Molecular Characterization, Expression Profile, and A 21-bp Indel within the ASB9 Gene and Its Associations with Chicken Production Traits
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Approval
2.2. Test Animals
2.2.1. F2 Resource Population
2.2.2. Genotyping Sample Collection
2.2.3. Cell Culture
2.3. DNA Isolation and PCR
2.4. RNA Extraction, cDNA Synthesis, and qPCR
2.5. Statistical Analysis
2.6. Phylogenetic Analysis
3. Results
3.1. Molecular Characterization and Bioinformatics Analysis of ASB9 in Chickens
3.2. Identification of Genetic Variants Correlated with ASB9 Expression
3.3. The ASB9 Gene 21-bp Indel Locus Genotypes and Genetic Parameters in Eleven Chicken Breeds and an F2 Resource Population
3.4. Association of the ASB9 Gene 21-bp Indel with Growth, Carcass, and Blood Biochemical Variables
3.5. Expression Level of ASB9 in Chickens
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xu, Y.; Shi, T.; Zhou, Y.; Liu, M.; Klaus, S.; Lan, X.; Lei, C.; Chen, H. A novel PAX7 10-bp indel variant modulates promoter activity, gene expression and contributes to different phenotypes of Chinese cattle. Sci. Rep. 2018, 8, 1724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, C.; Ju, X.; Cheng, H.; Huang, X.; Jiang, F.; Yao, Y.; Lan, X.; Song, E. Determination of genetic variation within the DYRK2 gene and its associations with milk traits in cattle. Arch. Anim. Breed. 2020, 63, 315–323. [Google Scholar] [CrossRef] [PubMed]
- Shi, T.; Peng, W.; Yan, J.; Cai, H.; Lan, X.; Lei, C.; Bai, Y.; Chen, H. A novel 17 bp indel in the SMAD3 gene alters transcription level, contributing to phenotypic traits in Chinese cattle. Arch. Anim. Breed. 2016, 59, 151–157. [Google Scholar] [CrossRef] [Green Version]
- Zhao, H.; Wu, M.; Wang, S.; Yu, X.; Li, Z.; Dang, R.; Sun, X. Identification of a novel 24 bp insertion-deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds. Arch. Anim. Breed. 2018, 61, 71–78. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Erdenee, S.; Zhang, S.; Wei, Z.; Zhang, M.; Jin, Y.; Wu, H.; Chen, H.; Sun, X.; Xu, H.; et al. Genetic effects of PRNP gene insertion/deletion (indel) on phenotypic traits in sheep. Prion 2018, 12, 42–53. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bi, Y.; Feng, B.; Wang, Z.; Zhu, H.; Qu, L.; Lan, X.; Pan, C.; Song, X. Myostatin (MSTN) Gene Indel Variation and Its Associations with Body Traits in Shaanbei White Cashmere Goat. Animals 2020, 10, 168. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Wang, K.; Liu, J.; Zhu, H.; Qu, L.; Chen, H.; Lan, X.; Pan, C.; Song, X. An 11-bp Indel Polymorphism within the CSN1S1 Gene Is Associated with Milk Performance and Body Measurement Traits in Chinese Goats. Animals 2019, 9, 1114. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Yang, Q.; Wang, K.; Zhang, S.; Pan, C.; Chen, H.; Qu, L.; Yan, H.; Lan, X. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim. Genet. 2017, 48, 735–736. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, X.; Zang, R.; Cai, Y.; Cao, X.; Yang, J.; Li, J.; Lan, X.; Wu, J. Genetic variations in the sheep SIRT7 gene and their correlation with body size traits. Arch. Anim. Breed. 2019, 62, 189–197. [Google Scholar] [CrossRef]
