%), Imipenem and ciprofloxacin (40%), and many studies have found carbapenem-resistant Acinetobacter spp. in hospital wastewater [28,29,30], but resistance to carbapenems has rarely been studied in isolates obtained from municipal wastewater [31].
A major concern for global public health is the rapid increase in the incidence of Enterobacteriaceae producing ESBL and its subsequent spread to the general population. The frequency of ESBL production was highest among Acinetobacter, followed by Enterobacter, Pseudomonas, E. coli, Citrobacter and Proteus. A study by Bréchet et al. found a high prevalence of Enterobacteriaceae producing ESBL in hospital wastewater [32]. Furthermore, global studies have found significant variations in the prevalence and percentage of strains that produce ESBL between different nations [33]. It appears that the production of ESBL by Enterobacteriaceae and non-Enterobacteriaceae strains may restrict the treatment options for infections caused by this group of bacteria. Therefore, the bacteria that produce ESBL pose a significant problem that requires proactive efforts to prevent their occurrence.
In our study, carbapenemase producers were phenotypically identified among Klebsiella, Citrobacter, Enterobacter, Acinetobacter, and Pseudomonas species. Two separate phenotypic studies conducted in Mecca found that 48.4% and 38% of the samples were positive for carbapenemase production in Klebsiella pneumoniae [34,35]. Wastewater serves as a reservoir of antibiotic resistant bacteria that reflects the composition of bacterial populations carried out by the general population, and wastewater is a hotspot for the exchange of resistant genes among bacteria [36]. Isolates that were found to produce ESBL or carbapenemase by any phenotypic method were further characterized by molecular analysis. The blaTEM-type gene was detected in 2 strains of Pseudomonas spp. and Enterobacter spp. isolated from municipal wastewater and treated wastewater, respectively. The blaSHV-type gene was also found in 2 strains, mainly in Citrobacter and Proteus spp. isolates from municipal wastewater. The blaCTX-M type gene was identified in 3 strains, mainly in Acinetobacter spp. isolates from the hospital and municipal wastewater. The prevalence of the blaTEM gene in this study is similar to the findings of a study conducted in Portugal, where the most commonly identified genes were blaTEM (24.1%) and blaCTX-M (5.6%) [37]. In a separate study, the blaTEM gene was found to be the most prevalent in wastewater samples collected during biological treatment, including treated wastewater. However, in another study, the blaSHV gene was the least prevalent among the genes tested [38]. A recent study revealed that a small percentage of ESBL genes were found in isolates obtained from wastewater effluent. Among these samples, 9.2% carried the blaTEM gene, 1.4% carried the blaSHV-12 gene, 0.2% carried the blaCTX-M-1 gene, and 1% carried the blaCTX-M-15 gene [39]. In WWTP, the genes blaCTX-M, blaTEM, blaSHV, and blaOXA have been identified in multiple species within the Enterobacteriaceae species group. Our study identified a combination of blaTEM and blaSHV genes in 1 E. coli spp. isolated from municipal wastewater. In other studies, blaSHV and/or blaTEM were also frequently found [40,41,42]. Furthermore, we found that the genes blaOXA-48 and blaNDM-1 were prevalent among carbapenemase genes. Specifically, the blaOXA-48 gene was the most identified in Klebsiella spp. isolated from hospital and municipal wastewater. The presence of blaOXA-48 has also been detected in Saudi Arabian clinical samples from Saudi Arabia [43]. Studies also reported the prevalence of blaOXA-48 in wastewater [44,45]. Meanwhile, the blaNDM-1 gene was detected in Acinetobacter spp. recovered from municipal wastewater. Our results are consistent with those of previous studies showing that the blaNDM-1 gene has been found in a wide variety of species and is spreading rapidly in various environments [28,46,47]. In this study, none of the isolates tested positive for carbapenemase encoding genes of type blaIMP, blaVIM or blaKPC.
Our research had some limitations, including the fact that we only tested β lactamase genes in bacteria that were phenotypically confirmed, the list of resistance testing primers did not cover everything, and we did not test the mechanism of resistance to carbapenems other than the production of carbapenemase. Resistance genes could be present in bacteria that do not show resistance phenotypically. The only way to overcome this is to perform whole genome sequencing for all isolates. Furthermore, our sample size was relatively small, so future studies with more samples from various sources will provide a more comprehensive understanding of pathogens and β-lactam genes. Another limitation was that our study only looked at a hospital and a municipal wastewater treatment plant in a specific location, so the results may not apply to other locations.

