Fabrication and Evaluation of Tubule-on-a-Chip with RPTEC/HUVEC Co-Culture Using Injection-Molded Polycarbonate Chips
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Fabrication of Injection-Molded Chip (I-M Chip)
2.3. Cell Viability Assessment and Imaging
2.4. Immunofluorescence
2.5. Glucose and TEER
2.6. Permeability Measurement
2.7. Evaluation of Metformin Secretion and Cimetidine Inhibition Using HPLC
2.8. qPCR (Quantitative RT-PCR) for Confirmation of Quantitative Transporter Expression
3. Result and Discussion
3.1. Comparison of Cell Cultures in Shear Stress and Membrane Pore Size
3.2. Comparison of Pore Size with Static/Fluidic Cell Growth
3.3. Confirmation of the Effects of Metformin and Cimetidine According to Pore Size
3.4. Confirmation of Transporter Expression by qPCR
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ma, C.; Peng, Y.; Li, H.; Chen, W. Organ-on-a-chip: A new paradigm for drug development. Trends Pharmacol. Sci. 2021, 42, 119–133. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Liu, J.; Wang, X.; Feng, L.; Wu, J.; Zhu, X.; Wen, W.; Gong, X. Organ-on-a-chip: Recent breakthroughs and future prospects. Biomed. Eng. Online 2020, 19, 1–19. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ingber, D.E. Human organs-on-chips for disease modelling, drug development and personalized medicine. Nat. Rev. Genet. 2022, 23, 467–491. [Google Scholar] [CrossRef]
- Shrestha, J.; Razavi Bazaz, S.; Aboulkheyr Es, H.; Yaghobian Azari, D.; Thierry, B.; Ebrahimi Warkiani, M.; Ghadiri, M. Lung-on-a-chip: The future of respiratory disease models and pharmacological studies. Crit. Rev. Biotechnol. 2020, 40, 213–230. [Google Scholar] [CrossRef]
- Petrosyan, A.; Cravedi, P.; Villani, V.; Angeletti, A.; Manrique, J.; Renieri, A.; De Filippo, R.E.; Perin, L.; Da Sacco, S. A glomerulus-on-a-chip to recapitulate the human glomerular filtration barrier. Nat. Commun. 2019, 10, 3656. [Google Scholar] [CrossRef][Green Version]
- Grosberg, A.; Alford, P.W.; McCain, M.L.; Parker, K.K. Ensembles of engineered cardiac tissues for physiological and pharmacological study: Heart on a chip. Lab Chip 2011, 11, 4165–4173. [Google Scholar] [CrossRef][Green Version]
- Duffy, D.C.; McDonald, J.C.; Schueller, O.J.A.; Whitesides, G.M. Rapid prototyping of microfluidic systems in poly (dimethylsiloxane). Anal. Chem. 1998, 70, 4974–4984. [Google Scholar] [CrossRef] [PubMed]
- Preetam, S.; Nahak, B.K.; Patra, S.; Toncu, D.C.; Park, S.; Syväjärvi, M.; Orive, G.; Tiwari, A. Emergence of microfluidics for next generation biomedical devices. Biosens. Bioelectron. X 2022, 10, 100106. [Google Scholar] [CrossRef]
- Nieskens, T.T.G.; Wilmer, M.J. Kidney-on-a-chip technology for renal proximal tubule tissue reconstruction. Eur. J. Pharmacol. 2016, 790, 46–56. [Google Scholar] [CrossRef]
- Niculescu, A.-G.; Chircov, C.; Bîrcă, A.C.; Grumezescu, A.M. Fabrication and applications of microfluidic devices: A review. Int. J. Mol. Sci. 2021, 22, 2011. [Google Scholar] [CrossRef]