- Ren, F.; Yu, S.; Chen, R.; Lv, X.; Pan, C. Identification of a novel 12-bp insertion/deletion (indel) of iPS-related Oct4 gene and its association with reproductive traits in male piglets. Anim. Reprod. Sci. 2017, 178, 55–60. [Google Scholar] [CrossRef]
- Zhang, W.; Fang, M.; Li, Y.; Nie, Q.; Zhang, X. Identification of TDRP1 gene and its association with pig reproduction traits. DNA Cell Biol. 2012, 31, 371–377. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Han, R.L.; Gao, Z.Y.; Zhu, S.K.; Tian, Y.D.; Sun, G.R.; Kang, X.T. A novel 31-bp indel in the paired box 7 (PAX7) gene is associated with chicken performance traits. Br. Poult. Sci. 2014, 55, 31–36. [Google Scholar] [CrossRef]
- Jia, X.; Lin, H.; Nie, Q.; Zhang, X.; Lamont, S.J. A short insertion mutation disrupts genesis of miR-16 and causes increased body weight in domesticated chicken. Sci. Rep. 2016, 6, 36433. [Google Scholar] [CrossRef]
- Lyu, S.J.; Tian, Y.D.; Wang, S.H.; Han, R.L.; Mei, X.X.; Kang, X.T. A novel 2-bp indel within Krüppel-like factor 15 gene (KLF15) and its associations with chicken growth and carcass traits. Br. Poult. Sci. 2014, 55, 427–434. [Google Scholar] [CrossRef] [PubMed]
- Han, R.L.; Li, Z.J.; Li, M.J.; Li, J.Q.; Lan, X.Y.; Sun, G.R.; Kang, X.T.; Chen, H. Novel 9-bp indel in visfatin gene and its associations with chicken growth. Br. Poult. Sci. 2011, 52, 52–57. [Google Scholar] [CrossRef] [PubMed]
- Shen, Q.; Zhou, J.; Li, J.; Zhao, X.; Zheng, L.; Bao, H.; Wu, C. Genome-Wide Association Study Identifies Candidate Genes for Stripe Pattern Feather Color of Rhode Island Red Chicks. Genes 2022, 13, 1511. [Google Scholar] [CrossRef]
- Kohroki, J.; Nishiyama, T.; Nakamura, T.; Masuho, Y. ASB proteins interact with Cullin5 and Rbx2 to form E3 ubiquitin ligase complexes. FEBS Lett. 2005, 579, 6796–6802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kile, B.T.; Metcalf, D.; Mifsud, S.; DiRago, L.; Nicola, N.A.; Hilton, D.J.; Alexander, W.S. Functional analysis of Asb-1 using genetic modification in mice. Mol. Cell. Biol. 2001, 21, 6189–6197. [Google Scholar] [CrossRef] [Green Version]
- Linossi, E.M.; Nicholson, S.E. The SOCS box-adapting proteins for ubiquitination and proteasomal degradation. IUBMB Life 2012, 64, 316–323. [Google Scholar] [CrossRef]
- James, J.; Zhang, Y.; Osinska, H.; Sanbe, A.; Klevitsky, R.; Hewett, T.E.; Robbins, J. Transgenic modeling of a cardiac troponin I mutation linked to familial hypertrophic cardiomyopathy. Circ. Res. 2000, 87, 805–811. [Google Scholar] [CrossRef] [Green Version]
- Burton, D.; Abdulrazzak, H.; Knott, A.; Elliott, K.; Redwood, C.; Watkins, H.; Marston, S.; Ashley, C. Two mutations in troponin I that cause hypertrophic cardiomyopathy have contrasting effects on cardiac muscle contractility. Biochem. J. 2002, 362, 443–451. [Google Scholar] [CrossRef] [PubMed]
