CoQ Regulates Brown Adipose Tissue Respiration and Uncoupling Protein 1 Expression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mouse Model
2.2. Lentiviruses
2.3. Cell Cultures
2.4. CoQ10 Supplementation
2.5. Coenzyme Q Extraction and Measurement
2.6. Mitochondria Isolation
2.7. Mitochondrial ROS and Mitochondrial Mass Detection
2.8. ADP/ATP and NAD/NADH Measurements
2.9. RNA Preparation and Quantitative RT-PCR
2.10. In Vivo Respirometry
2.11. H&E Staining and Imaging
2.12. In Vitro Respirometry
2.13. Immunoblot
2.14. Lipid Peroxidation
2.15. UCP1 Current Measurement
2.16. Statistical Analysis
3. Results
3.1. CoQ Regulates UCP1 Expression in BAT
3.2. CoQ Deficiency Driven UCP1 Suppression Is Specific to Brown and Beige Fat
3.3. BAT CoQ Deficiency Alters Cellular Bioenergetics and Redox Functions
3.4. CoQ Deficiency Leads to BAT Dysfunction In Vivo
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Appendix B
Appendix C
Gene | Exons | Forward | Reverse |
---|---|---|---|
UCP1 | 2-3 | CACACCTCCAGTCATTAAGCC | CAAATCAGCTTTGCCTCACTC |
PGC1a | 2-3 | CTCCATCTGTCAGTGCATCA | CCAACCAGTACAACAATGAGC |
PRDM16 | 12-13 | CACTTGAACGGCTTCTCTTTG | CACAAGACATCTGAGGACACA |
EBF2 | 14-15 | GGAGGTGCTGTAATTAGATTGCT | GTCAGCATTTCAGAGTCCACA |
PPARG | 4-5 | TGCAGGTTCTACTTTGATCGC | CTGCTCCACACTATGAAGACAT |
PPIA | 4-5 | TTCACCTTCCCAAAGACCAC | CAAACACAAACGGTTCCCAG |
PDSS2 | 6-8 | CACCTTTGCCAGCTTTGATTG | GTCTTACATCAGGAGTTTCTTGGA |
Cre | N/A | CATCGCTCGACCAGTTTAGTT | CTGACGGTGGGAGAATGTTAAT |
Appendix D
Antibody | Source | Identifier |
---|---|---|
beta Tubulin | Abcam | Cat# ab131205, RRID:AB_11156121 |
beta Actin | Sigma-Aldrich | Cat# A1978, RRID:AB_476692 |
UCP1a | Abcam | Cat# ab209483 RRID:AB_2722676 |
UCP1 (E9Z2V) XP Rabbit mAb | Cell Signaling Technology | Cat# 72298 |
Total OXPHOS Rodent WB Antibody Cocktail | Abcam | Cat# ab110413 |
IRDye 680LT Goat anti-Mouse IgG antibody | LI-COR Biosciences | Cat# 925-68020, RRID:AB_2687826 |
IRDye 800CW Goat anti-Rabbit IgG antibody | LI-COR Biosciences | Cat# 925-32211, RRID:AB_2651127 |
References
- Anderson, C.M.; Kazantzis, M.; Wang, J.; Venkatraman, S.; Goncalves, R.L.; Quinlan, C.L.; Ng, R.; Jastroch, M.; Benjamin, D.I.; Nie, B.; et al. Dependence of brown adipose tissue function on CD36-mediated coenzyme Q uptake. Cell Rep. 2015, 10, 505–515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bersuker, K.; Hendricks, J.M.; Li, Z.; Magtanong, L.; Ford, B.; Tang, P.H.; Roberts, M.A.; Tong, B.; Maimone, T.J.; Zoncu, R.; et al. The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis. Nature 2019, 575, 688–692. [Google Scholar] [CrossRef] [PubMed]
- Emmanuele, V.; López, L.C.; Berardo, A.; Naini, A.; Tadesse, S.; Wen, B.; D’Agostino, E.; Solomon, M.; DiMauro, S.; Quinzii, C.; et al. Heterogeneity of coenzyme Q10 deficiency: Patient study and literature review. Arch. Neurol. 2012, 69, 978–983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quinzii, C.M.; Emmanuele, V.; Hirano, M. Clinical presentations of coenzyme q10 deficiency syndrome. Mol. Syndromol. 2014, 5, 141–146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ates, O.; Bilen, H.; Keles, S.; Alp, H.H.; Keleş, M.S.; Yıldırım, K.; Ondaş, O.; Pınar, L.C.; Civelekler, M.; Baykal, O. Plasma coenzyme Q10 levels in type 2 diabetic patients with retinopathy. Int. J. Ophthalmol. 2013, 6, 675–679. [Google Scholar] [CrossRef]
