Modulation of Colorectal Tumor Behavior via lncRNA TP53TG1-Lipidic Nanosystem
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation and Characterization of Sphingomyelin Nanosystems
2.3. Association of Nucleic Acids
2.4. Nanosystems Cytotoxicity Profile
2.5. Nanosystems Internalization by Colorectal Cancer Cells
2.6. HCT-116 Cells Transfection
2.7. Functional Assays
2.8. Quantitative Reverse Transcription–Polymerase Chain Reaction (qRT-PCR)
2.9. Statistical Analysis
3. Results
3.1. Preparation and Characterization of DSNs
3.2. Nanosystems Cytotoxic Profile, Internalization Capacity and Transfection Efficiency
3.3. Transfection Efficiency in HCT-116 Cells
3.4. Tumor Suppressor Effects of pc(TP53TG1)-DSNs in HCT-116 Colorectal Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sharma, S.; Kelly, T.K.; Jones, P.A. Epigenetics in cancer. Carcinogenesis 2010, 31, 27–36. [Google Scholar] [CrossRef]
- Mari-Alexandre, J.; Diaz-Lagares, A.; Villalba, M.; Juan, O.; Crujeiras, A.B.; Calvo, A.; Sandoval, J. Translating cancer epigenomics into the clinic: Focus on lung cancer. Transl. Res. 2017, 189, 76–92. [Google Scholar] [CrossRef]
- Rodriguez-Casanova, A.; Costa-Fraga, N.; Bao-Caamano, A.; López-López, R.; Muinelo-Romay, L.; Diaz-Lagares, A. Epigenetic Landscape of Liquid Biopsy in Colorectal Cancer. Front. Cell Dev. Biol. 2021, 9, 622459. [Google Scholar] [CrossRef]
- Esteller, M. Non-coding RNAs in human disease. Nat. Rev. Genet. 2011, 12, 861–874. [Google Scholar] [CrossRef]
- Hanly, D.J.; Esteller, M.; Berdasco, M. Interplay between long non-coding RNAs and epigenetic machinery: Emerging targets in cancer? Philos. Trans. R. Soc. B Biol. Sci. 2018, 373, 74. [Google Scholar] [CrossRef] [PubMed]
- Kapranov, P.; Cheng, J.; Dike, S.; Nix, D.A.; Duttagupta, R.; Willingham, A.T.; Stadler, P.F.; Hertel, J.; Hackermüller, J.; Hofacker, I.L.; et al. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 2007, 316, 1484–1488. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Goff, L.A.; Rinn, J.L. Linking RNA biology to lncRNAs. Genome Res. 2015, 25, 1456–1465. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Statello, L.; Guo, C.J.; Chen, L.L.; Huarte, M. Gene regulation by long non-coding RNAs and its biological functions. Nat. Rev. Mol. Cell Biol. 2021, 22, 96–118. [Google Scholar] [CrossRef]
- Huarte, M.; Guttman, M.; Feldser, D.; Garber, M.; Koziol, M.J.; Kenzelmann-Broz, D.; Khalil, A.M.; Zuk, O.; Amit, I.; Rabani, M.; et al. A Large Intergenic Noncoding RNA Induced by p53 Mediates Global Gene Repression in the p53 Response. Cell 2010, 142, 409–419. [Google Scholar] [CrossRef][Green Version]
- Léveillé, N.; Melo, C.A.; Rooijers, K.; Díaz-Lagares, A.; Melo, S.A.; Korkmaz, G.; Lopes, R.; Moqadam, F.A.; Maia, A.R.; Wijchers, P.J.; et al. Genome-wide profiling of p53-regulated enhancer RNAs uncovers a subset of enhancers controlled by a lncRNA. Nat. Commun. 2015, 6, 6520. [Google Scholar] [CrossRef]
- Bhan, A.; Soleimani, M.; Mandal, S.S. Long Noncoding RNA and Cancer: A New Paradigm. Cancer Res. 2017, 77, 3965–3981. [Google Scholar] [CrossRef][Green Version]
