Hylin-a1: A Host Defense Peptide with Antibacterial Potential against Staphylococcus aureus Multi-Resistant Strains
Abstract
:1. Introduction
2. Results and Discussion
2.1. Hylin-a1 Cytotoxicity Evaluation
2.2. Hylin-a1 Antibacterial Activity
2.2.1. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC)
2.2.2. Time-Killing Assay
2.2.3. Evaluation of the Invasion Capability
2.3. Antibiofilm Activity
2.4. FACScan Analysis
2.5. SEM Analysis
2.6. Inflammatory Response
3. Materials and Methods
3.1. Peptide Synthesis and Characterization
3.2. Cell and Bacteria Culture
3.3. Peptide Cytotoxicity
3.4. Antibacterial Activity
3.4.1. Determination of Minimum Inhibitory Concentration (MIC) and Minimal Bactericidal Concentration (MBC)
3.4.2. Time-Kill Kinetics Assay
3.4.3. Invasion Assay
3.5. Antibiofilm Activity
3.5.1. Initial Attachment Assay
3.5.2. Biofilm Inhibition Assay
3.5.3. Biofilm Degradation Assay
3.6. FACScan Analysis
3.7. Scanning Electron Microscopy (SEM)
3.8. Quantitative Real-Time PCR
3.9. Statistic Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Antibiotic Resistance; WHO: Geneva, Switzerland, 2021. [Google Scholar]
- Alvarez, A.; Fernandez, L.; Gutierrez, D.; Iglesias, B.; Rodriguez, A.; Garcia, P. Methicillin-Resistant Staphylococcus aureus in Hospitals: Latest Trends and Treatments Based on Bacteriophages. J. Clin. Microbiol. 2019, 57, e01006-19. [Google Scholar] [CrossRef] [PubMed]
- Antimicrobial Resistance, C. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef]
- Foster, T. Staphylococcus. In Medical Microbiology, 4th ed.; Baron, S., Ed.; University of Texas Medical Branch at Galveston: Galveston, TX, USA, 1996. [Google Scholar]
- Tong, S.Y.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G., Jr. Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin. Microbiol. Rev. 2015, 28, 603–661. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Cheung, G.Y.C.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef]
- Van Hal, S.J.; Jensen, S.O.; Vaska, V.L.; Espedido, B.A.; Paterson, D.L.; Gosbell, I.B. Predictors of mortality in Staphylococcus aureus Bacteremia. Clin. Microbiol. Rev. 2012, 25, 362–386. [Google Scholar] [CrossRef][Green Version]
- Gajdacs, M. The Continuing Threat of Methicillin-Resistant Staphylococcus aureus. Antibiotics 2019, 8, 52. [Google Scholar] [CrossRef][Green Version]
- Davies, J.; Davies, D. Origins and evolution of antibiotic resistance. Microbiol. Mol. Biol. Rev. 2010, 74, 417–433. [Google Scholar] [CrossRef][Green Version]
- Papanicolas, L.E.; Bell, J.M.; Bastian, I. Performance of phenotypic tests for detection of penicillinase in Staphylococcus aureus isolates from Australia. J. Clin. Microbiol. 2014, 52, 1136–1138. [Google Scholar] [CrossRef][Green Version]
- Enright, M.C.; Robinson, D.A.; Randle, G.; Feil, E.J.; Grundmann, H.; Spratt, B.G. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc. Natl. Acad. Sci. USA 2002, 99, 7687–7692. [Google Scholar] [CrossRef][Green Version]
- Egorov, A.M.; Ulyashova, M.M.; Rubtsova, M.Y. Bacterial Enzymes and Antibiotic Resistance. Acta Nat. 2018, 10, 33–48. [Google Scholar] [CrossRef][Green Version]
- Turner, N.A.; Sharma-Kuinkel, B.K.; Maskarinec, S.A.; Eichenberger, E.M.; Shah, P.P.; Carugati, M.; Holland, T.L.; Fowler, V.G., Jr. Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat. Rev. Microbiol. 2019, 17, 203–218. [Google Scholar] [CrossRef]
- Livermore, D.M. Has the era of untreatable infections arrived? J. Antimicrob. Chemother. 2009, 64 (Suppl. S1), i29–i36. [Google Scholar] [CrossRef][Green Version]