4. Materials and Methods

4.1. Sample Collection

Six samples, consisting of three wastewater samples and three treated wastewater samples, were collected from a hospital and municipal wastewater treatment plant in the central region of Saudi Arabia between October 2021 and December 2021. The samples were collected between 8 am and 11 am and placed in 1-L plastic containers that had been sterilized with 70% alcohol and rinsed with deionized water. After collection, the samples were transported in an insulated box with ice packs to the laboratory for processing. All samples were stored at a temperature of 4 °C and analyzed within 24 h after collection.

4.2. Bacterial Isolates

10 mL of wastewater and 100 mL of treated wastewater were centrifuged at 5000× g for 10 min. The samples were then serially diluted with normal sterile saline (10−1, 10−2, 10−3) and 100 μL of each aliquot was spread on MacConkey agar with 2 μg/mL of meropenem added. The plates were incubated overnight at a temperature of 35 ± 2 °C. To further purify the bacteria, colonies with distinctive color and characteristics were randomly selected and subcultured on MacConkey agar containing 2 μg of meropenem. The isolates were then stored in TSA + 10% glycerol stock at a temperature of −80 °C for further analysis. The identifications of the isolates were confirmed by Gram staining and then further determined by biochemical analysis, as detailed by Mahan et al. [48].

4.3. Antimicrobial Sensitivity

The antibiotic sensitivity test (AST) was performed using the disk diffusion method as per the recommendations of the Clinical Laboratory Standard Institute (CLSI) [49]. The disk diffusion test was carried out using the Kirby-Bauer technique with cefotaxime (CTX, 30 μg), cefepime (FEP, 5 μg), imipenem (IMP, 10 µg), meropenem (MEM, 10 μg), ciprofloxacin (CIP, 5 μg), gentamicin (GEN, 10 μg), trimethoprim/sulfamethoxazole (SXT, 23.75 μg + 1.25 μg), ceftazidime (CAZ, 30 μg), amoxicillin-clavulanate (AMC, 30 µg), and colistin (CST) (30 µg). All antibiotics were obtained from Oxide Pvt. Ltd. The quality control process included the use of strains from the American Type Culture Collection (ATCC) Escherichia coli (E. coli) 25,922 and P. aeruginosa 27,953.

4.4. Phenotypic Detection of β-Lactamases

A double disc diffusion test [49] was carried out to verify the presence of ESBL, discs containing ceftazidime (30 μg), cefotaxime (30 μg), and a combination of clavulanic acid (30 μg)/10 μg) were used. The disks were placed at the appropriate distance on MHA plates that had been inoculated with a bacterial suspension of 0.5 McFarland turbidity standards. The plates were left to incubate for 18–20 h at 37 °C. The isolates were determined to be producers of ESBL if the difference in the zone of inhibition of the drug and inhibitor was at least 5 mm compared to cephalosporin alone.
Modified Hodge Test [49] was performed to determine carbapenemase production according to CLSI standards. A suspension of E. coli ATCC 25,922 was adjusted to the 0.5 McFarland standard and swabbed on MHA plates. After drying, a disc containing 10 μg of meropenem was left in the middle of the plate and then the isolates were spread in a thin line from the edge of the disc that extended to the edge of the plate. The plates were incubated overnight at 37 °C. A distorted inhibitory zone in the shape of a clover leaf on the meropenem disc around the growth of E. coli ATCC 25,922 indicated a positive result.

4.5. Analysis of Gene Molecules of ESBL and Carbapenemase

4.5.1. DNA Extraction

Fresh colonies of all phenotypically verified ESBL and carbapenemase isolates were processed for DNA extraction using the boiling method [50]. Briefly, a suspension was made by suspending 2–4 fresh colonies of each isolate in 500 µL of nuclease-free distilled water. The suspension was heated to 95 °C for 10 min, followed by cooling and then centrifugation at 10,000 rpm for 10 min. Finally, 150 µL of the supernatant was stored at −20 °C and used as a template for subsequent amplification.