- Molkentin, J.D. The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression. J. Biol. Chem. 2000, 275, 38949–38952. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barz, T.; Hoffmann, A.; Panhuysen, M.; Spengler, D. Peroxisome proliferator-activated receptor γ is a Zac target gene mediating Zac antiproliferation. Cancer Res. 2006, 66, 11975–11982. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schiffer, J.M.; Malmstrom, R.D.; Parnell, J.; Ramirez-Sarmiento, C.; Reyes, J.; Amaro, R.E.; Komives, E.A. Model of the Ankyrin and SOCS Box Protein, ASB9, E3 Ligase Reveals a Mechanism for Dynamic Ubiquitin Transfer. Structure 2016, 24, 1248–1256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benoit, G.; Warma, A.; Lussier, J.G.; Ndiaye, K. Gonadotropin regulation of ankyrin-repeat and SOCS-box protein 9 (ASB9) in ovarian follicles and identification of binding partners. PLoS ONE 2019, 14, e0212571. [Google Scholar] [CrossRef] [Green Version]
- Tokuoka, M.; Miyoshi, N.; Hitora, T.; Mimori, K.; Tanaka, F.; Shibata, K.; Ishii, H.; Sekimoto, M.; Doki, Y.; Mori, M. Clinical significance of ASB9 in human colorectal cancer. Int. J. Oncol. 2010, 37, 1105–1111. [Google Scholar] [CrossRef] [Green Version]
- Zhong, L.; Ge, K.; Zu, J.C.; Zhao, L.H.; Shen, W.K.; Wang, J.F.; Zhang, X.G.; Gao, X.; Hu, W.; Yen, Y.; et al. Autoantibodies as potential biomarkers for breast cancer. Breast Cancer Res. 2008, 10, R40. [Google Scholar] [CrossRef] [Green Version]
- Liu, D.; Han, R.; Wang, X.; Li, W.; Tang, S.; Li, W.; Tang, S.; Wang, Y.; Jiang, R.; Yan, F.; et al. A novel 86-bp indel of the motilin receptor gene is significantly associated with growth and carcass traits in Gushi-Anka F(2) reciprocal cross chickens. Br. Poult. Sci. 2019, 60, 649–658. [Google Scholar] [CrossRef]
- Liang, K.; Wang, X.; Tian, X.; Geng, R.; Li, W.; Jing, Z.; Han, R.; Tian, Y.; Liu, X.; Kang, X.; et al. Molecular characterization and an 80-bp indel polymorphism within the prolactin receptor (PRLR) gene and its associations with chicken growth and carcass traits. 3 Biotech 2019, 9, 296. [Google Scholar] [CrossRef]
- Ren, T.; Li, W.; Liu, D.; Liang, K.; Wang, X.; Li, H.; Jiang, R.; Tian, Y.; Kang, X.; Li, Z. Two insertion/deletion variants in the promoter region of the QPCTL gene are significantly associated with body weight and carcass traits in chickens. Anim. Genet. 2019, 50, 279–282. [Google Scholar] [CrossRef]
- Cai, B.; Ma, M.; Chen, B.; Li, Z.; Abdalla, B.A.; Nie, Q.; Zhang, X. MiR-16-5p targets SESN1 to regulate the p53 signaling pathway, affecting myoblast proliferation and apoptosis, and is involved in myoblast differentiation. Cell Death Dis. 2018, 9, 367. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Li, Z.; Guo, Y.; Wang, Y.; Sun, G.; Jiang, R.; Kang, X.; Han, R. Identification of a novel 43-bp insertion in the heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene and its associations with growth and carcass traits in chickens. Anim. Biotechnol. 2019, 30, 252–259. [Google Scholar] [CrossRef]