- Grossi, E.; Sánchez, Y.; Huarte, M. Expanding the p53 regulatory network: LncRNAs take up the challenge. Biochim. Biophys. Acta Gene Regul. Mech. 2016, 1859, 200–208. [Google Scholar] [CrossRef] [PubMed]
- Takei, Y.; Ishikawa, S.; Tokino, T.; Muto, T.; Nakamura, Y. Isolation of a novel TP53 target gene from a colon cancer cell line carrying a highly regulated wild-type TP53 expression system. Genes Chromosom. Cancer 1998, 23, 1–9. [Google Scholar] [CrossRef]
- Diaz-Lagares, A.; Crujeiras, A.B.; Lopez-Serra, P.; Soler, M.; Setien, F.; Goyal, A.; Sandoval, J.; Hashimoto, Y.; Martinez-Cardús, A.; Gomez, A.; et al. Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer. Proc. Natl. Acad. Sci. USA 2016, 113, E7535–E7544. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Jürchott, K.; Kuban, R.-J.; Krech, T.; Blüthgen, N.; Stein, U.; Walther, W.; Friese, C.; Kiełbasa, S.M.; Ungethüm, U.; Lund, P.; et al. Identification of Y-Box Binding Protein 1 As a Core Regulator of MEK/ERK Pathway-Dependent Gene Signatures in Colorectal Cancer Cells. PLoS Genet. 2010, 6, e1001231. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Shao, M.; Ma, H.; Wan, X.; Liu, Y. Survival analysis for long noncoding RNAs identifies TP53TG1 as an antioncogenic target for the breast cancer. J. Cell. Physiol. 2020, 235, 6574–6581. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Lan, J.; Xiao, Y.; Liu, P.; Guo, D.; Gu, Y.; Song, Y.; Zhong, Q.; Ma, D.; Lei, P.; et al. Long noncoding RNA TP53TG1 suppresses the growth and metastasis of hepatocellular carcinoma by regulating the PRDX4/β-catenin pathway. Cancer Lett. 2021, 513, 75–89. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, H.; Du, Y.; Liu, P.; Zhang, J.; Li, Y.; Shen, H.; Xing, L.; Xue, X.; Chen, J.; et al. Long noncoding RNA TP53TG1 promotes pancreatic ductal adenocarcinoma development by acting as a molecular sponge of microRNA-96. Cancer Sci. 2019, 110, 2760–2772. [Google Scholar] [CrossRef][Green Version]
- Yuan, J.; Jiang, Y.Y.; Mayakonda, A.; Huang, M.; Ding, L.W.; Lin, H.; Yu, F.; Lu, Y.; Loh, T.K.S.; Chow, M.; et al. Super-enhancers promote transcriptional dysregulation in nasopharyngeal carcinoma. Cancer Res. 2017, 77, 6614–6626. [Google Scholar] [CrossRef][Green Version]
- Xiao, H.; Liu, Y.; Liang, P.; Wang, B.; Tan, H.; Zhang, Y.; Gao, X.; Gao, J. TP53TG1 enhances cisplatin sensitivity of non-small cell lung cancer cells through regulating miR-18a/PTEN axis. Cell Biosci. 2018, 8, 23. [Google Scholar] [CrossRef]
- Wang, Y.; Miao, L.; Satterlee, A.; Huang, L. Delivery of oligonucleotides with lipid nanoparticles. Adv. Drug Deliv. Rev. 2015, 87, 68–80. [Google Scholar] [CrossRef][Green Version]
- Shi, J.; Kantoff, P.W.; Wooster, R.; Farokhzad, O.C. Cancer nanomedicine: Progress, challenges and opportunities. Nat. Rev. Cancer 2017, 17, 20–37. [Google Scholar] [CrossRef]
- Thukral, D.; Dumoga, S.; Mishra, A. Solid Lipid Nanoparticles: Promising Therapeutic Nanocarriers for Drug Delivery. Curr. Drug Deliv. 2014, 11, 771–791. [Google Scholar] [CrossRef]
- Fonseca, N.A.; Lopes, R.M.; Cruz, A.F.; Gregório, A.C.; Valério-Fernandes, Â.; Moura, V.; Simões, S.; Moreira, J.N. Lipid-Based Nanosystems for the Delivery of siRNA: Challenges and Trends. In Handbook of Nanomaterials for Cancer Theranostics; Elsevier: Amsterdam, The Netherlands, 2018; pp. 495–515. [Google Scholar]
- Yin, H.; Kanasty, R.L.; Eltoukhy, A.A.; Vegas, A.J.; Dorkin, J.R.; Anderson, D.G. Non-viral vectors for gene-based therapy. Nat. Rev. Genet. 2014, 15, 541–555. [Google Scholar] [CrossRef]
- Teixeira, H.F.; Bruxel, F.; Fraga, M.; Schuh, R.S.; Zorzi, G.K.; Matte, U.; Fattal, E. Cationic nanoemulsions as nucleic acids delivery systems. Int. J. Pharm. 2017, 534, 356–367. [Google Scholar] [CrossRef]
- Mazza, M.; Alonso-Sande, M.; Jones, M.-C.C.; de la Fuente, M. The potential of nanoemulsions in biomedicine. In Fundamentals of Pharmaceutical Nanoscience; Springer: New York, NY, USA, 2013; pp. 117–158. [Google Scholar]
- Nagachinta, S.; Bouzo, B.L.; Vazquez-Rios, A.J.; Lopez, R.; de la Fuente, M. Sphingomyelin-based nanosystems (SNs) for the development of anticancer miRNA therapeutics. Pharmaceutics 2020, 12, 189. [Google Scholar] [CrossRef][Green Version]
- Bouzo, B.L.; Calvelo, M.; Martín-Pastor, M.; García-Fandiño, R.; de la Fuente, M. In Vitro—In Silico Modeling Approach to Rationally Designed Simple and Versatile Drug Delivery Systems. J. Phys. Chem. B 2020, 124, 5788–5800. [Google Scholar] [CrossRef]
- Nagachinta, S.; Becker, G.; Dammicco, S.; Serrano, M.E.; Leroi, N.; Bahri, M.A.; Plenevaux, A.; Lemaire, C.; Lopez, R.; Luxen, A.; et al. Radiolabelling of lipid-based nanocarriers with fluorine-18 for in vivo tracking by PET. Colloids Surf. B Biointerfaces 2020, 188, 110793. [Google Scholar] [CrossRef]
- Bouzo, B.L.; Lores, S.; Jatal, R.; Alijas, S.; Alonso, M.J.; Conejos-Sánchez, I.; de la Fuente, M. Sphingomyelin nanosystems loaded with uroguanylin and etoposide for treating metastatic colorectal cancer. Sci. Rep. 2021, 11, 17213. [Google Scholar] [CrossRef] [PubMed]
- Díez-Villares, S.; Ramos-Docampo, M.A.; da Silva-Candal, A.; Hervella, P.; Vázquez-Ríos, A.J.; Dávila-Ibáñez, A.B.; López-López, R.; Iglesias-Rey, R.; Salgueiriño, V.; de la Fuente, M. Manganese Ferrite Nanoparticles Encapsulated into Vitamin E/Sphingomyelin Nanoemulsions as Contrast Agents for High-Sensitive Magnetic Resonance Imaging. Adv. Healthc. Mater. 2021, 2101019. [Google Scholar] [CrossRef]
- Ingólfsson, H.I.; Melo, M.N.; van Eerden, F.J.; Arnarez, C.; Lopez, C.A.; Wassenaar, T.A.; Periole, X.; de Vries, A.H.; Tieleman, D.P.; Marrink, S.J. Lipid Organization of the Plasma Membrane. J. Am. Chem. Soc. 2014, 136, 14554–14559. [Google Scholar] [CrossRef]
- Díez-Villares, S.; Pellico, J.; Gómez-Lado, N.; Grijalvo, S.; Alijas, S.; Eritja, R.; Herranz, F.; Aguiar, P.; de la Fuente, M. Biodistribution of 68/67Ga-Radiolabeled Sphingolipid Nanoemulsions by PET and SPECT Imaging. Int. J. Nanomed. 2021, 16, 5923–5935. [Google Scholar] [CrossRef] [PubMed]
- Reimondez-Troitiño, S.; González-Aramundiz, J.V.; Ruiz-Bañobre, J.; López-López, R.; Alonso, M.J.; Csaba, N.; de la Fuente, M. Versatile protamine nanocapsules to restore miR-145 levels and interfere tumor growth in colorectal cancer cells. Eur. J. Pharm. Biopharm. 2019, 142, 449–459. [Google Scholar] [CrossRef]
- Tai, Z.; Ma, J.; Ding, J.; Pan, H.; Chai, R.; Zhu, C.; Cui, Z.; Chen, Z.; Zhu, Q. Aptamer-Functionalized Dendrimer Delivery of Plasmid-Encoding lncRNA MEG3 Enhances Gene Therapy in Castration-Resistant Prostate Cancer. Int. J. Nanomed. 2020, 15, 10305–10320. [Google Scholar] [CrossRef] [PubMed]
- Gong, N.; Teng, X.; Li, J.; Liang, X.J. Antisense Oligonucleotide-Conjugated Nanostructure-Targeting lncRNA MALAT1 Inhibits Cancer Metastasis. ACS Appl. Mater. Interfaces 2019, 11, 37–42. [Google Scholar] [CrossRef]
- Wang, M.; Thanou, M. Targeting nanoparticles to cancer. Pharmacol. Res. 2010, 62, 90–99. [Google Scholar] [CrossRef]
- Aslan, B.; Ozpolat, B.; Sood, A.K.; Lopez-Berestein, G. Nanotechnology in cancer therapy. J. Drug Target. 2013, 21, 904–913. [Google Scholar] [CrossRef][Green Version]
- Kim, T.W.; Chung, H.; Kwon, I.C.; Sung, H.C.; Jeong, S.Y. Optimization of lipid composition in cationic emulsion as In Vitro and In Vivo transfection agents. Pharm. Res. 2001, 18, 54–60. [Google Scholar] [CrossRef]
- Bennett, C.F. Intracellular Delivery of Oligonucleotides with Cationic Liposomes. In Delivery Strategies for Antisense Oligonucleotide Therapeutics; CRC Press: Boca Raton, FL, USA, 2017; pp. 223–232. [Google Scholar]
- Bose, R.J.C.; Arai, Y.; Ahn, J.C.; Park, H.; Lee, S.H. Influence of cationic lipid concentration on properties of lipid–polymer hybrid nanospheres for gene delivery. Int. J. Nanomed. 2015, 10, 5367–5382. [Google Scholar] [CrossRef][Green Version]
- Santander-Ortega, M.J.; de la Fuente, M.; Lozano, M.V.; Tsui, M.L.; Bolton, K.; Uchegbu, I.F.; Schatzlein, A.G. Optimisation of Synthetic Vector Systems for Cancer Gene Therapy—The Role of the Excess of Cationic Dendrimer Under Physiological Conditions. Curr. Top. Med. Chem. 2014, 14, 1172–1181. [Google Scholar] [CrossRef]
- Ma, L.; Bajic, V.B.; Zhang, Z. On the classification of long non-coding RNAs. RNA Biol. 2013, 10, 924–933. [Google Scholar] [CrossRef]
- St. Laurent, G.; Wahlestedt, C.; Kapranov, P. The Landscape of long noncoding RNA classification. Trends Genet. 2015, 31, 239–251. [Google Scholar] [CrossRef][Green Version]
- Jandura, A.; Krause, H.M. The New RNA World: Growing Evidence for Long Noncoding RNA Functionality. Trends Genet. 2017, 33, 665–676. [Google Scholar] [CrossRef] [PubMed]
- Rinn, J.L.; Chang, H.Y. Genome Regulation by Long Noncoding RNAs. Annu. Rev. Biochem. 2012, 81, 145–166. [Google Scholar] [CrossRef][Green Version]
- Chen, Y.G.; Satpathy, A.T.; Chang, H.Y. Gene regulation in the immune system by long noncoding RNAs. Nat. Immunol. 2017, 18, 962–972. [Google Scholar] [CrossRef] [PubMed]
- Guttman, M.; Rinn, J.L. Modular regulatory principles of large non-coding RNAs. Nature 2012, 482, 339–346. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kim, J.; Kim, K.M.; Noh, J.H.; Yoon, J.-H.; Abdelmohsen, K.; Gorospe, M. Long noncoding RNAs in diseases of aging. Biochim. Biophys. Acta Gene Regul. Mech. 2016, 1859, 209–221. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Russell, M.R.; Penikis, A.; Oldridge, D.A.; Alvarez-Dominguez, J.R.; McDaniel, L.; Diamond, M.; Padovan, O.; Raman, P.; Li, Y.; Wei, J.S.; et al. CASC15-S is a tumor suppressor lncRNA at the 6p22 neuroblastoma susceptibility locus. Cancer Res. 2015, 75, 3155–3166. [Google Scholar] [CrossRef][Green Version]
- Liz, J.; Portela, A.; Soler, M.; Gómez, A.; Ling, H.; Michlewski, G.; Calin, G.A.; Guil, S.; Esteller, M. Regulation of pri-miRNA Processing by a Long Noncoding RNA Transcribed from an Ultraconserved Region. Mol. Cell 2014, 55, 138–147. [Google Scholar] [CrossRef][Green Version]
- Liu, L.; Yue, H.; Liu, Q.; Yuan, J.; Li, J.; Wei, G.; Chen, X.; Lu, Y.; Guo, M.; Luo, J.; et al. LncRNA MT1JP functions as a tumor suppressor by interacting with TIAR to modulate the p53 pathway. Oncotarget 2016, 7, 15787–15800. [Google Scholar] [CrossRef][Green Version]
- Liu, S.J.; Horlbeck, M.A.; Cho, S.W.; Birk, H.S.; Malatesta, M.; He, D.; Attenello, F.J.; Villalta, J.E.; Cho, M.Y.; Chen, Y.; et al. CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 2017, 355, 7111. [Google Scholar] [CrossRef][Green Version]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA. Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Wadetwar, R.N.; Godbole, A.P. Nanocarriers: A Tool for Effective Gene Delivery. Nanopharm. Adv. Deliv. Syst. 2021, 161–185. [Google Scholar] [CrossRef]
- Kulkarni, J.A.; Witzigmann, D.; Thomson, S.B.; Chen, S.; Leavitt, B.R.; Cullis, P.R.; van der Meel, R. The current landscape of nucleic acid therapeutics. Nat. Nanotechnol. 2021, 16, 630–643. [Google Scholar] [CrossRef] [PubMed]
- Dhaliwal, H.K.; Fan, Y.; Kim, J.; Amiji, M.M. Intranasal Delivery and Transfection of mRNA Therapeutics in the Brain Using Cationic Liposomes. Mol. Pharm. 2020, 17, 1996–2005. [Google Scholar] [CrossRef]
- Wang, D.; Wang, X.; Wang, L.; Zhang, J.; Ma, J.; Xia, G.; Hong, B. Antisense microRNA185 loaded liposome for efficient inhibition of the hepatic endogenous microRNA185 level. Eur. J. Pharm. Sci. 2021, 161, 105803. [Google Scholar] [CrossRef]
- Blakney, A.K.; Deletic, P.; McKay, P.F.; Bouton, C.R.; Ashford, M.; Shattock, R.J.; Sabirsh, A. Effect of complexing lipids on cellular uptake and expression of messenger RNA in human skin explants. J. Control. Release 2021, 330, 1250–1261. [Google Scholar] [CrossRef]
- Brito, L.A.; Chan, M.; Shaw, C.A.; Hekele, A.; Carsillo, T.; Schaefer, M.; Archer, J.; Seubert, A.; Otten, G.R.; Beard, C.W.; et al. A Cationic Nanoemulsion for the Delivery of Next-generation RNA Vaccines. Mol. Ther. 2014, 22, 2118–2129. [Google Scholar] [CrossRef][Green Version]
- Samsa, M.M.; Dupuy, L.C.; Beard, C.W.; Six, C.M.; Schmaljohn, C.S.; Mason, P.W.; Geall, A.J.; Ulmer, J.B.; Yu, D. Self-Amplifying RNA Vaccines for Venezuelan Equine Encephalitis Virus Induce Robust Protective Immunogenicity in Mice. Mol. Ther. 2019, 27, 850–865. [Google Scholar] [CrossRef][Green Version]
- Xiong, F.; Mi, Z.; Gu, N. Cationic liposomes as gene delivery system: Transfection efficiency and new application. Pharmazie 2011, 66, 158–164. [Google Scholar] [CrossRef]
- Xue, H.; Guo, P.; Wen, W.-C.; Wong, H. Lipid-Based Nanocarriers for RNA Delivery. Curr. Pharm. Des. 2015, 21, 3140–3147. [Google Scholar] [CrossRef] [PubMed]
- Martini, É.; Fattal, E.; de Oliveira, M.C.; Teixeira, H. Effect of cationic lipid composition on properties of oligonucleotide/emulsion complexes: Physico-chemical and release studies. Int. J. Pharm. 2008, 352, 280–286. [Google Scholar] [CrossRef] [PubMed]
- Duan, L.; Yan, Y.; Liu, J.; Wang, B.; Li, P.; Hu, Q.; Chen, W. Target delivery of small interfering RNAs with vitamin E-coupled nanoparticles for treating hepatitis C. Sci. Rep. 2016, 6, 1–12. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Caracciolo, G.; Pozzi, D.; Capriotti, A.L.; Marianecci, C.; Carafa, M.; Marchini, C.; Montani, M.; Amici, A.; Amenitsch, H.; Digman, M.A.; et al. Factors determining the superior performance of lipid/DNA/protammine nanoparticles over lipoplexes. J. Med. Chem. 2011, 54, 4160–4171. [Google Scholar] [CrossRef][Green Version]
- Colombo, S.; Cun, D.; Remaut, K.; Bunker, M.; Zhang, J.; Martin-Bertelsen, B.; Yaghmur, A.; Braeckmans, K.; Nielsen, H.M.; Foged, C. Mechanistic profiling of the siRNA delivery dynamics of lipid–polymer hybrid nanoparticles. J. Control. Release 2015, 201, 22–31. [Google Scholar] [CrossRef]
- Blakney, A.K.; McKay, P.F.; Yus, B.I.; Aldon, Y.; Shattock, R.J. Inside out: Optimization of lipid nanoparticle formulations for exterior complexation and in vivo delivery of saRNA. Gene Ther. 2019, 26, 363–372. [Google Scholar] [CrossRef]
Assay | Forward | Reverse |
---|---|---|
wild type TP53TG1 | CTTTCCTTTAATCTTCGGAGGC | TGCCAGCTCTCAGAGTCCTT |
mutated TP53TG1 | CTCGAGGCGAACACTTACTC | TCTCAGAGTCCTTCGAGGTT |
GAPDH | TCTTCCAGGAGCGAGATC | CAGAGATGATGACCCTTTTG |
Composition (DOTAP %) | Size (nm) | PdI | Zeta Pot. (mV) |
---|---|---|---|
SNs | 208 ± 2 | 0.15 | −10 ± 0 |
DSNs1% | 136 ± 1 | 0.16 | +26 ± 1 |
DSNs5% | 141 ± 2 | 0.16 | +51 ± 4 |
DSNs10% | 142 ± 2 | 0.17 | +47 ± 2 |
DSNs20% | 229 ± 2 | 0.27 | +48 ± 3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Masoumi, F.; Saraiva, S.M.; Bouzo, B.L.; López-López, R.; Esteller, M.; Díaz-Lagares, Á.; de la Fuente, M. Modulation of Colorectal Tumor Behavior via lncRNA TP53TG1-Lipidic Nanosystem. Pharmaceutics 2021, 13, 1507. https://doi.org/10.3390/pharmaceutics13091507
Masoumi F, Saraiva SM, Bouzo BL, López-López R, Esteller M, Díaz-Lagares Á, de la Fuente M. Modulation of Colorectal Tumor Behavior via lncRNA TP53TG1-Lipidic Nanosystem. Pharmaceutics. 2021; 13(9):1507. https://doi.org/10.3390/pharmaceutics13091507
Chicago/Turabian StyleMasoumi, Farimah, Sofia M. Saraiva, Belén L. Bouzo, Rafael López-López, Manel Esteller, Ángel Díaz-Lagares, and María de la Fuente. 2021. "Modulation of Colorectal Tumor Behavior via lncRNA TP53TG1-Lipidic Nanosystem" Pharmaceutics 13, no. 9: 1507. https://doi.org/10.3390/pharmaceutics13091507