4.5.2. Detection of Genes Encoding ESBL and Carbapenemase

The multiplex polymerase chain reaction (PCR) was performed in two separate reactions using the BIO-RAD T100 thermal cycler (Applied Biosystems, Waltham, MA, USA). In the first reaction, the genes blaCTX-M, blaTEM, and blaSHV were multiplexed in a single tube to detect ESBL. In the second reaction, the genes blaIMP, blaVIM, blaKPC, blaNDM, and blaOXA-48 were multiplexed to detect carbapenemase. The PCR procedures were performed in a total volume of 20 µL, including 4 µL of 5× FIREPol® Master Mix (Solis Biodyne, Tartu, Estonia), 0.2 µL of each primer, 1 µL of DNA template and 14.6 µL of nuclease-free water. The amplification cycle consisted of initial denaturation at 95 °C for 3 min, followed by 30 cycles of denaturation at 95 °C for 15 s, annealing at the temperature specified in Table 2 for 30 s, extension at 72 °C for 1 min, and final extension at 72 °C for 5 min. The PCR results were analyzed by gel electrophoresis on 1.5% agarose gel. The size of the amplicon was calculated compared to the 100 bp ladder marker (Solis Biodyne, Tartu, Estonia).

5. Conclusions and Future Perspectives

Our data indicate that that hospital and municipal wastewater contained a range of resistant bacteria dominated by Klebsiella, Acinetobacter, Enterobacter, and Pseudomonas species. These isolates showed resistance to various antibiotics, particularly cefotaxime, amoxicillin-clavulanate, imipenem, meropenem, and trimethoprim-sulfamethoxazole. Furthermore, Enterobacteriaceae and non-Enterobacteriaceae strains producing ESBL and carbapenemase were also identified. To address this issue, it is important to identify the genes responsible for producing ESBL and carbapenemase in nonclinical samples, such as wastewater. So, we can gain valuable information to help develop effective strategies for managing pathogens, which can help reduce the occurrence of multidrug resistance. Additionally, there is a practice of reusing wastewater for agricultural purposes, and the potential use of wastewater sludge for other applications. Given the high levels of resistant bacteria found in wastewater, we must take additional measures to remove these bacteria before releasing the water back into the environment or reusing it for other purposes. Therefore, it is essential to regularly evaluate wastewater systems in hospitals and municipalities. Furthermore, more research is needed to understand the risks associated with wastewater disposal and recycling. We must assess the extent of ecosystem pollution that occurs because of these practices. By doing so, we can develop more effective methods to manage wastewater and ensure that it does not contribute to the spread of antibiotic resistance in the environment.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics12040653/s1, Table S1. Biochemical analyses of isolates; Table S2. Antibiotic resistance profile; Figure S1. Double disc diffusion test for ESBLs; Figure S2. Modified Hodge test; Figure S3. Detection of ESBL genes (multiplex PCR); Figure S4. Detection of Carbapenemase genes (multiplex PCR).

Author Contributions

Conceptualization, M.I.; methodology, M.I, A.A. and Z.A.A.; analysis, M.I, A.A. and Z.A.A.; writing and editing all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the “Deputyship for Research and Innovation, Ministry of Education in Saudi Arabia” (project IFP2021-085).

Institutional Review Board Statement

The research plan was examined and authorized by the Ethical Research Committee of Shaqra University, and its approval number is ERC_SU 20210031.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data are contained within the article.