- Hasegawa, G.; Yamamoto, Y.; Zhi, J.G.; Tanino, Y.; Yamasaki, M.; Yano, M.; Nakajima, T.; Fukui, M.; Yoshikawa, T.; Nakamura, N. Daily profile of plasma %CoQ10 level, a biomarker of oxidative stress, in patients with diabetes manifesting postprandial hyperglycaemia. Acta Diabetol. 2005, 42, 179–181. [Google Scholar] [CrossRef]
- Garrido-Maraver, J.; Cordero, M.D.; Oropesa-Avila, M.; Vega, A.F.; de la Mata, M.; Pavon, A.D.; Alcocer-Gomez, E.; Calero, C.P.; Paz, M.V.; Alanis, M.; et al. Clinical applications of coenzyme Q10. Front. Biosci. 2014, 19, 619–633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Littarru, G.P.; Tiano, L. Clinical aspects of coenzyme Q10: An update. Nutrition 2010, 26, 250–254. [Google Scholar] [CrossRef]
- Golomb, B.A.; Evans, M.A. Statin adverse effects: A review of the literature and evidence for a mitochondrial mechanism. Am. J. Cardiovasc. Drugs 2008, 8, 373–418. [Google Scholar] [CrossRef]
- Stefely, J.A.; Pagliarini, D.J. Biochemistry of Mitochondrial Coenzyme Q Biosynthesis. Trends Biochem. Sci. 2017, 42, 824–843. [Google Scholar] [CrossRef]
- Rosen, E.D.; Spiegelman, B.M. What we talk about when we talk about fat. Cell 2014, 156, 20–44. [Google Scholar] [CrossRef] [Green Version]
- Enerback, S. Human brown adipose tissue. Cell Metab. 2010, 11, 248–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cypess, A.M.; Kahn, C.R. Brown fat as a therapy for obesity and diabetes. Curr. Opin. Endocrinol. Diabetes Obes. 2010, 17, 143–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yubero, D.; Montero, R.; Artuch, R.; Land, J.M.; Heales, S.J.; Hargreaves, I.P. Biochemical diagnosis of coenzyme q10 deficiency. Mol. Syndromol. 2014, 5, 147–155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rahman, S.; Hargreaves, I.; Clayton, P.; Heales, S. Neonatal presentation of coenzyme Q10 deficiency. J. Pediatr. 2001, 139, 456–458. [Google Scholar] [CrossRef] [PubMed]
- Peng, M.; Falk, M.J.; Haase, V.H.; King, R.; Polyak, E.; Selak, M.; Yudkoff, M.; Hancock, W.W.; Meade, R.; Saiki, R.; et al. Primary coenzyme Q deficiency in Pdss2 mutant mice causes isolated renal disease. PLoS Genet. 2008, 4, e1000061. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meerbrey, K.L.; Hu, G.; Kessler, J.D.; Roarty, K.; Li, M.Z.; Fang, J.E.; Herschkowitz, J.I.; Burrows, A.E.; Ciccia, A.; Sun, T.; et al. The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2011, 108, 3665–3670. [Google Scholar] [CrossRef] [Green Version]