- Homan, K.A.; Kolesky, D.B.; Skylar-Scott, M.A.; Herrmann, J.; Obuobi, H.; Moisan, A.; Lewis, J.A. Bioprinting of 3D convoluted renal proximal tubules on perfusable chips. Sci. Rep. 2016, 6, 34845. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Maggiorani, D.; Dissard, R.; Belloy, M.; Saulnier-Blache, J.-S.; Casemayou, A.; Ducasse, L.; Grès, S.; Bellière, J.; Caubet, C.; Bascands, J.-L. Shear stress-induced alteration of epithelial organization in human renal tubular cells. PLoS ONE 2015, 10, e0131416. [Google Scholar] [CrossRef] [PubMed]
- Friedrich, C.; Endlich, N.; Kriz, W.; Endlich, K. Podocytes are sensitive to fluid shear stress in vitro. Am. J. Physiol. Physiol. 2006, 291, F856–F865. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kim, H.; Lee, J.-B.; Kim, K.; Sung, G.Y. Effect of Shear Stress on the Proximal Tubule-On-A-Chip for Multi-Organ Microphysiological System. J. Ind. Eng. Chem. 2022, 115, 279–286. [Google Scholar] [CrossRef]
- Gomez-Sjoberg, R.; Leyrat, A.A.; Houseman, B.T.; Shokat, K.; Quake, S.R. Biocompatibility and reduced drug absorption of Sol− Gel-Treated Poly (dimethyl siloxane) for microfluidic cell culture applications. Anal. Chem. 2010, 82, 8954–8960. [Google Scholar] [CrossRef][Green Version]
- Nge, P.N.; Rogers, C.I.; Woolley, A.T. Advances in microfluidic materials, functions, integration, and applications. Chem. Rev. 2013, 113, 2550–2583. [Google Scholar] [CrossRef][Green Version]
- Ogończyk, D.; Węgrzyn, J.; Jankowski, P.; Dąbrowski, B.; Garstecki, P. Bonding of microfluidic devices fabricated in polycarbonate. Lab Chip 2010, 10, 1324–1327. [Google Scholar] [CrossRef]
- Duval, K.; Grover, H.; Han, L.-H.; Mou, Y.; Pegoraro, A.F.; Fredberg, J.; Chen, Z. Modeling physiological events in 2D vs. 3D cell culture. Physiology 2017, 32, 266–277. [Google Scholar] [CrossRef][Green Version]
- Jang, K.-J.; Mehr, A.P.; Hamilton, G.A.; McPartlin, L.A.; Chung, S.; Suh, K.-Y.; Ingber, D.E. Human kidney proximal tubule-on-a-chip for drug transport and nephrotoxicity assessment. Integr. Biol. 2013, 5, 1119–1129. [Google Scholar] [CrossRef]
- Vormann, M.K.; Gijzen, L.; Hutter, S.; Boot, L.; Nicolas, A.; van den Heuvel, A.; Vriend, J.; Ng, C.P.; Nieskens, T.T.G.; van Duinen, V. Nephrotoxicity and kidney transport assessment on 3D perfused proximal tubules. AAPS J. 2018, 20, 1–11. [Google Scholar] [CrossRef]
- Ferrell, N.; Desai, R.R.; Fleischman, A.J.; Roy, S.; Humes, H.D.; Fissell, W.H. A microfluidic bioreactor with integrated transepithelial electrical resistance (TEER) measurement electrodes for evaluation of renal epithelial cells. Biotechnol. Bioeng. 2010, 107, 707–716. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Srinivasan, B.; Kolli, A.R.; Esch, M.B.; Abaci, H.E.; Shuler, M.L.; Hickman, J.J. TEER measurement techniques for in vitro barrier model systems. SLAS Technol. 2015, 20, 107–126. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, J.; Skolnik, S. Permeability diagnosis model in drug discovery: A diagnostic tool to identify the most influencing properties for gastrointestinal permeability. Curr. Top. Med. Chem. 2013, 13, 1308–1316. [Google Scholar] [CrossRef] [PubMed]
- Kawanami, D.; Takashi, Y.; Tanabe, M. Significance of metformin use in diabetic kidney disease. Int. J. Mol. Sci. 2020, 21, 4239. [Google Scholar] [CrossRef]
- Stocker, S.L.; Morrissey, K.M.; Yee, S.W.; Castro, R.A.; Xu, L.; Dahlin, A.; Ramirez, A.H.; Roden, D.M.; Wilke, R.A.; McCarty, C.A. The effect of novel promoter variants in MATE1 and MATE2 on the pharmacokinetics and pharmacodynamics of metformin. Clin. Pharmacol. Ther. 2013, 93, 186–194. [Google Scholar] [CrossRef]
- Nakamichi, N.; Shima, H.; Asano, S.; Ishimoto, T.; Sugiura, T.; Matsubara, K.; Kusuhara, H.; Sugiyama, Y.; Sai, Y.; Miyamoto, K. Involvement of carnitine/organic cation transporter OCTN1/SLC22A4 in gastrointestinal absorption of metformin. J. Pharm. Sci. 2013, 102, 3407–3417. [Google Scholar] [CrossRef]
- Lang, F.; Vallon, V.; Knipper, M.; Wangemann, P. Functional significance of channels and transporters expressed in the inner ear and kidney. Am. J. Physiol. Physiol. 2007, 293, C1187–C1208. [Google Scholar] [CrossRef]
- Tzvetkov, M.V.; Vormfelde, S.V.; Balen, D.; Meineke, I.; Schmidt, T.; Sehrt, D.; Sabolić, I.; Koepsell, H.; Brockmoeller, J. The effects of genetic polymorphisms in the organic cation transporters OCT1, OCT2, and OCT3 on the renal clearance of metformin. Clin. Pharmacol. Ther. 2009, 86, 299–306. [Google Scholar] [CrossRef]
- Somogyi, A.; Stockley, C.; Keal, J.; Rolan, P.; Bochner, F. Reduction of metformin renal tubular secretion by cimetidine in man. Br. J. Clin. Pharmacol. 1987, 23, 545–551. [Google Scholar] [CrossRef][Green Version]
- Baudin, B.; Bruneel, A.; Bosselut, N.; Vaubourdolle, M. A protocol for isolation and culture of human umbilical vein endothelial cells. Nat. Protoc. 2007, 2, 481–485. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
OCT2 | GAGATAGTCTGCCTGGTCAATGC | GTAGACCAGGAATGGCGTGATG |
MATE1 | TGCTGTAGCCTTCAGTGTCCTG | GCTTCAAAGCGGTGGGAAACAGC |
MATE2K | GCCTTTGGTGCCGCTGTGAATG | AGCAGTTGCCAGGAAGACACAG |
OCTN1 | TGGACCTGTTCAGGACTCGGAA | TAGGAGCATCCAGAGACAGAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.-B.; Kim, H.; Kim, S.; Sung, G.Y. Fabrication and Evaluation of Tubule-on-a-Chip with RPTEC/HUVEC Co-Culture Using Injection-Molded Polycarbonate Chips. Micromachines 2022, 13, 1932. https://doi.org/10.3390/mi13111932
Lee J-B, Kim H, Kim S, Sung GY. Fabrication and Evaluation of Tubule-on-a-Chip with RPTEC/HUVEC Co-Culture Using Injection-Molded Polycarbonate Chips. Micromachines. 2022; 13(11):1932. https://doi.org/10.3390/mi13111932
Chicago/Turabian StyleLee, Ju-Bi, Hyoungseob Kim, Sol Kim, and Gun Yong Sung. 2022. "Fabrication and Evaluation of Tubule-on-a-Chip with RPTEC/HUVEC Co-Culture Using Injection-Molded Polycarbonate Chips" Micromachines 13, no. 11: 1932. https://doi.org/10.3390/mi13111932