Acknowledgments

The authors extend their appreciation to the “Deputyship for Research and Innovation, Ministry of Education in Saudi Arabia” for funding this research work through the project number IFP2021-085. In addition, the authors extend their appreciation to Deanship of scientific research at Shaqra University for supporting this work.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Jelic, A.; Rodriguez-Mozaz, S.; Barceló, D.; Gutierrez, O. Impact of In-Sewer Transformation on 43 Pharmaceuticals in a Pressurized Sewer under Anaerobic Conditions. Water Res. 2015, 68, 98–108. [Google Scholar] [CrossRef]
  2. Karkman, A.; Pärnänen, K.; Larsson, D.G.J. Fecal Pollution Can Explain Antibiotic Resistance Gene Abundances in Anthropogenically Impacted Environments. Nat. Commun. 2019, 10, 80. [Google Scholar] [CrossRef] [Green Version]
  3. Aldrazi, F.A.; Rabaan, A.A.; Alsuliman, S.A.; Aldrazi, H.A.; Alabdalslam, M.J.; Alsadiq, S.A.; Alhani, H.M.; Bueid, A.S. ESBL Expression and Antibiotic Resistance Patterns in a Hospital in Saudi Arabia: Do Healthcare Staff Have the Whole Picture? J. Infect. Public Health 2020, 13, 759–766. [Google Scholar] [CrossRef]
  4. Liu, H.; Zhou, H.; Li, Q.; Peng, Q.; Zhao, Q.; Wang, J.; Liu, X. Molecular Characteristics of Extended-Spectrum β-Lactamase-Producing Escherichia Coli Isolated from the Rivers and Lakes in Northwest China. BMC Microbiol. 2018, 18, 125. [Google Scholar] [CrossRef] [Green Version]
  5. Čornejová, T.; Venglovsky, J.; Gregova, G.; Kmetova, M.; Kmet, V. Extended Spectrum Beta-Lactamases in Escherichia Coli from Municipal Wastewater. Ann. Agric. Environ. Med. 2015, 22, 447–450. [Google Scholar] [CrossRef] [Green Version]
  6. Lépesová, K.; Olejníková, P.; Mackuľak, T.; Cverenkárová, K.; Krahulcová, M.; Bírošová, L. Hospital Wastewater—Important Source of Multidrug Resistant Coliform Bacteria with ESBL-Production. Int. J. Environ. Res. Public Health 2020, 17, 7827. [Google Scholar] [CrossRef]
  7. Mustafa, S.S.; Batool, R.; Kamran, M.; Javed, H.; Jamil, N. Evaluating the Role of Wastewaters as Reservoirs of Antibiotic-Resistant ESKAPEE Bacteria Using Phenotypic and Molecular Methods. Infect. Drug Resist. 2022, 15, 5715–5728. [Google Scholar] [CrossRef]
  8. Rizzo, L.; Manaia, C.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D. Urban Wastewater Treatment Plants as Hotspots for Antibiotic Resistant Bacteria and Genes Spread into the Environment: A Review. Sci. Total Envron. 2013, 447, 345–360. [Google Scholar] [CrossRef] [Green Version]
  9. Chau, K.K.; Barker, L.; Budgell, E.P.; Vihta, K.D.; Sims, N.; Kasprzyk-Hordern, B.; Harriss, E.; Crook, D.W.; Read, D.S.; Walker, A.S.; et al. Systematic Review of Wastewater Surveillance of Antimicrobial Resistance in Human Populations. Environ. Int. 2022, 162, 107171. [Google Scholar] [CrossRef]
  10. Sirot, D. Extended-Spectrum Plasmid-Mediated Beta-Lactamases. J. Antimicrob. Chemother. 1995, 36 (Suppl. SA), 19–34. [Google Scholar] [CrossRef]
  11. Bush, K.; Bradford, P.A. β-Lactams and β-Lactamase Inhibitors: An Overview. Cold Spring Harb. Perspect. Med. 2016, 6, a025247. [Google Scholar] [CrossRef]
  12. Bush, K. The ABCD’s of β-Lactamase Nomenclature. J. Infect. Chemother. 2013, 19, 549–559. [Google Scholar] [CrossRef]