- Hawkey, P.M. The growing burden of antimicrobial resistance. J. Antimicrob. Chemother. 2008, 62 (Suppl. S1), i1–i9. [Google Scholar] [CrossRef]
- Cantisani, M.; Leone, M.; Mignogna, E.; Kampanaraki, K.; Falanga, A.; Morelli, G.; Galdiero, M.; Galdiero, S. Structure-activity relations of myxinidin, an antibacterial peptide derived from the epidermal mucus of hagfish. Antimicrob. Agents Chemother. 2013, 57, 5665–5673. [Google Scholar] [CrossRef][Green Version]
- Aslam, B.; Wang, W.; Arshad, M.I.; Khurshid, M.; Muzammil, S.; Rasool, M.H.; Nisar, M.A.; Alvi, R.F.; Aslam, M.A.; Qamar, M.U.; et al. Antibiotic resistance: A rundown of a global crisis. Infect. Drug Resist. 2018, 11, 1645–1658. [Google Scholar] [CrossRef][Green Version]
- Yeung, A.T.; Gellatly, S.L.; Hancock, R.E. Multifunctional cationic host defence peptides and their clinical applications. Cell. Mol. Life Sci. 2011, 68, 2161–2176. [Google Scholar] [CrossRef]
- Hancock, R.E.; Brown, K.L.; Mookherjee, N. Host defence peptides from invertebrates--emerging antimicrobial strategies. Immunobiology 2006, 211, 315–322. [Google Scholar] [CrossRef]
- Huan, Y.; Kong, Q.; Mou, H.; Yi, H. Antimicrobial Peptides: Classification, Design, Application and Research Progress in Multiple Fields. Front. Microbiol. 2020, 11, 582779. [Google Scholar] [CrossRef]
- Wang, G. Human antimicrobial peptides and proteins. Pharmaceuticals 2014, 7, 545–594. [Google Scholar] [CrossRef][Green Version]
- Xu, D.; Lu, W. Defensins: A Double-Edged Sword in Host Immunity. Front. Immunol. 2020, 11, 764. [Google Scholar] [CrossRef]
- Heimlich, D.R.; Harrison, A.; Mason, K.M. Host Antimicrobial Peptides in Bacterial Homeostasis and Pathogenesis of Disease. Antibiotics 2014, 3, 645–676. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Diamond, G.; Beckloff, N.; Weinberg, A.; Kisich, K.O. The roles of antimicrobial peptides in innate host defense. Curr. Pharm. Des. 2009, 15, 2377–2392. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Brogden, K.A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol. 2005, 3, 238–250. [Google Scholar] [CrossRef] [PubMed]
- Henriques, S.T.; Melo, M.N.; Castanho, M.A. Cell-penetrating peptides and antimicrobial peptides: How different are they? Biochem. J. 2006, 399, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Yeaman, M.R.; Yount, N.Y. Mechanisms of antimicrobial peptide action and resistance. Pharmacol. Rev. 2003, 55, 27–55. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Koprivnjak, T.; Peschel, A. Bacterial resistance mechanisms against host defense peptides. Cell. Mol. Life Sci. 2011, 68, 2243–2254. [Google Scholar] [CrossRef]
- Lozo, J.; Topisirovic, L.; Kojic, M. Natural bacterial isolates as an inexhaustible source of new bacteriocins. Appl. Microbiol. Biotechnol. 2021, 105, 477–492. [Google Scholar] [CrossRef]
- Simmaco, M.; Mignogna, G.; Canofeni, S.; Miele, R.; Mangoni, M.L.; Barra, D. Temporins, antimicrobial peptides from the European red frog Rana temporaria. Eur. J. Biochem. 1996, 242, 788–792. [Google Scholar] [CrossRef]
- Mangoni, M.L. Temporins, anti-infective peptides with expanding properties. Cell. Mol. Life Sci. 2006, 63, 1060–1069. [Google Scholar] [CrossRef]
- Zannella, C.; Chianese, A.; Palomba, L.; Marcocci, M.E.; Bellavita, R.; Merlino, F.; Grieco, P.; Folliero, V.; De Filippis, A.; Mangoni, M.; et al. Broad-Spectrum Antiviral Activity of the Amphibian Antimicrobial Peptide Temporin L and Its Analogs. Int. J. Mol. Sci. 2022, 23, 2060. [Google Scholar] [CrossRef]
- Mangoni, M.L.; Shai, Y. Temporins and their synergism against Gram-negative bacteria and in lipopolysaccharide detoxification. Biochim. Biophys. Acta 2009, 1788, 1610–1619. [Google Scholar] [CrossRef][Green Version]
- Merlino, F.; Carotenuto, A.; Casciaro, B.; Martora, F.; Loffredo, M.R.; Di Grazia, A.; Yousif, A.M.; Brancaccio, D.; Palomba, L.; Novellino, E.; et al. Glycine-replaced derivatives of [Pro(3),DLeu(9)]TL, a temporin L analogue: Evaluation of antimicrobial, cytotoxic and hemolytic activities. Eur. J. Med. Chem. 2017, 139, 750–761. [Google Scholar] [CrossRef]
- Castro, M.S.; Ferreira, T.C.; Cilli, E.M.; Crusca, E., Jr.; Mendes-Giannini, M.J.; Sebben, A.; Ricart, C.A.; Sousa, M.V.; Fontes, W. Hylin a1, the first cytolytic peptide isolated from the arboreal South American frog Hypsiboas albopunctatus (“spotted treefrog”). Peptides 2009, 30, 291–296. [Google Scholar] [CrossRef]
- Crusca, E., Jr.; Rezende, A.A.; Marchetto, R.; Mendes-Giannini, M.J.; Fontes, W.; Castro, M.S.; Cilli, E.M. Influence of N-terminus modifications on the biological activity, membrane interaction, and secondary structure of the antimicrobial peptide hylin-a1. Biopolymers 2011, 96, 41–48. [Google Scholar] [CrossRef]
- Park, H.J.; Kang, H.K.; Park, E.; Kim, M.K.; Park, Y. Bactericidal activities and action mechanism of the novel antimicrobial peptide Hylin a1 and its analog peptides against Acinetobacter baumannii infection. Eur. J. Pharm. Sci. 2022, 175, 106205. [Google Scholar] [CrossRef]
- Fuda, C.C.; Fisher, J.F.; Mobashery, S. Beta-lactam resistance in Staphylococcus aureus: The adaptive resistance of a plastic genome. Cell. Mol. Life Sci. 2005, 62, 2617–2633. [Google Scholar] [CrossRef]
- Peacock, S.J.; Paterson, G.K. Mechanisms of Methicillin Resistance in Staphylococcus aureus. Annu. Rev. Biochem. 2015, 84, 577–601. [Google Scholar] [CrossRef]
- Ghooi, R.B.; Thatte, S.M. Inhibition of cell wall synthesis--is this the mechanism of action of penicillins? Med. Hypotheses 1995, 44, 127–131. [Google Scholar] [CrossRef]
- Cho, H.; Uehara, T.; Bernhardt, T.G. Beta-lactam antibiotics induce a lethal malfunctioning of the bacterial cell wall synthesis machinery. Cell 2014, 159, 1300–1311. [Google Scholar] [CrossRef][Green Version]
- Santos, N.C.S.; Scodro, R.B.L.; Sampiron, E.G.; Ieque, A.L.; Carvalho, H.C.; Santos, T.D.S.; Ghiraldi Lopes, L.D.; Campanerut-Sa, P.A.Z.; Siqueira, V.L.D.; Caleffi-Ferracioli, K.R.; et al. Minimum Bactericidal Concentration Techniques in Mycobacterium tuberculosis: A Systematic Review. Microb. Drug Resist. 2020, 26, 752–765. [Google Scholar] [CrossRef]
- Parvekar, P.; Palaskar, J.; Metgud, S.; Maria, R.; Dutta, S. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of silver nanoparticles against Staphylococcus aureus. Biomater. Investig. Dent. 2020, 7, 105–109. [Google Scholar] [CrossRef] [PubMed]
- Percival, S.L.; Suleman, L.; Vuotto, C.; Donelli, G. Healthcare-associated infections, medical devices and biofilms: Risk, tolerance and control. J. Med. Microbiol. 2015, 64 Pt 4, 323–334. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bjarnsholt, T.; Ciofu, O.; Molin, S.; Givskov, M.; Hoiby, N. Applying insights from biofilm biology to drug development—Can a new approach be developed? Nat. Rev. Drug. Discov. 2013, 12, 791–808. [Google Scholar] [CrossRef] [PubMed]
- Foster, T.J. Immune evasion by staphylococci. Nat. Rev. Microbiol. 2005, 3, 948–958. [Google Scholar] [CrossRef] [PubMed]
- Tajima, A.; Seki, K.; Shinji, H.; Masuda, S. Inhibition of interleukin-8 production in human endothelial cells by Staphylococcus aureus supernatant. Clin. Exp. Immunol. 2007, 147, 148–154. [Google Scholar] [CrossRef]
- Soe, Y.M.; Bedoui, S.; Stinear, T.P.; Hachani, A. Intracellular Staphylococcus aureus and host cell death pathways. Cell. Microbiol. 2021, 23, e13317. [Google Scholar] [CrossRef]
- Huber, A.R.; Kunkel, S.L.; Todd, R.F., 3rd; Weiss, S.J. Regulation of transendothelial neutrophil migration by endogenous interleukin-8. Science 1991, 254, 99–102. [Google Scholar] [CrossRef]
- Van der Poll, T.; Keogh, C.V.; Guirao, X.; Buurman, W.A.; Kopf, M.; Lowry, S.F. Interleukin-6 gene-deficient mice show impaired defense against pneumococcal pneumonia. J. Infect. Dis. 1997, 176, 439–444. [Google Scholar] [CrossRef]
- Caporale, A.; Doti, N.; Monti, A.; Sandomenico, A.; Ruvo, M. Automatic procedures for the synthesis of difficult peptides using oxyma as activating reagent: A comparative study on the use of bases and on different deprotection and agitation conditions. Peptides 2018, 102, 38–46. [Google Scholar] [CrossRef]
- Chianese, A.; Zannella, C.; Monti, A.; De Filippis, A.; Doti, N.; Franci, G.; Galdiero, M. The Broad-Spectrum Antiviral Potential of the Amphibian Peptide AR-23. Int. J. Mol. Sci. 2022, 23, 883. [Google Scholar] [CrossRef]
- Mulvey, M.A.; Schilling, J.D.; Hultgren, S.J. Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection. Infect. Immun. 2001, 69, 4572–4579. [Google Scholar] [CrossRef][Green Version]
- Schilling, J.D.; Mulvey, M.A.; Vincent, C.D.; Lorenz, R.G.; Hultgren, S.J. Bacterial invasion augments epithelial cytokine responses to Escherichia coli through a lipopolysaccharide-dependent mechanism. J. Immunol. 2001, 166, 1148–1155. [Google Scholar] [CrossRef][Green Version]
- Lv, Y.; Wang, J.; Gao, H.; Wang, Z.; Dong, N.; Ma, Q.; Shan, A. Antimicrobial properties and membrane-active mechanism of a potential alpha-helical antimicrobial derived from cathelicidin PMAP-36. PLoS ONE 2014, 9, e86364. [Google Scholar] [CrossRef][Green Version]
Bacteria | MIC (μM) | MBC (μM) |
---|---|---|
S.aureus ATCC 6538 | 6.25 | 6.25 |
Multi-sensitive S.aureus | 6.25 | - |
Macrolide-resistant S.aureus | 6.25 | - |
Methicillin-resistant S.aureus | 3.125 | - |
Quinolone-resistant S.aureus | 6.25 | - |
β-lactamase resistant S.aureus | 3.125 | - |
Name | Median Fluorescence |
---|---|
S. aureus ATCC 6538 | 61 |
Hylin-a1 (1/2 MIC) | 64 |
Hylin-a1 (2 MIC) | 192 |
Hylin-a1 (MIC) | 166 |
Vancomycin | 181 |
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
IL-1β | GCATCCAGCTACGAATCTCC | CCAACATTCAGCACAGGACTC |
IL-6 | AATAACCACCCCTGACCCAAC | ACATTTGCCGAAGAGCCCT |
IL-8 | AAACCACCGGAAGGAACCAT | CCTTCACACAGAGCTGCAGAAA |
GAPDH | CCTTTCATTGAGCTCCAT | CGTACATGGGAGCGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chianese, A.; Zannella, C.; Foglia, F.; Nastri, B.M.; Monti, A.; Doti, N.; Franci, G.; De Filippis, A.; Galdiero, M. Hylin-a1: A Host Defense Peptide with Antibacterial Potential against Staphylococcus aureus Multi-Resistant Strains. Pharmaceuticals 2023, 16, 509. https://doi.org/10.3390/ph16040509
Chianese A, Zannella C, Foglia F, Nastri BM, Monti A, Doti N, Franci G, De Filippis A, Galdiero M. Hylin-a1: A Host Defense Peptide with Antibacterial Potential against Staphylococcus aureus Multi-Resistant Strains. Pharmaceuticals. 2023; 16(4):509. https://doi.org/10.3390/ph16040509
Chicago/Turabian StyleChianese, Annalisa, Carla Zannella, Francesco Foglia, Bianca Maria Nastri, Alessandra Monti, Nunzianna Doti, Gianluigi Franci, Anna De Filippis, and Massimiliano Galdiero. 2023. "Hylin-a1: A Host Defense Peptide with Antibacterial Potential against Staphylococcus aureus Multi-Resistant Strains" Pharmaceuticals 16, no. 4: 509. https://doi.org/10.3390/ph16040509