- Kang, Z.; Zhang, S.; He, L.; Zhu, H.; Wang, Z.; Yan, H.; Huang, Y.; Dang, R.; Lei, C.; Chen, H.; et al. A 14-bp functional deletion within the CMTM2 gene is significantly associated with litter size in goat. Theriogenology 2019, 139, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1974, 76, 379–390. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Jing, Z.; Cheng, Y.; Wang, X.; Li, D.; Han, R.; Li, W.; Li, G.; Sun, G.; Tian, Y.; et al. Analysis of four complete linkage sequence variants within a novel lncRNA located in a growth QTL on chromosome 1 related to growth traits in chickens. J. Anim. Sci. 2020, 98, skaa122. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Liu, D.; Tang, S.; Li, D.; Han, R.; Tian, Y.; Li, H.; Li, G.; Li, W.; Liu, X.; et al. A multiallelic indel in the promoter region of the Cyclin-dependent kinase inhibitor 3 gene is significantly associated with body weight and carcass traits in chickens. Poult. Sci. 2019, 98, 556–565. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, Z.; He, Z.; Tang, W.; Li, T.; Zeng, Z.; He, L.; Shi, Y. A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: Update of the SHEsis (http://analysis.bio-x.cn). Cell Res. 2009, 19, 519–523. [Google Scholar] [CrossRef]
- Rose, A.B. Intron-mediated regulation of gene expression. Curr. Top. Microbiol. Immunol. 2008, 326, 77–90. [Google Scholar] [CrossRef]
- Yang, Q.; Yan, H.; Li, J.; Xu, H.; Wang, K.; Zhu, H.; Chen, H.; Qu, L.; Lan, X. A novel 14-bp duplicated deletion within goat GHR gene is significantly associated with growth traits and litter size. Anim. Genet. 2017, 48, 499–500. [Google Scholar] [CrossRef]
- Shaul, O. How introns enhance gene expression. Int. J. Biochem. Cell Biol. 2017, 91, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Li, H.; Zhao, X.Q.; Xue, H.; Zheng, Y.; Meng, H.; Jia, Y.; Bo, S.L. The evolution mechanism of intron length. Genomics 2016, 108, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Lee, M.O.; Davis, B.W.; Wu, P.; Hsieh Li, S.M.; Chuong, C.M.; Andersson, L. Corrigendum to “The crest phenotype in domestic chicken is caused by a 195 bp duplication in the intron of HOXC10”. G3 2022, 12, jkab425. [Google Scholar] [CrossRef] [PubMed]
- Kumari, P.; Singh, S.K.; Raman, R. A novel non-coding RNA within an intron of CDH2 and association of its SNP with non-syndromic cleft lip and palate. Gene 2018, 658, 123–128. [Google Scholar] [CrossRef]
- Nezer, C.; Moreau, L.; Brouwers, B.; Coppieters, W.; Detilleux, J.; Hanset, R.; Karim, L.; Kvasz, A.; Leroy, P.; Georges, M. An imprinted QTL with major effect on muscle mass and fat deposition maps to the IGF2 locus in pigs. Nat. Genet. 1999, 21, 155–156. [Google Scholar] [CrossRef]
- Li, T.; Qin, P.; Chen, B.; Niu, X.; Wang, Y.; Niu, Y.; Wei, C.; Hou, D.; Ma, H.; Han, R.; et al. A novel 27-bp indel in the intron region of the YBX3 gene is associated with growth traits in chickens. Br. Poult. Sci. 2022, 63, 590–596. [Google Scholar] [CrossRef]
- Chang, C.M.; Furet, J.P.; Coville, J.L.; Coquerelle, G.; Gourichon, D.; Tixier-Boichard, M. Quantitative effects of an intronic retroviral insertion on the transcription of the tyrosinase gene in recessive white chickens. Anim. Genet. 2007, 38, 162–167. [Google Scholar] [CrossRef]
- Amills, M.; Jimenez, N.; Villalba, D.; Tor, M.; Molina, E.; Cubilo, D.; Marcos, C.; Francesch, A.; Sanchez, A.; Estany, J. Identification of three single nucleotide polymorphisms in the chicken insulin-like growth factor 1 and 2 genes and their associations with growth and feeding traits. Poult. Sci. 2003, 82, 1485–1493. [Google Scholar] [CrossRef]