  13. Hussein, K.; Raz-Pasteur, A.; Finkelstein, R.; Neuberger, A.; Shachor-Meyouhas, Y.; Oren, I.; Kassis, I. Impact of Carbapenem Resistance on the Outcome of Patients’ Hospital-Acquired Bacteraemia Caused by Klebsiella Pneumoniae. J. Hosp. Infect. 2013, 83, 307–313. [Google Scholar] [CrossRef]
  14. Alhumaidy, A.; Alahmadi, R.; Eisa, S.; Alotaibi, M.; Filfilan, S.; Alzayer, M.; Okdah, L.; Doumith, M.; Taha, O.; Albishri, B.; et al. Molecular Characterization of Carbapenemase Producing Acinetobacter Baumannii and Pseudomonas Aeruginosa from Tertiary Care Hospitals in Mecca—Saudi Arabia. J. Infect. Public Health 2020, 13, 335. [Google Scholar] [CrossRef]
  15. Alahmadi, R.; Alhumaidy, A.; Eisa, S.; Alotaibi, M.; Filfilan, S.; Taha, O.; Albishri, B.; Mulana, A.; Alshelgani, A.; Alzeyadi, Z. Molecular Detection of Common Carbapenemase Resistance Genes in Nosocomial Pathogens Isolated from Neonatal ICU at a Major Tertiary Care Hospital in Mecca. J. Infect. Public Health 2020, 13, 332. [Google Scholar] [CrossRef]
  16. Yezli, S.; Shibl, A.M.; Memish, Z.A. The Molecular Basis of β-Lactamase Production in Gram-Negative Bacteria from Saudi Arabia. J Med Microbiol 2015, 64, 127–136. [Google Scholar] [CrossRef] [Green Version]
  17. Al-Agamy, M.H.; Shibl, A.M.; Elkhizzi, N.A.; Meunier, D.; Turton, J.F.; Livermore, D.M. Persistence of Klebsiella Pnemoniae Clones with OXA-48 or NDM Carbapenemases Causing Bacteraemias in a Riyadh Hospital. Diagn Microbiol. Infect Dis. 2013, 76, 214–216. [Google Scholar] [CrossRef]
  18. Garbati, M.A.; Sakkijha, H.; Abushaheen, A. Infections Due to Carbapenem Resistant Enterobacteriaceae among Saudi Arbian Hospitalized Patients: A Matched Case-Control Study. BioMed. Res. Int. 2016, 2016, e3961684. [Google Scholar] [CrossRef] [Green Version]
  19. Al-Zahrani, I.A.; Alasiri, B.A. The Emergence of Carbapenem-Resistant Klebsiella Pneumoniae Isolates Producing OXA-48 and NDM in the Southern (Asir) Province, Saudi Arabia. Saudi Med. J. 2018, 39, 23–30. [Google Scholar] [CrossRef]
  20. Irfan, M.; Almotiri, A.; AlZeyadi, Z.A. Antimicrobial Resistance and Its Drivers—A Review. Antibiotics 2022, 11, 1362. [Google Scholar] [CrossRef]
  21. Galler, H.; Feierl, G.; Petternel, C.; Reinthaler, F.F.; Haas, D.; Habib, J.; Kittinger, C.; Luxner, J.; Zarfel, G. Multiresistant Bact ria Isolated from Activated Sludge in Austria. Int. J. Environ. Res. Public Health 2018, 15, 479. [Google Scholar] [CrossRef] [Green Version]
  22. Manaia, C.M. Assessing the Risk of Antibiotic Resistance Transmission from the Environment to Humans: Non-Direct Proportionality between Abundance and Risk. Trends Microbiol. 2017, 25, 173–181. [Google Scholar] [CrossRef] [Green Version]
  23. Oliveira, P.H.; Touchon, M.; Cury, J.; Rocha, E.P.C. The Chromosomal Organization of Horizontal Gene Transfer in Bacteria. Nat. Commun. 2017, 8, 841. [Google Scholar] [CrossRef] [Green Version]
  24. Martínez, J.L. Ecology and Evolution of Chromosomal Gene Transfer between Environmental Microorganisms and Pathogens. Microbiol. Spectr. 2018, 6, 6.1.06. [Google Scholar] [CrossRef]