- Galmozzi, A.; Sonne, S.B.; Altshuler-Keylin, S.; Hasegawa, Y.; Shinoda, K.; Luijten, I.H.N.; Chang, J.W.; Sharp, L.Z.; Cravatt, B.F.; Saez, E.; et al. ThermoMouse: An in vivo model to identify modulators of UCP1 expression in brown adipose tissue. Cell Rep. 2014, 9, 1584–1593. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Mao, K.; Wang, W.; Pan, H.; Wang, F.; Yang, M.; Liu, H. Kolliphor(R) HS 15 Micelles for the Delivery of Coenzyme Q10: Preparation, Characterization, and Stability. AAPS PharmSciTech 2016, 17, 757–766. [Google Scholar] [CrossRef]
- Podda, M.; Weber, C.; Traber, M.G.; Milbradt, R.; Packer, L. Sensitive high-performance liquid chromatography techniques for simultaneous determination of tocopherols, tocotrienols, ubiquinols, and ubiquinones in biological samples. Methods Enzymol. 1999, 299, 330–341. [Google Scholar] [CrossRef]
- Mina, A.I.; LeClair, R.A.; LeClair, K.B.; Cohen, D.E.; Lantier, L.; Banks, A.S. CalR: A Web-Based Analysis Tool for Indirect Calorimetry Experiments. Cell Metab. 2018, 28, 656–666.e1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bertholet, A.M.; Kirichok, Y. Patch-Clamp Analysis of the Mitochondrial H(+) Leak in Brown and Beige Fat. Front. Physiol. 2020, 11, 326. [Google Scholar] [CrossRef] [PubMed]
- Bour, S.; Carmona, M.C.; Galinier, A.; Caspar-Bauguil, S.; Van Gaal, L.; Staels, B.; Penicaud, L.; Casteilla, L. Coenzyme Q as an antiadipogenic factor. Antioxid. Redox Signal. 2011, 14, 403–413. [Google Scholar] [CrossRef] [PubMed]
- Echtay, K.S.; Winkler, E.; Klingenberg, M. Coenzyme Q is an obligatory cofactor for uncoupling protein function. Nature 2000, 408, 609–613. [Google Scholar] [CrossRef] [PubMed]
- Bertholet, A.M.; Kazak, L.; Chouchani, E.T.; Bogaczyńska, M.G.; Paranjpe, I.; Wainwright, G.L.; Bétourné, A.; Kajimura, S.; Spiegelman, B.M.; Kirichok, Y. Mitochondrial Patch Clamp of Beige Adipocytes Reveals UCP1-Positive and UCP1-Negative Cells Both Exhibiting Futile Creatine Cycling. Cell Metab. 2017, 25, 811–822.e4. [Google Scholar] [CrossRef] [Green Version]
- Petit, J.M.; Maftah, A.; Ratinaud, M.H.; Julien, R. 10N-nonyl acridine orange interacts with cardiolipin and allows the quantification of this phospholipid in isolated mitochondria. Eur. J. Biochem. 1992, 209, 267–273. [Google Scholar] [CrossRef]
- Luo, C.; Li, Y.; Wang, H.; Feng, Z.; Long, J.; Liu, J. Mitochondrial accumulation under oxidative stress is due to defects in autophagy. J. Cell. Biochem. 2013, 114, 212–219. [Google Scholar] [CrossRef]
- Smiley, S.T.; Reers, M.; Mottola-Hartshorn, C.; Lin, M.; Chen, A.; Smith, T.W.; Steele, G.D., Jr.; Chen, L.B. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc. Natl. Acad. Sci. USA 1991, 88, 3671–3675. [Google Scholar] [CrossRef] [Green Version]
- Korshunov, S.S.; Skulachev, V.P.; Starkov, A.A. High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett. 1997, 416, 15–18. [Google Scholar] [CrossRef] [Green Version]
- Feillet-Coudray, C.; Fouret, G.; Ebabe Elle, R.; Rieusset, J.; Bonafos, B.; Chabi, B.; Crouzier, D.; Zarkovic, K.; Zarkovic, N.; Ramos, J.; et al. The mitochondrial-targeted antioxidant MitoQ ameliorates metabolic syndrome features in obesogenic diet-fed rats better than Apocynin or Allopurinol. Free Radic. Res. 2014, 48, 1232–1246. [Google Scholar] [CrossRef]