- He, Y.; Shi, H.; Li, Z.; Kang, J.; Li, M.; Liu, M.; Liu, Y.; Zhao, J.; Dou, T.; Jia, J.; et al. Identification of New Genes and Genetic Variant Loci Associated with Breast Muscle Development in the Mini-Cobb F2 Chicken Population Using a Genome-Wide Association Study. Genes 2022, 13, 2153. [Google Scholar] [CrossRef]
- Tan, X.; Liu, L.; Liu, X.; Cui, H.; Liu, R.; Zhao, G.; Wen, J. Large-Scale Whole Genome Sequencing Study Reveals Genetic Architecture and Key Variants for Breast Muscle Weight in Native Chickens. Genes 2021, 13, 3. [Google Scholar] [CrossRef]
- Tanaka, M.; Miyazaki, T.; Yamamoto, I.; Nakai, N.; Ohta, Y.; Tsushima, N.; Wakita, M.; Shimada, K. Molecular characterization of chicken growth hormone secretagogue receptor gene. Gen. Comp. Endocrinol. 2003, 134, 198–202. [Google Scholar] [CrossRef] [PubMed]
- Fisher, R.A. XV.—The Correlation between Relatives on the Supposition of Mendelian Inheritance. Trans. R. Soc. Edinb. 1919, 52, 399–433. [Google Scholar] [CrossRef] [Green Version]
- Elliott, J.; Johnston, J.A. SOCS: Role in inflammation, allergy and homeostasis. Trends Immunol. 2004, 25, 434–440. [Google Scholar] [CrossRef]
- Dalpke, A.; Heeg, K.; Bartz, H.; Baetz, A. Regulation of innate immunity by suppressor of cytokine signaling (SOCS) proteins. Immunobiology 2008, 213, 225–235. [Google Scholar] [CrossRef]
- Tee, J.M.; Peppelenbosch, M.P. Anchoring skeletal muscle development and disease: The role of ankyrin repeat domain containing proteins in muscle physiology. Crit. Rev. Biochem. Mol. Biol. 2010, 45, 318–330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nosratpour, S.; Ndiaye, K. Ankyrin-repeat and SOCS box-containing protein 9 (ASB9) regulates ovarian granulosa cells function and MAPK signaling. Mol. Reprod. Dev. 2021, 88, 830–843. [Google Scholar] [CrossRef]
- Balasubramaniam, D.; Schiffer, J.; Parnell, J.; Mir, S.P.; Amaro, R.E.; Komives, E.A. How the ankyrin and SOCS box protein, ASB9, binds to creatine kinase. Biochemistry 2015, 54, 1673–1680. [Google Scholar] [CrossRef] [Green Version]
- Fei, X.; Gu, X.; Fan, S.; Yang, Z.; Li, F.; Zhang, C.; Gong, W.; Mao, Y.; Ji, C. Crystal structure of Human ASB9-2 and substrate-recognition of CKB. Protein J. 2012, 31, 275–284. [Google Scholar] [CrossRef]
- Kwon, S.; Kim, D.; Rhee, J.W.; Park, J.A.; Kim, D.W.; Kim, D.S.; Lee, Y.; Kwon, H.J. ASB9 interacts with ubiquitous mitochondrial creatine kinase and inhibits mitochondrial function. BMC Biol. 2010, 8, 23. [Google Scholar] [CrossRef] [Green Version]
- Wallimann, T.; Wyss, M.; Brdiczka, D.; Nicolay, K.; Eppenberger, H.M. Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: The ‘phosphocreatine circuit’ for cellular energy homeostasis. Biochem. J. 1992, 281, 21–40. [Google Scholar] [CrossRef] [Green Version]
- Wyss, M.; Kaddurah-Daouk, R. Creatine and creatinine metabolism. Physiol. Rev. 2000, 80, 1107–1213. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, S.; Gao, Y.S.; Chen, Z.; Zhou, H.M.; Yan, Y.B. Dissimilarity in the folding of human cytosolic creatine kinase isoenzymes. PLoS ONE 2011, 6, e24681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bush, D.J.; Kirillova, O.; Clark, S.A.; Davulcu, O.; Fabiola, F.; Xie, Q.; Somasundaram, T.; Ellington, W.R.; Chapman, M. The structure of lombricine kinase: Implications for phosphagen kinase conformational changes. J. Biol. Chem. 2011, 286, 9338–9350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moe, H.H.; Shimogiri, T.; Kawabe, K.; Nishibori, M.; Okamoto, S.; Hashiguchi, T.; Maeda, Y. Genotypic Frequency in Asian Native Chicken Populations and Gene Expression Using Insulin-like Growth Factor 1 (IGF1) Gene Promoter Polymorphism. J. Poult. Sci. 2009, 46, 1–5. [Google Scholar] [CrossRef]
Breeds | Tissue/Cell Samples | Week Age |
---|---|---|
AA | heart, liver, spleen, breast muscle, leg muscle, pancreas, muscle stomach | E14 |
AA | heart, liver, spleen, lung, pancreas, muscle stomach, breast muscle, leg muscle, and kidney | 3W |
LS | heart, liver, spleen, lung, pancreas, muscle stomach, breast muscle, leg muscle, and kidney | 3W |
AA | breast muscle | E10, E12, E14, E16, E18, and 1D, 1W, 3W |
AA | leg muscle | E10, E12, E14, E16, E18, and 1D, 1W, 3W |
LS | breast muscle | E10, E12, E14, E16, E18, and 1D, 1W, 3W |
LS | leg muscle | E10, E12, E14, E16, E18, and 1D, 1W, 3W |
LS | liver | 1D, 1W, 3W, 5W |
AA | primary myoblasts | 1D, 2D, 3D, 4D, 5D, 6D, 7D |
Primer Set | Primer Sequence, (All 5′-3′) | Product Size (bp) | Tm, °C |
---|---|---|---|
ASB9-F1 | TGCCTAGAACAACGCCATCTT | 60/81 | 60 |
ASB9-R1 | TCAAATAGCTACAGCAGCACAA | ||
ASB9-qF1 | TGAATTTACTGCTGCAACATGGG | 293 | 60 |
ASB9-qR1 | CACCAGCTCTACACTGCAAC | ||
GAPDH-F | GAACATCATCCCAGCGTCCA | 132 | 60 |
GAPDH-R | CGGCAGGTCAGGTCAACAAC |
Breeds | n | Genotype and Allelic Frequencies | Ho | Ne | PIC | p-Value, HWE | |||||
---|---|---|---|---|---|---|---|---|---|---|---|
II | ID | DD | I | D | |||||||
F2 generation resource population | F2 | 654 | 0.49 | 0.46 | 0.05 | 0.716 | 0.284 | 0.460 | 1.685 | 0.32 | 0.00 |
Dual-purpose chickens | DX | 189 | 0.29 | 0.50 | 0.21 | 0.540 | 0.460 | 0.497 | 1.987 | 0.37 | 0.99 |
CS | 181 | 0.27 | 0.55 | 0.18 | 0.544 | 0.456 | 0.547 | 1.984 | 0.37 | 0.17 | |
LS | 271 | 0.41 | 0.48 | 0.11 | 0.648 | 0.352 | 0.476 | 1.840 | 0.35 | 0.48 | |
YY | 77 | 0.25 | 0.55 | 0.21 | 0.519 | 0.481 | 0.545 | 1.997 | 0.37 | 0.42 | |
GF | 264 | 0.19 | 0.50 | 0.31 | 0.438 | 0.563 | 0.504 | 1.969 | 0.37 | 0.70 | |
HNG | 84 | 0.11 | 0.65 | 0.24 | 0.435 | 0.565 | 0.655 | 1.966 | 0.37 | 0.00 | |
Commercial broilers | RS308 | 92 | 0.41 | 0.49 | 0.10 | 0.658 | 0.342 | 0.489 | 1.819 | 0.35 | 0.41 |
HBD | 96 | 0.31 | 0.60 | 0.08 | 0.615 | 0.385 | 0.604 | 1.900 | 0.36 | 0.01 | |
AA | 279 | 0.26 | 0.70 | 0.04 | 0.612 | 0.388 | 0.702 | 1.904 | 0.36 | 0.00 | |
Cobb | 182 | 0.15 | 0.69 | 0.16 | 0.492 | 0.508 | 0.687 | 1.999 | 0.37 | 0.00 | |
Commercial laying hens | HL | 272 | 0.19 | 0.66 | 0.15 | 0.524 | 0.476 | 0.658 | 1.995 | 0.37 | 0.00 |
Growth Traits | Mean ± SE | p-Value | ||
---|---|---|---|---|
II (n = 318) | ID (n = 301) | DD (n = 35) | ||
4-week weight (g) | 326.43 ± 2.61 | 319.35 ± 2.7 | 310.29 ± 7.7 | 0.047 |
6-week weight (g) | 574.35 ± 4.86 | 558.3 ± 5.03 | 542.44 ± 14.46 | 0.020 |
8-week weight (g) | 827.83 ± 7.31 | 809.71 ± 7.46 | 783.57 ± 21.32 | 0.043 |