  25. Elgayar, K.E.; Essa, A.M. Characterization of Bacteria Isolated from Domestic Wastewater In Jazan, Saudi Arabia. Egypt. J. Exp. Biol. 2018, 14, 331. [Google Scholar] [CrossRef]
  26. Röderová, M.; Sedláková, M.H.; Pudová, V.; Hricová, K.; Silová, R.; Imwensi, P.E.O.; Bardoň, J.; Kolář, M. Occurrence of Bacteria Producing Broad-Spectrum Beta-Lactamases and Qnr Genes in Hospital and Urban Wastewater Samples. New Microbiol. 2016, 39, 124–133. [Google Scholar]
  27. Homeier-Bachmann, T.; Heiden, S.E.; Lübcke, P.K.; Bachmann, L.; Bohnert, J.A.; Zimmermann, D.; Schaufler, K. Antibiotic-Resistant Enterobacteriaceae in Wastewater of Abattoirs. Antibiotics 2021, 10, 568. [Google Scholar] [CrossRef]
  28. Marathe, N.P.; Berglund, F.; Razavi, M.; Pal, C.; Dröge, J.; Samant, S.; Kristiansson, E.; Larsson, D.G.J. Sewage Effluent from an Indian Hospital Harbors Novel Carbapenemases and Integron-Borne Antibiotic Resistance Genes. Microbiome 2019, 7, 97. [Google Scholar] [CrossRef] [Green Version]
  29. Qin, J.; Maixnerová, M.; Nemec, M.; Feng, Y.; Zhang, X.; Nemec, A.; Zong, Z. Acinetobacter Cumulans Sp. Nov., Isolated from Hospital Sewage and Capable of Acquisition of Multiple Antibiotic Resistance Genes. Syst. Appl. Microbiol. 2019, 42, 319–325. [Google Scholar] [CrossRef]
  30. Wang, Q.; Wang, P.; Yang, Q. Occurrence and Diversity of Antibiotic Resistance in Untreated Hospital Wastewater. Sci. Total Environ. 2018, 621, 990–999. [Google Scholar] [CrossRef]
  31. Higgins, P.G.; Hrenovic, J.; Seifert, H.; Dekic, S. Characterization of Acinetobacter Baumannii from Water and Sludge Line of Secondary Wastewater Treatment Plant. Water Res. 2018, 140, 261–267. [Google Scholar] [CrossRef]
  32. Bréchet, C.; Plantin, J.; Sauget, M.; Thouverez, M.; Talon, D.; Cholley, P.; Guyeux, C.; Hocquet, D.; Bertrand, X. Wastewater Treatment Plants Release Large Amounts of Extended-Spectrum β-Lactamase–Producing Escherichia Coli Into the Environment. Clin. Infect. Dis. 2014, 58, 1658–1665. [Google Scholar] [CrossRef] [Green Version]
  33. Pfaller, M.A.; Jones, R.N.; Doern, G.V. Multicenter Evaluation of the Antimicrobial Activity for Six Broad-Spectrum Beta-Lactams in Venezuela: Comparison of Data from 1997 and 1998 Using the Etest Method. Venezuelan Antimicrobial Resistance Study Group. Diagn Microbiol. Infect Dis. 1999, 35, 153–158. [Google Scholar] [CrossRef]
  34. Faidah, H.S.; Momenah, A.M.; El-Said, H.M.; Barhameen, A.A.A.; Ashgar, S.S.; Johargy, A.; Elsawy, A.; Almalki, W.; Qurashi, S.A. Trends in the Annual Incidence of Carbapenem Resistant among Gram Negative Bacilli in a Large Teaching Hospital in Makah City, Saudi Arabia. J. Tuberc. Res. 2017, 5, 229–236. [Google Scholar] [CrossRef] [Green Version]
  35. Khan, M.; Faiz, A. Frequency of Carbapenemase Producing Klebsiella Pneumoniae in Makkah, Saudi Arabia. J. Microbiol. Infect. Dis. 2016, 6, 121–127. [Google Scholar] [CrossRef] [Green Version]
  36. Korzeniewska, E.; Harnisz, M. Beta-Lactamase-Producing Enterobacteriaceae in Hospital Effluents. J. Env. Manag. 2013, 123, 1–7. [Google Scholar] [CrossRef]
  37. Amador, P.P.; Fernandes, R.M.; Prudêncio, M.C.; Barreto, M.P.; Duarte, I.M. Antibiotic Resistance in Wastewater: Occurrence and Fate of Enterobacteriaceae Producers of Class A and Class C β-Lactamases. J. Env. Sci. Health A Tox Hazard Subst Env. Eng. 2015, 50, 26–39. [Google Scholar] [CrossRef]