- James, A.M.; Sharpley, M.S.; Manas, A.R.; Frerman, F.E.; Hirst, J.; Smith, R.A.; Murphy, M.P. Interaction of the mitochondria-targeted antioxidant MitoQ with phospholipid bilayers and ubiquinone oxidoreductases. J. Biol. Chem. 2007, 282, 14708–14718. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dikalova, A.E.; Bikineyeva, A.T.; Budzyn, K.; Nazarewicz, R.R.; McCann, L.; Lewis, W.; Harrison, D.G.; Dikalov, S.I. Therapeutic targeting of mitochondrial superoxide in hypertension. Circ. Res. 2010, 107, 106–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cypess, A.M.; Lehman, S.; Williams, G.; Tal, I.; Rodman, D.; Goldfine, A.B.; Kuo, F.C.; Palmer, E.L.; Tseng, Y.-H.; Doria, A.; et al. Identification and Importance of Brown Adipose Tissue in Adult Humans. N. Engl. J. Med. 2009, 360, 1509–1517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Becher, T.; Palanisamy, S.; Kramer, D.J.; Eljalby, M.; Marx, S.J.; Wibmer, A.G.; Butler, S.D.; Jiang, C.S.; Vaughan, R.; Schöder, H.; et al. Brown adipose tissue is associated with cardiometabolic health. Nat. Med. 2021, 27, 58–65. [Google Scholar] [CrossRef]
- Balaz, M.; Becker, A.S.; Balazova, L.; Straub, L.; Müller, J.; Gashi, G.; Maushart, C.I.; Sun, W.; Dong, H.; Moser, C.; et al. Inhibition of Mevalonate Pathway Prevents Adipocyte Browning in Mice and Men by Affecting Protein Prenylation. Cell Metab. 2019, 29, 901–916.e8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swerdlow, D.I.; Preiss, D.; Kuchenbaecker, K.B.; Holmes, M.V.; Engmann, J.E.; Shah, T.; Sofat, R.; Stender, S.; Johnson, P.C.; Scott, R.A.; et al. HMG-coenzyme A reductase inhibition, type 2 diabetes, and bodyweight: Evidence from genetic analysis and randomised trials. Lancet 2015, 385, 351–361. [Google Scholar] [CrossRef] [Green Version]
- Qu, H.; Meng, Y.Y.; Chai, H.; Liang, F.; Zhang, J.Y.; Gao, Z.Y.; Shi, D.Z. The effect of statin treatment on circulating coenzyme Q10 concentrations: An updated meta-analysis of randomized controlled trials. Eur. J. Med. Res. 2018, 23, 57. [Google Scholar] [CrossRef] [Green Version]
- Quinzii, C.M.; Hirano, M. Coenzyme Q and mitochondrial disease. Dev. Disabil. Res. Rev. 2010, 16, 183–188. [Google Scholar] [CrossRef]
- Esteves, T.C.; Echtay, K.S.; Jonassen, T.; Clarke, C.F.; Brand, M.D. Ubiquinone is not required for proton conductance by uncoupling protein 1 in yeast mitochondria. Biochem. J. 2004, 379, 309–315. [Google Scholar] [CrossRef] [Green Version]
- Tiefenbach, J.; Magomedova, L.; Liu, J.; Reunov, A.A.; Tsai, R.; Eappen, N.S.; Jockusch, R.A.; Nislow, C.; Cummins, C.L.; Krause, H.M. Idebenone and coenzyme Q10 are novel PPARα/γ ligands, with potential for treatment of fatty liver diseases. Dis. Models Mech. 2018, 11, dmm034801. [Google Scholar] [CrossRef]
- Villarroya, F.; Iglesias, R.; Giralt, M. PPARs in the Control of Uncoupling Proteins Gene Expression. PPAR Res. 2007, 2007, 074364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hodgson, J.M.; Watts, G.F.; Playford, D.A.; Burke, V.; Croft, K.D. Coenzyme Q10 improves blood pressure and glycaemic control: A controlled trial in subjects with type 2 diabetes. Eur. J. Clin. Nutr. 2002, 56, 1137–1142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zahedi, H.; Eghtesadi, S.; Seifirad, S.; Rezaee, N.; Shidfar, F.; Heydari, I.; Golestan, B.; Jazayeri, S. Effects of CoQ10 Supplementation on Lipid Profiles and Glycemic Control in Patients with Type 2 Diabetes: A randomized, double blind, placebo-controlled trial. J. Diabetes Metab. Disord. 2014, 13, 81. [Google Scholar] [CrossRef] [Green Version]
- Eriksson, J.G.; Forsén, T.J.; Mortensen, S.A.; Rohde, M. The effect of coenzyme Q10 administration on metabolic control in patients with type 2 diabetes mellitus. Biofactors 1999, 9, 315–318. [Google Scholar] [CrossRef] [PubMed]
- Akbari Fakhrabadi, M.; Zeinali Ghotrom, A.; Mozaffari-Khosravi, H.; Hadi Nodoushan, H.; Nadjarzadeh, A. Effect of Coenzyme Q10 on Oxidative Stress, Glycemic Control and Inflammation in Diabetic Neuropathy: A Double Blind Randomized Clinical Trial. Int. J. Vitam. Nutr. Res. 2014, 84, 252–260. [Google Scholar] [CrossRef]
- Hernández-Camacho, J.D.; Bernier, M.; López-Lluch, G.; Navas, P. Coenzyme Q(10) Supplementation in Aging and Disease. Front. Physiol. 2018, 9, 44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mantle, D.; Dybring, A. Bioavailability of Coenzyme Q10: An Overview of the Absorption Process and Subsequent Metabolism. Antioxidants 2020, 9, 386. [Google Scholar] [CrossRef]
- Pastor-Maldonado, C.J.; Suárez-Rivero, J.M.; Povea-Cabello, S.; Álvarez-Córdoba, M.; Villalón-García, I.; Munuera-Cabeza, M.; Suárez-Carrillo, A.; Talaverón-Rey, M.; Sánchez-Alcázar, J.A. Coenzyme Q10: Novel Formulations and Medical Trends. Int. J. Mol. Sci. 2020, 21, 8432. [Google Scholar] [CrossRef]
- Wang, Y.; Hekimi, S. Micellization of coenzyme Q by the fungicide caspofungin allows for safe intravenous administration to reach extreme supraphysiological concentrations. Redox Biol. 2020, 36, 101680. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, C.-F.; Gunawan, A.L.; Liparulo, I.; Zushin, P.-J.H.; Bertholet, A.M.; Kirichok, Y.; Stahl, A. CoQ Regulates Brown Adipose Tissue Respiration and Uncoupling Protein 1 Expression. Antioxidants 2023, 12, 14. https://doi.org/10.3390/antiox12010014
Chang C-F, Gunawan AL, Liparulo I, Zushin P-JH, Bertholet AM, Kirichok Y, Stahl A. CoQ Regulates Brown Adipose Tissue Respiration and Uncoupling Protein 1 Expression. Antioxidants. 2023; 12(1):14. https://doi.org/10.3390/antiox12010014
Chicago/Turabian StyleChang, Ching-Fang, Amanda L. Gunawan, Irene Liparulo, Peter-James H. Zushin, Ambre M. Bertholet, Yuriy Kirichok, and Andreas Stahl. 2023. "CoQ Regulates Brown Adipose Tissue Respiration and Uncoupling Protein 1 Expression" Antioxidants 12, no. 1: 14. https://doi.org/10.3390/antiox12010014