10-week weight (g) | 1137.01 ± 9.07 a | 1100.62 ± 9.22 b | 1098.27 ± 27.37 ab | 0.015 |
12-week weight (g) | 1380.52 ± 10.75 a | 1342.64 ± 10.96 b | 1286.68 ± 32.18 b | 0.004 |
12-week sternum length (cm) | 9.49 ± 0.04 a | 9.35 ± 0.04 b | 9.33 ± 0.1 ab | 0.012 |
4-week shin girth (cm) | 2.72 ± 0.02 | 2.69 ± 0.02 | 2.64 ± 0.04 | 0.011 |
12-week shin girth (cm) | 3.88 ± 0.02 a | 3.83 ± 0.02 b | 3.81 ± 0.04 ab | 0.020 |
4-week Sternum length (cm) | 6.28 ± 0.03 a | 6.19 ± 0.03 b | 6.14 ± 0.09 ab | 0.043 |
8-week Sternum length (cm) | 9.0 ± 0.04 | 8.9 ± 0.04 | 8.76 ± 0.11 | 0.034 |
12-week Sternum length (cm) | 11.09 ± 0.04 a | 10.96 ± 0.04 ab | 10.78 ± 0.12 b | 0.007 |
4-week body slanting length (cm) | 11.46 ± 0.05 | 11.33 ± 0.05 | 11.23 ± 0.13 | 0.046 |
8-week body slanting length (cm) | 16.33 ± 0.07 | 16.16 ± 0.07 | 15.9 ± 0.19 | 0.031 |
12-week body slanting length (cm) | 19.9 ± 0.06 a | 19.69 ± 0.06 b | 19.71 ± 0.18 ab | 0.032 |
4-week pelvis width (cm) | 5.2 ± 0.03 | 5.12 ± 0.03 | 5.04 ± 0.08 | 0.015 |
Traits | Mean ± SE | p-Value | ||
---|---|---|---|---|
II (n = 318) | ID (n = 301) | DD (n = 35) | ||
SEW (g) | 1120.05 ± 9.34 a | 1094.85 ± 9.58 ab | 1047.83 ± 28.2 b | 0.021 |
EW (g) | 937.13 ± 8.13 | 912.93 ± 8.31 | 876.51 ± 24.48 | 0.018 |
CLW (g) | 60.43 ± 0.57 a | 57.65 ± 0.59 b | 55.77 ± 1.73 b | 0.001 |
BMW (g) | 72.18 ± 0.85 | 69.8 ± 0.87 | 65.92 ± 2.57 | 0.023 |
LeW (g) | 152.98 ± 1.37 a | 148.01 ± 1.41 b | 140.71 ± 4.15 b | 0.003 |
LMW (g) | 101.91 ± 1 a | 98.51 ± 1.02 ab | 92.98 ± 2.99 b | 0.004 |
HWP (%) | 3.19 ± 0.02 a | 3.22 ± 0.02 ab | 3.35 ± 0.06 b | 0.020 |
CLR (%) | 4.36 ± 0.03 a | 4.26 ± 0.03 b | 4.31 ± 0.08 ab | 0.023 |
PWP (%) | 0.25 ± 0.01 a | 0.26 ± 0.01 ab | 0.28 ± 0.01 b | 0.009 |
ShW (g) | 1211.34 ± 9.55 a | 1180.36 ± 9.82 ab | 1135.01 ± 29.01 b | 0.010 |
LMB (cm) | 25.32 ± 0.3 | 24.28 ± 0.32 | 24.18 ± 0.91 | 0.047 |
LMD (g/cm³) | 903.65 ± 17.52 a | 973.37 ± 18.29 b | 977.12 ± 53.23 ab | 0.018 |
Serum Variable | Mean ± SE | p-Value | ||
---|---|---|---|---|
II (n = 318) | ID (n = 301) | DD (n = 35) | ||
Alanine aminotransferase (U/L) | 1.78 ± 0.12 a | 1.61 ± 0.13 ab | 3.16 ± 0.37 b | 0.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qin, P.; Liu, Y.; Niu, X.; Liu, Y.; Zhang, Y.; Niu, Y.; Wang, Y.; Chen, B.; Han, R.; Tian, Y.; et al. Molecular Characterization, Expression Profile, and A 21-bp Indel within the ASB9 Gene and Its Associations with Chicken Production Traits. Genes 2023, 14, 339. https://doi.org/10.3390/genes14020339
Qin P, Liu Y, Niu X, Liu Y, Zhang Y, Niu Y, Wang Y, Chen B, Han R, Tian Y, et al. Molecular Characterization, Expression Profile, and A 21-bp Indel within the ASB9 Gene and Its Associations with Chicken Production Traits. Genes. 2023; 14(2):339. https://doi.org/10.3390/genes14020339
Chicago/Turabian StyleQin, Panpan, Yang Liu, Xinran Niu, Yixuan Liu, Yushi Zhang, Yufang Niu, Yanxing Wang, Bingjie Chen, Ruili Han, Yadong Tian, and et al. 2023. "Molecular Characterization, Expression Profile, and A 21-bp Indel within the ASB9 Gene and Its Associations with Chicken Production Traits" Genes 14, no. 2: 339. https://doi.org/10.3390/genes14020339