  38. Zieliński, W.; Buta, M.; Hubeny, J.; Korzeniewska, E.; Harnisz, M.; Nowrotek, M.; Płaza, G. Prevalence of Beta Lactamases Genes in Sewage and Sludge Treated in Mechanical-Biological Wastewater Treatment Plants. J. Ecol. Eng. 2019, 20, 80–86. [Google Scholar] [CrossRef]
  39. Smyth, C.; O’Flaherty, A.; Walsh, F.; Do, T.T. Antibiotic Resistant and Extended-Spectrum β-Lactamase Producing Faecal Coliforms in Wastewater Treatment Plant Effluent. Env. Pollut 2020, 262, 114244. [Google Scholar] [CrossRef]
  40. Zieliński, W.; Korzeniewska, E.; Harnisz, M.; Drzymała, J.; Felis, E.; Bajkacz, S. Wastewater Treatment Plants as a Reservoir of Integrase and Antibiotic Resistance Genes—An Epidemiological Threat to Workers and Environment. Env. Int. 2021, 156, 106641. [Google Scholar] [CrossRef]
  41. Osińska, A.; Korzeniewska, E.; Harnisz, M.; Felis, E.; Bajkacz, S.; Jachimowicz, P.; Niestępski, S.; Konopka, I. Small-Scale Wastewater Treatment Plants as a Source of the Dissemination of Antibiotic Resistance Genes in the Aquatic Environment. J. Hazard. Mater. 2020, 381, 121221. [Google Scholar] [CrossRef]
  42. Surleac, M.; Czobor Barbu, I.; Paraschiv, S.; Popa, L.I.; Gheorghe, I.; Marutescu, L.; Popa, M.; Sarbu, I.; Talapan, D.; Nita, M.; et al. Whole Genome Sequencing Snapshot of Multi-Drug Resistant Klebsiella Pneumoniae Strains from Hospitals and Receiving Wastewater Treatment Plants in Southern Romania. PLoS ONE 2020, 15, e0228079. [Google Scholar] [CrossRef] [Green Version]
  43. Khan, M.A.; Mohamed, A.M.; Faiz, A.; Ahmad, J. Enterobacterial Infection in Saudi Arabia: First Record of Klebsiella Pneumoniae with Triple Carbapenemase Genes Resistance. J. Infect Dev. Ctries. 2019, 13, 334–341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Teban-Man, A.; Farkas, A.; Baricz, A.; Hegedus, A.; Szekeres, E.; Pârvu, M.; Coman, C. Wastewaters, with or without Hospital Contribution, Harbour MDR, Carbapenemase-Producing, but Not Hypervirulent Klebsiella pneumoniae. Antibiotics 2021, 10, 361. [Google Scholar] [CrossRef]
  45. Gibbon, M.J.; Couto, N.; David, S.; Barden, R.; Standerwick, R.; Jagadeesan, K.; Birkwood, H.; Dulyayangkul, P.; Avison, M.B.; Kannan, A.; et al. A High Prevalence of BlaOXA-48 in Klebsiella (Raoultella) Ornithinolytica and Related Species in Hospital Wastewater in South West England. Microb. Genom. 2021, 7, mgen000509. [Google Scholar] [CrossRef] [PubMed]
  46. Parvez, S.; Khan, A.U. Hospital Sewage Water: A Reservoir for Variants of New Delhi Metallo-β-Lactamase (NDM)- and Extended-Spectrum β-Lactamase (ESBL)-Producing Enterobacteriaceae. Int. J. Antimicrob. Agents 2018, 51, 82–88. [Google Scholar] [CrossRef] [PubMed]
  47. Haller, L.; Chen, H.; Ng, C.; Le, T.H.; Koh, T.H.; Barkham, T.; Sobsey, M.; Gin, K.Y.-H. Occurrence and Characteristics of Extended-Spectrum β-Lactamase- and Carbapenemase- Producing Bacteria from Hospital Effluents in Singapore. Sci. Total Env. 2018, 615, 1119–1125. [Google Scholar] [CrossRef]
  48. Mahon, C.; Lehman, D. Textbook of Diagnostic Microbiology—7th Edition, 7th ed; Elsevier: Amsterdam, The Netherlands, 2022; ISBN 978-0-323-82997-7. [Google Scholar]
  49. M100Ed30; Performance Standards for Antimicrobial Susceptibility Testing, 30rd Edition. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020; ISBN 978-1-68440-067-6.
  50. Mashwal, F.A.; Safi, S.H.E.; George, S.K.; Adam, A.A.; Jebakumar, A.Z. Incidence and Molecular Characterization of the Extended Spectrum Beta Lactamase-Producing Escherichia Coli Isolated from Urinary Tract Infections in Eastern Saudi Arabia. Saudi Med. J. 2017, 38, 811–815. [Google Scholar] [CrossRef]
  51. Gharrah, M.M.; Mostafa El-Mahdy, A.; Barwa, R.F. Association between Virulence Factors and Extended Spectrum Beta-Lactamase Producing Klebsiella Pneumoniae Compared to Nonproducing Isolates. Interdiscip Perspect Infect Dis. 2017, 2017, 7279830. [Google Scholar] [CrossRef] [Green Version]
  52. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a Set of Multiplex PCR Assays for the Detection of Genes Encoding Important β-Lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Green Version]
  53. Nordmann, P.; Poirel, L.; Carrër, A.; Toleman, M.A.; Walsh, T.R. How To Detect NDM-1 Producers. J. Clin. Microbiol. 2011, 49, 718–721. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Table
Table 1. List of bacteria isolated.
Table 1. List of bacteria isolated.
Bacteria Isolated/Number of Isolates
Hospital
(Wastewater)		Hospital
(Treated Wastewater)		Municipal
(Wastewater)		Municipal
(Treated Wastewater)
EnterobacteriaceaeKlebsiella spp. (2)No growthE. coli (3)Enterobacter spp. (1)
Enterobacter spp. (1)Klebsiella spp. (2)
Enterobacter spp. (1)
Citrobacter spp. (2)
Proteus spp. (1)
Non-EnterobacteriaceaeAcinetobacter spp. (3)No growthAcinetobacter spp. (2)Pseudomonas spp. (1)
Pseudomonas spp. (1)Pseudomonas spp. (3)
Table
Table 2. List of primers used.
Table 2. List of primers used.
Targeted GenesNucleotide Sequence (5′to 3′)Amplicon Size (bp)Annealing TempReferences
blaCTX-MForward—GTGATACCACTTCACCTC25556[51]
Reverse -AGTAAGTGACCAGAATCAG
blaSHVForward—ACTATCGCCAGCAGGATC35653[51]
Reverse—ATCGTCCACCATCCACTG
blaTEMForward—GATCTCAACAGCGGTAAG78658[51]
Reverse—CAGTGAGGCACCTATCTC
blaKPCForward—CATTCAAGGGCTTTCTTGCTGC53855[52]
Reverse—ACGACGGCATAGTCATTTGC
blaIMPForward—TTGACACTCCATTTACDG13955[52]
Reverse—GATYGAGAATTAAGCCACYCT
blaVIMForward—GATGGTGTTTGGTCGCATA39055[52]
Reverse—CGAATGCGCAGCACCAG
blaOXA-48Forward—GCTTGATCGCCCTCGATT28157[52]
Reverse—GATTTGCTCCGTGGCCGAAA
blaNDM-1Forward—GGTTTGGCGATCTGGTTTTC62152[53]
Reverse—CGGAATGGCTCATCACGATC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Irfan, M.; Almotiri, A.; AlZeyadi, Z.A. Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater. Antibiotics 2023, 12, 653. https://doi.org/10.3390/antibiotics12040653

AMA Style

Irfan M, Almotiri A, AlZeyadi ZA. Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater. Antibiotics. 2023; 12(4):653. https://doi.org/10.3390/antibiotics12040653

Chicago/Turabian Style

Irfan, Mohammad, Alhomidi Almotiri, and Zeyad Abdullah AlZeyadi. 2023. "Antimicrobial Resistance and β-Lactamase Production in Clinically Significant Gram-Negative Bacteria Isolated from Hospital and Municipal Wastewater" Antibiotics 12, no. 4: 653. https://doi.org/10.3390/antibiotics12040653

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop