Next Article in Journal
IL-10 Promotes CXCL13 Expression in Macrophages Following Foot-and-Mouth Disease Virus Infection
Next Article in Special Issue
Interaction between Cigarette Smoke and Human Papillomavirus 16 E6/E7 Oncoproteins to Induce SOD2 Expression and DNA Damage in Head and Neck Cancer
Previous Article in Journal
Glia-Neurotrophic Factor Relationships: Possible Role in Pathobiology of Neuroinflammation-Related Brain Disorders
Previous Article in Special Issue
Cholesterol Is a Regulator of CAV1 Localization and Cell Migration in Oral Squamous Cell Carcinoma
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 24
Issue 7
10.3390/ijms24076320
ijms-logo
Submit to this Journal Review for this Journal Edit a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma

by
Karolina Gołąbek
1,*,
Dorota Hudy
1,
Agata Świętek
1,2,
Jadwiga Gaździcka
1,
Natalia Dąbrowska
3,
Katarzyna Miśkiewicz-Orczyk
4,
Natalia Zięba
4,
Maciej Misiołek
4 and
Joanna Katarzyna Strzelczyk
1
1
Department of Medical and Molecular Biology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice, 19 Jordana St., 41-808 Zabrze, Poland
2
Silesia LabMed Research and Implementation Center, Medical University of Silesia in Katowice, 19 Jordana St., 41-808 Zabrze, Poland
3
Strathclyde Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, 161 Cathedral Street, Glasgow G4 0RE, UK
4
Department of Otorhinolaryngology and Oncological Laryngology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice, 10 C Skłodowska St., 41-800 Zabrze, Poland
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2023, 24(7), 6320; https://doi.org/10.3390/ijms24076320
Received: 13 March 2023 / Revised: 26 March 2023 / Accepted: 27 March 2023 / Published: 28 March 2023
(This article belongs to the Special Issue Pathogenesis and Therapy of Oral Carcinogenesis)
Browse Figures
Review Reports Versions Notes

Abstract

:
It is known that E2F2 (E2F transcription factor 2) plays an important role as controller in the cell cycle. This study aimed to analyse the expression of the E2F2 gene and E2F2 protein and demonstrate E2F2 target microRNAs (miRNAs) candidates (miR-125b-5p, miR-155-3p, and miR-214-5p) in oral squamous cell carcinoma tumour and margin samples. The study group consisted 50 patients. The E2F2 gene and miRNAs expression levels were assessed by qPCR, while the E2F2 protein was assessed by ELISA. When analysing the effect of miRNAs expression on E2F2 gene expression and E2F2 protein level, we observed no statistically significant correlations. miR-125b-5p was downregulated, while miR-155-3p, and miR-214-5p were upregulated in tumour samples compared to margin. We observed a difference between the miR-125b-5p expression level in smokers and non-smokers in margin samples. Furthermore, HPV-positive individuals had a significantly higher miR-125b-5p and miR-214-5p expression level compared to HPV-negative patients in tumour samples. The study result showed that the E2F2 gene is not the target for analysed miRNAs in OSCC. Moreover, miR-155-3p and miR-125b-5p could play roles in the pathogenesis of OSCC. A differential expression of the analysed miRNAs was observed in response to tobacco smoke and HPV status.

1. Introduction

Oral squamous cell carcinoma (OSCC) is considered one of the most common cancers in the head and neck squamous cell carcinoma (HNSCC) region. More than 300,000 new cases were reported worldwide in 2020 according to GLOBOCAN 2020 analysis [1]. It is also worth adding that this type of cancer is characterized by a 5 year survival rate ranging only from 45 to 50% [2,3]. It is believed that 80% of squamous cell carcinoma cases are due to alcohol consumption and smoking as risk factors [4,5]. However, the genetic background of this cancer type seems still insufficiently understood. Therefore, it seems reasonable to search for new biomarkers for an improved diagnosis and prognosis of the disease.
The E2F family of transcription factors includes eight proteins (E2F1–E2F8). These factors play an important role in cell proliferation and cell-cycle progression, regulate autophagy, mitochondrial functions, and the DNA damage response [6,7]. Pocket proteins, such as hypophosphorylated retinoblastoma protein Rb, and related proteins p107 and p130 can critically control E2F activity [6]. Changes in the E2F gene expression were analysed in several types of cancer—breast cancer, gastric cancer, liver cancer, and non-small-cell lung cancer [6,8,9,10,11]. The higher E2F2 expression levels were significantly associated with poor prognosis in patients with non-small-cell lung cancer [6,8].
MicroRNAs (miRNAs) are a class of small, non-coding RNAs with about 18–22 nucleotides. The action mechanism of miRNA is based on binding to the 3′-UTR of mRNAs and silencing them [12,13]. These types of RNA are involved in the post-transcriptional regulation of approximately 60% of human genes [14]. miRNAs play an important role in modulating processes such as embryogenesis, cellular development, cell proliferation, cell metabolism, and homeostasis [13]. The importance of miRNAs in cancer biology was first demonstrated by Calin et al. [15] in a study to determine frequent deletions and downregulation of miR15 and miR16 in chronic lymphocytic leukaemia [15]. Currently, many studies on miRNAs focus on how these molecules affect gene expression in carcinogenesis. miRNAs are tissue-specific and may be seen as oncogenic (OncomiRs) when involved in the repression of tumour suppressor gene expression. In addition, miRNAs as tumour suppressors (oncosuppressor miRs) can also participate in the downregulation of oncogenes [16,17]. Some studies examine the role of miRNA in various cancers, such as pancreatic [18], colon [19], prostate [20,21], renal [22], bladder [23], breast [24], cervical [25], ovarian [26], lung [27], and HNSCC [28]. To date, analyses of the role of miRNAs in HNSCC pathogenesis are focused generally on studies of miRNAs, such as miR-375, miR-1234, miR-103, miR-638, miR-200b-3p, miR-191-5p, miR-24-3p, miR-572, miR-483-5p, miR-20a, miR-22, miR-29a, miR-29b, mir-let-7c, miR-17, miR-374b-5p, miR-425-5p, miR-122, miR-134, miR-184, miR 191, miR-412, miR-512, miR-8392, miR-21, miR-31, miR-155, miR-196a, miR-196b, miR-9, miR-29c, miR-223, miR-187, Let-7a, miR- 27, miR-34, miR-92, miR-124, miR-125a, miR-136, miR-139, miR-145, miR-146a, miR-200, miR-195, and miR-205 [29,30,31,32,33].
This study aimed to analyse the expression of the E2F2 gene and E2F2 protein and demonstrate E2F2 target miRNA candidates (miR-125b-5p, miR-155-3p, and miR-214-5p) in oral squamous cell carcinoma tumour and margin samples.

2. Results

2.1. Patient Sociodemographic and Clinical Characteristics

In the patient cohort group, the median age was 62.5 years (range: 27–87 years). There were 38 (76%) men and 12 (24%) women; 27 (54%) reported alcohol consumption; 28 (56%) patients who were smokers; and 17 (34%) who were both smokers and alcohol users. HPV 16 DNA was found in 13 of 50 samples (26%). The 3 year survival rate for all patients was approximately 24%. Clinical parameters of the OSCC group are shown in Table 1.

2.2. E2F2 Gene Expression and E2F2 Protein Expression in Tumour Samples Compared to Margin Samples

We found no statistically significant differences in the E2F2 expression gene level and E2F2 protein level in tumour samples compared to margin samples. The median E2F2 relative gene expression in the tumour was 0.263 (0.145–0.578) and 0.47 (0.051–0.784) in the margin. While the median E2F2 protein level in the tumour was 0.129 ng/µg (0.051–0.238) and 0.082 ng/µg (0.047–0.282) in the margin (Figure 1). We also showed no effect of gene expression on protein expression in the examined tissues.

2.3. miR-125b-5p, miR-155-3p, and miR-214-5p Expression in Tumour Samples Compared to Margin Samples

Analysis of the relative expression levels of the tested miRNAs demonstrated statistically significant levels for only one (miR-155-3p) of the tested miRNAs when comparing tumour versus margin samples. The tests showed that miR-125b-5p (p-value = 0.235) was downregulated, while miR-155-3p (p-value = 0.013), and miR-214-5p (p-value = 0.368) were upregulated in tumour samples compared to the margin samples (Figure 2).

2.4. Correlation of E2F2 Gene Expression and E2F2 Protein Concentration with miRNAs Expression

When analysing the effect of miRNAs expression on E2F2 gene expression and E2PF2 protein level, we observed no statistically significant difference in the tumour samples. We showed a similar observation in margin samples. Figure 3 presents the correlation between the expressions of E2F2 gene, E2F2 protein, and the tested miRNAs in tumour and margin samples.

2.5. Correlations between E2F2 Gene Expression and Sociodemographic and Clinicopathological Features

No association was found between the E2F2 gene expression levels, age, gender, smoking, alcohol consumption, HPV status and clinical parameters (N and G) in tumour and margin samples, except T parameter. The patients with T1 had a significantly higher gene expression level of E2F2 than patients with T2 (0.581 vs. 0.237; p-value = 0.019) and T3 (0.581 vs. 0.145; p-value = 0.004) in tumour samples. Furthermore, we noticed that high E2F2 gene expression levels in the margin could contribute to a lower 3 year survival rate (p-value = 0.026).

2.6. Correlations between E2F2 Protein Expression and Sociodemographic and Clinicopathological Features

No association was found between the E2F2 protein expression levels, age, gender, smoking, alcohol consumption, and clinical parameters (T and G) in tumour and margin samples, except N parameter. The patients with N0 had a significantly lower protein level of E2F2 than patients with N3 (0.125 vs. 0.581; p-value = 0.022) in tumour samples. At the same time, protein expression was lower in HPV-positive individuals compared to HPV-negative patients (0.035 vs. 0.164; p-value = 0.002) in tumour samples (Figure 4).

2.7. Correlation of miRNAs Expression Level with Sociodemographic and Clinicopathological Variables

We also assessed the correlation of the expression levels of selected miRNAs with demographics and clinical characteristics of the patients. When analysing the effect of smoking on miRNAs expression, we observed a statistically significant difference between the miR-125b-5p expression level in smokers and non-smokers (0.568 vs. 2.194; p-value = 0.009) in margin samples. In addition, the patients with G2 had a significantly lower miR-125b-5p expression level than patients with G3 (0.507 vs. 0.992, p-value = 0.008) in tumour samples. Furthermore, HPV-positive individuals had significantly higher miR-125b-5p and miR-214-5p expression levels in tumour samples compared to HPV-negative patients (2.629 vs. 0.627; p-value = 0.035 and 7.942 vs 1.684; p-value = 0.039, respectively). Figure 5, Figure 6 and Figure 7 present the expressions of the tested miRNAs in HPV-positive compared to HPV-negative patients.

3. Discussion

It is known that E2F2 plays an important role as a controller in the cell cycle [6]. Our study demonstrated no statistically significant differences in the E2F2 expression gene level and the E2F2 protein level in tumour samples compared to margin samples. Still, we found a higher expression of E2F2 gene in the margin samples, while E2F2 protein level was higher in the tumour specimens. Furthermore, we noticed that the tumour progression could be associated with a decrease in gene expression. High E2F2 gene expression levels in the margin could contribute to a lower 3 year survival rate. Moreover, the patients with N0 had a significantly lower protein expression level of E2F2 than patients with N3 in tumour samples. At the same time, protein concentration was lower in HPV-positive individuals compared to HPV-negative patients in tumour samples. Perhaps these results are related to the ambiguous role of E2F2 as a transcription factor in cell cycle regulation. This protein can act as both a promoter of cell division and a suppressor. Furthermore, changes in gene expression profile in normal samples could be explained by Slaughter’s model of “field cancerization”. According to this idea, in the samples of the margin without a trace of the tumour, cells genetically altered by the action of carcinogens could be present [34,35]. It is also noteworthy that E7 is a well-known HPV oncogene that plays a critical role in cellular growth control pathways. E7 targets the retinoblastoma protein Rb of tumour suppressor for proteasome-mediated degradation, and this protein can critically control the E2F family of transcription factors activity [6,36].
For many years, there has been interest in research with regard to the use of miRNAs as potential diagnostic and prognostic biomarkers in many types of cancers. Based on several studies, it can be assumed that miRNAs (for example microRNA-let-7a, miR-125b, miR-146b-3p, miR-638, miR-31, miR-218, miR-454-3p and miRNA-936) could play an important role in targeting E2F2 expression. The analyses concerned with types of cancer, such as breast cancer, ovarian cancer, colon cancer, gastric cancer, prostate cancer, hepatocellular carcinoma, non-small cell lung cancer cell, glioma, and laryngeal cancer, suggested that miRNAs, by targeting E2F2, could be involved in cancer progression, overall survival of patients, and response to radiochemotherapy [37,38,39,40,41,42,43,44,45,46]. Moreover, circ_RPPH1/miR-146b-3p/E2F2 axis could promote the progression of breast cancer and circCUL2/miR-214-5p/E2F2 axis-suppressed retinoblastoma cells [46,47]. When analysing the effect of miRNAs expression on E2F2 gene expression and E2F2 protein concentration, we observed no statistically significant differences in the OSCC tumour samples. However, we showed a similar observation in margin samples.
The miR-125 family is highly conserved and composed of a few homologs (e.g., miR-125a-3p, miR-125a-5p, miR-125b-1 and miR-125b-2) [48]. Some studies showed miR-125b could be downregulated in many types of tumours. Decreased miRNA expression was found in carcinomas of bladder [49], breast [50,51], liver [52,53], ovary [54,55], as well as Ewing’s sarcoma [56]. Upregulation of miR-125b is also known to reverse the effects of drug resistance in ovarian cancer cells and nasopharyngeal carcinoma cells [57,58]. In this work, we demonstrated that miR-125b-5p was downregulated in tumour samples but not at statistically significant levels. However, it is noteworthy that the patients with G2 had a significantly lower miR-125b-5p expression level than patients with G3 in tumour samples. This result confirms previous analyses. The study by Shiiba [59] and others has shown a downregulated expression of miR-125b in OSCC-derived cell lines and OSCC samples. Furthermore, forced expression of miR-125b has been observed to enhance radiosensitivity in OSCC cells. Moreover, miR-125b expression is correlated with OSCC tumour staging and survival [59]. Our tests showed a statistically significant difference between the miR-125b-5p expression level in smokers and non-smokers in margin samples. The Doukas et al. [60] analysis demonstrated that tobacco could play a role in miRNA expression modification in HNSCC. The tobacco-specific nitrosamine—NNK (4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone) has been identified as an important inducing factor in the upregulation of miR-21 and miR-155 and in the downregulation of miR-422 [60]. Perhaps miR-125b-5p expression is also regulated by NNK. Furthermore, HPV-positive individuals had a significantly higher miR-125b-5p expression level in tumour samples compared to HPV-negative patients. Our observation thus confirms the result of another study. The analysis of miRNA expression in cells transfected with HPV 11, 16, and 45 showed that this virus could be a modifier of miRNAs expression. It is noteworthy that the most upregulated miRNA is miR-125a-5p in cancers such as head and neck and gastric cancer [61].
The miR-155 host gene (MIR155HG) produces two different miRNA strands: miR155-5p and miR-155-3p [62]. In our study, we showed a statistically significant increased expression of miR-155-3p in tumour samples compared to margin samples. Several studies reported higher miR-155-5p expression in OSCC tumour samples [63,64,65]. Furthermore, miR-155-5p overexpression was associated with ESCC (oesophageal squamous cell carcinoma) tumour aggressiveness [66] and lymph node metastases and relapse OSCC [64,65]. It is worth adding that a meta-analysis based on eight studies including 709 HNSCC patients (279 presenting OSCC) showed that the OSSC subgroup had a worsening survival for patients with a high expression of miR-155-5p in tumour samples [33].
In our study, the last of the miRNAs analysed was miR-214-5p. miR-214-5p is known as a tumour-suppressive miRNA that plays a role in the pathogenesis of cancers such as osteosarcoma [67], hepatocellular carcinoma [68], and pancreatic cancer [69]. It is also noteworthy that miR-214-5p was upregulated in the tongue squamous cell carcinoma cisplatin-resistant subline [70]. Yao and others [71] demonstrated that miR-214-5p expression had a negative correlation with E2F2 expression in pancreatic cancer tissue samples [71]. Our study showed no association between miR-214-5p level and E2F2 expression, but HPV-positive individuals had a significantly higher miR-214-5p expression compared to HPV-negative patients in tumour samples. However, the role of miR-214-5p in HPV replication has not been reported. Interestingly, Patil et al.’s [72] study indicated that miR-214-5p regulates viral replications of hepatitis E virus [72].
In summary, one of the main limitations of this study is the small sample size. In addition, our results should be confirmed in studies using OSCC cell lines.

4. Materials and Methods

4.1. Patient and Samples

In total, 50 paired tumour and matching margin specimens were collected from patients with OSCC. The tissues were obtained following surgical resection at the Department of Otorhinolaryngology and Oncological Laryngology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice. Tumour staging was based on the American Joint Committee on Cancer (AJCC, version 2007) [73,74] and the WHO Classification of Head and Neck Tumours [75]. The normal tissues (margins) were checked and classified as cancer-free by pathologists. The main inclusion criteria were: written informed consent to participate in the study, age over 18 years, no metabolic diseases (e.g., diabetes, hypertension) or no chronic inflammatory diseases, a diagnosis of primary tumours, and no history of preoperative radio- or chemotherapy. All laboratory analyses were performed at the Department of Medical and Molecular Biology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice. The samples were transported to the Department on ice. The study was approved by the Bioethics Committee of the Medical University of Silesia (approval no. KNW/022/KB1/49/16 and no. KNW/002/KB1/49/II/16/17).

4.2. RNA and miRNAs Extraction and Quantification

The methodology for the extraction was presented in a previous study [76]. All tissue samples were homogenized with FastPrep®-24 homogenizer (MP Biomedicals, Solon, CA, USA) with ceramic beads Lysing Matrix D (MP Biomedicals, Solon, CA, USA). The RNA and miRNAs were extracted using the RNA isolation kit (catalog number RIK 001, BioVendor, Brno, Czech Republic) to the standard instruction. The concentration and purity of the isolated RNA was determined using spectrophotometry in NanoPhotometer Pearl UV/Vis Spectrophotometer (Implen, Munich, Germany) [76].

4.3. Selection of Candidate MicroRNAs to E2F2 Target

The target miRNAs of the E2F2 gene were predicted by miRCode (version 11) [77], miRDB (version 6.0) [78], and TargetScan (version 7.2) [79] online databases.

4.4. Complementary DNA (cDNA) Synthesis

The methodology for the cDNA synthesis was presented in a previous study [76]. Total RNA (5 ng) was reverse-transcribed into cDNA using a high capacity cDNA reverse transcription kit with RNase inhibitor (Applied Biosystems, Foster City, CA, USA) according to manufacturer’s protocol. The compound mix was prepared in a 20 μL volume containing: 2 μL of 10× Buffer RT; 0.8 μL of 25× dNTP mix (100 mM); 2 μL of 10× RT random primers; 1 μL of MultiScribe® reverse transcriptase; 1 μL of RNase inhibitor; 3.2 μL of nuclease-free H2O; and 10 μL of previously isolated RNA. The reaction was processed in Mastercycler personal (Eppendorf, Hamburg, Germany) with the following thermal profile: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min, and 4 °C–∞ [76].
Furthermore, the obtained RNA (5 ng) was reverse-transcribed using TaqMan® Advanced miRNA cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA) according to manufacturers’ protocol. The whole procedure consisted four reactions with different profiles, which are presented in Table 2. The reactions were prepared in Mastercycler personal (Eppendorf, Hamburg, Germany).

4.5. E2F2 Gene and miRNAs Expression Analysis

The methodology for the E2F2 gene expression analysis was presented in a previous study [35]. The relative gene expression (RQ) analysis was performed by Real-Time PCR (qPCR) using TaqMan® gene expression assays, QuantStudio 5 Real-Time PCR System, and Analysis Software v1.5.1 (Applied Biosystems, Foster City, CA, USA). The kit was supplied with primers and fluorescently marked molecular probes. The glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) was used as an endogenous control. Five surgical margin samples were used as a calibrator. The comparative threshold cycle (Ct) method 2−∆∆Ct was used to determine the RQ. The qPCR was performed in a volume of 20 µL using 1 µL of cDNA, 10 µL of TaqMan® fast advanced master mix (Applied Biosystems, Foster City, CA, USA), 1 µL of TaqMan® gene expression assays (Assay ID: Hs00914334_m1 for E2F2, and Assay ID: Hs03929097_g1 for GAPDH), and 8 µL of nuclease-free H2O (EURx, Gdańsk, Poland). Thermal cycle for all analysed genes was: 95 °C for 20 s, followed by 40 cycles of 95 °C for 1 s, and 60 °C for 20 s [76].
The relative expression (RQ) of miR-125b-5p, miR-155-3p, and miR-214-5p were assessed based on the guidelines by the TaqMan® advanced miRNA assays (Applied Biosystems, Foster City, CA, USA). The kit was supplied with primers and fluorescently marked molecular probes. All reactions were performed in QuantStudio 5 Real-Time PCR System and Analysis Software v1.5.1 (Applied Biosystems, Foster City, CA, USA). The housekeeping miR-361-5p was used for normalizing the expression. Five surgical margin samples were used as a calibrator. RQ was calculated using 2−∆∆Ct after normalization with the reference miRNA. The qPCR was performed in a volume of 20 µL using 5 µL of cDNA (1:10 dilution), 10 µL of TaqMan® fast advanced master mix (Applied Biosystems, Foster City, CA, USA) and 1 µL of TaqMan® advanced miRNA assay (assay ID: 477885_mir for miR-125b-5p, assay ID: 477926_mir for miR-155-3p, assay ID: 478768_mir for miR-214-5p, and assay ID: 478056_mir for miR-361-5p). Thermal cycle for all analysed miRNAs was: 95 °C for 20 s, followed by 40 cycles of 95 °C for 1 s, and 60 °C for 20 s. Table 3 presents the sequence of the tested miRNAs.

4.6. E2F2 and Total Protein Concentration Determinations

The tumour and margin tissue samples were homogenized with a homogenizer Bio-Gen PRO200 (PRO Scientific Inc., Oxford, CT, USA) at a speed 10,000 RPM (5 times 1 min at 2 min intervals) in nine volumes of cold PBS (EURx, Gdańsk, Poland). Then, the suspensions were sonicated with the ultrasonic processor UP100H (Hilscher, Teltow, Germany).
Enzyme-linked immunosorbent assay (ELISA) technique was used to evaluate E2F2 protein concentrations in tissue homogenates. Enzyme-linked immunosorbent assay kit (Assay ID: SEJ182Hu, Cloud-Clone Corp., Houston, TX, USA) was used for the tests according to the manufacturer’s instructions. Absorbance was recorded at 450 nm wavelength and calibrated according to the standard curve in Synergy H1 microplate reader (BioTek, Winooski, VT, USA) and results were calculated with Gen5 2.06 software (BioTek, Winooski, VT, USA). The sensitivity of this assay was 0.059 ng/mL. Precision-measured as the coefficient of variation was <10% (intra-assay) and <12% (inter-assay).
The quantified total protein was performed using AccuOrange™ protein quantitation kit (Biotium, Fremont, CA, USA) according to the standard instructions. The samples were assayed in a 100-fold dilution. The detection range of the assay was 0.1–15 µg/mL protein. The fluorescence was measured with excitation/emission at 480/598 nm (SYNERGY H1 microplate reader; BIOTEK, Winooski, VT, USA). The E2F2 protein concentrations for each sample were normalized to the total amount of protein in the tissue lysates. Values were expressed in ng/µg protein.

4.7. HPV 16 Detection

DNA was extracted from tissue samples using a gene matrix tissue DNA purification kit (EURx, Gdansk, Poland) according to the manufacturer’s instructions. The concentration and purity of the isolated DNA was prepared using spectrophotometry in NanoPhotometer Pearl UV/Vis Spectrophotometer (Implen, Munich, Germany). HPV was detected using AmpliSens® HPV 16/18-FRT PCR kit (InterLabService, Moscow, Russia) according to manufacturers’ protocol. The PCR was performed in a volume of 25 µL using 7 µL of PCR-mix-1-FEP/FRT HPV; 8 µL mixture of PCR-buffer-FRT, TaqF polymerase, and 10 µL of DNA. The amplification program was as follows: 95 °C for 20 s, followed by 45 cycles of 95 °C for 20 s, and 60 °C for 1 min. All PCR reactions were performed using in QuantStudio 5 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).

4.8. Statistical Analyses

The Shapiro–Wilk test evaluated the distribution of variables. The median with inter-quartile range (25–75%) was used to describe miRNAs expression, E2F2 gene expression, and E2F2 protein concentration. The Mann–Whitney U test was used to compare the sociodemographic and clinical characteristics, miRNAs, E2F2 gene, and E2F2 protein level. Correlations between miRNAs, E2F2 gene, and E2F2 protein concentration were calculated using Spearman’s rank correlation analysis. The level of statistical significance was set at 0.05. The statistical software STATISTICA version 13 (TIBCO Software Inc., Palo Alto, CA, USA) was used to perform all the analyses.

5. Conclusions

The study result showed that the E2F2 gene is not the target for analysing miRNAs in OSCC. Moreover, miR-155-3p and miR-125b-5p could play roles in the pathogenesis of OSCC. A differential expression of the analysed miRNAs in response to tobacco smoke and HPV status was observed.

Author Contributions

Conceptualization, K.G.; methodology, K.G.; collection of samples, K.M.-O. and N.Z.; RNA extraction, cDNA synthesis, gene and miRNAs expression analyses, K.G.; protein level analyses and HPV detection, A.Ś., K.G. and J.G.; data analysis and interpretation, K.G., D.H. and N.D.; writing—original draft preparation, K.G.; supervision, M.M. and J.K.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded from the grant by the Medical University of Silesia (PCN-1-025/N/1/O).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Bioethics Committee of the Medical University of Silesia (approval no. KNW/022/KB1/49/16 and no. KNW/002/KB1/49/II/16/17).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Acknowledgments

We would like to thank Krzysztof Biernacki, for help with HPV detection.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

References

  1. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
  2. Golusinski, P.; Di Maio, P.; Pehlivan, B.; Colley, S.; Nankivell, P.; Kong, A.; Hartley, A.; Mehanna, H. Evidence for the approach to the diagnostic evaluation of squamous cell carcinoma occult primary tumors of the head and neck. Oral Oncol. 2019, 88, 145–152. [Google Scholar] [CrossRef]
  3. Aghiorghiesei, O.; Zanoaga, O.; Raduly, L.; Aghiorghiesei, A.I.; Chiroi, P.; Trif, A.; Buiga, R.; Budisan, L.; Lucaciu, O.; Pop, L.A.; et al. Dysregulation of miR-21-5p, miR-93-5p, miR-200c-3p and miR-205-5p in Oral Squamous Cell Carcinoma: A Potential Biomarkers Panel? Curr. Issues Mol. Biol. 2022, 44, 1754–1767. [Google Scholar] [CrossRef]
  4. Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef][Green Version]
  5. Dioguardi, M.; Caloro, G.A.; Laino, L.; Alovisi, M.; Sovereto, D.; Crincoli, V.; Aiuto, R.; Coccia, E.; Troiano, G.; Lo Muzio, L. Circulating miR-21 as a Potential Biomarker for the Diagnosis of Oral Cancer: A Systematic Review with Meta-Analysis. Cancers 2020, 12, 936. [Google Scholar] [CrossRef][Green Version]
  6. Emmrich, S.; Pützer, B.M. Checks and balances: E2F-microRNA crosstalk in cancer control. Cell Cycle 2010, 9, 2555–2567. [Google Scholar] [CrossRef]
  7. Wang, H.; Wang, X.; Xu, L.; Zhang, J.; Cao, H. Integrated analysis of the E2F transcription factors across cancer types. Oncol. Rep. 2020, 43, 1133–1146. [Google Scholar] [CrossRef][Green Version]
  8. Gao, Z.; Shi, R.; Yuan, K.; Wang, Y. Expression and prognostic value of E2F activators in NSCLC and subtypes: A research based on bioinformatics analysis. Tumour Biol. 2016, 37, 14979–14987. [Google Scholar] [CrossRef]
  9. Li, Y.; Huang, J.; Yang, D.; Xiang, S.; Sun, J.; Li, H.; Ren, G. Expression patterns of E2F transcription factors and their potential prognostic roles in breast cancer. Oncol. Lett. 2018, 15, 9216–9230. [Google Scholar] [CrossRef][Green Version]
  10. Manicum, T.; Ni, F.; Ye, Y.; Fan, X.; Chen, B.C. Prognostic values of E2F mRNA expression in human gastric cancer. Biosci. Rep. 2018, 38, BSR20181264. [Google Scholar] [CrossRef][Green Version]
  11. Huang, Y.L.; Ning, G.; Chen, L.B.; Lian, Y.F.; Gu, Y.R.; Wang, J.L.; Chen, D.M.; Wei, H.; Huang, Y.H. Promising diagnostic and prognostic value of E2Fs in human hepatocellular carcinoma. Cancer Manag. Res. 2019, 11, 1725–1740. [Google Scholar] [CrossRef][Green Version]
  12. Kabzinski, J.; Maczynska, M.; Majsterek, I. MicroRNA as a Novel Biomarker in the Diagnosis of Head and Neck Cancer. Biomolecules 2021, 11, 844. [Google Scholar] [CrossRef]
  13. Thomaidou, A.C.; Batsaki, P.; Adamaki, M.; Goulielmaki, M.; Baxevanis, C.N.; Zoumpourlis, V.; Fortis, S.P. Promising Biomarkers in Head and Neck Cancer: The Most Clinically Important miRNAs. Int. J. Mol. Sci. 2022, 23, 8257. [Google Scholar] [CrossRef] [PubMed]
  14. Avram, E.G.; Moatar, I.A.; Miok, V.; Baderca, F.; Samoila, C.; Alexa, A.; Andreescu, I.N.; Podariu, A.; Marian, C.; Sirbu, I.O. Gene network analysis of the transcriptome impact of methylated microRNAs on oral squamous cell carcinoma. Adv. Clin. Exp. Med. 2022, 31, 1231–1242. [Google Scholar] [PubMed]
  15. Calin, G.A.; Dumitru, C.D.; Shimizu, M.; Bichi, R.; Zupo, S.; Noch, E.; Aldler, H.; Rattan, S.; Keating, M.; Rai, K.; et al. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. USA 2002, 99, 15524–15529. [Google Scholar] [CrossRef][Green Version]
  16. Di Leva, G.; Garofalo, M.; Croce, C.M. MicroRNAs in cancer. Annu. Rev. Pathol. 2014, 9, 287–314. [Google Scholar] [CrossRef][Green Version]
  17. Ali Syeda, Z.; Langden, S.S.S.; Munkhzul, C.; Lee, M.; Song, S.J. Regulatory Mechanism of MicroRNA Expression in Cancer. Int. J. Mol. Sci. 2020, 21, 1723. [Google Scholar] [CrossRef][Green Version]
  18. Kent, O.A.; Fox-Talbot, K.; Halushka, M.K. RREB1 repressed miR-143/145 modulates KRAS signaling through downregulation of multiple targets. Oncogene 2013, 32, 2576–2585. [Google Scholar] [CrossRef][Green Version]
  19. Wang, C.; Shi, Z.; Hong, Z.; Pan, J.; Chen, Z.; Qiu, C.; Zhuang, H.; Zheng, X. MicroRNA-1276 Promotes Colon Cancer Cell Proliferation by Negatively Regulating LACTB. Cancer Manag. Res. 2020, 12, 12185–12195. [Google Scholar] [CrossRef]
  20. Coarfa, C.; Fiskus, W.; Eedunuri, V.K.; Rajapakshe, K.; Foley, C.; Chew, S.A.; Shah, S.S.; Geng, C.; Shou, J.; Mohamed, J.S.; et al. Comprehensive proteomic profiling identifies the androgen receptor axis and other signaling pathways as targets of microRNAs suppressed in metastatic prostate cancer. Oncogene 2016, 35, 2345–2356. [Google Scholar] [CrossRef] [PubMed][Green Version]
  21. Takayama, K.I.; Misawa, A.; Inoue, S. Significance of microRNAs in Androgen Signaling and Prostate Cancer Progression. Cancers 2017, 9, 102. [Google Scholar] [CrossRef] [PubMed][Green Version]
  22. Wang, X.J.; Yan, Z.J.; Luo, G.C.; Chen, Y.Y.; Bai, P.M. miR-26 suppresses renal cell cancer via down-regulating coronin-3. Mol. Cell. Biochem. 2020, 463, 137–146. [Google Scholar] [CrossRef] [PubMed]
  23. Li, X.; Chen, W.; Li, R.; Chen, X.; Huang, G.; Lu, C.; Wen, Z.; Peng, X.; Liu, K.; Zhang, C.; et al. Bladder cancer diagnosis with a four-miRNA panel in serum. Future Oncol. 2022, 18, 3311–3322. [Google Scholar] [CrossRef]
  24. Gao, S.; Shi, P.; Tian, Z.; Yang, X.; Liu, N. Overexpression of miR-1225 promotes the progression of breast cancer, resulting in poor prognosis. Clin. Exp. Med. 2021, 21, 287–296. [Google Scholar] [CrossRef] [PubMed]
  25. Gao, C.; Zhou, C.; Zhuang, J.; Liu, L.; Liu, C.; Li, H.; Liu, G.; Wei, J.; Sun, C. MicroRNA expression in cervical cancer: Novel diagnostic and prognostic biomarkers. J. Cell. Biochem. 2018, 119, 7080–7090. [Google Scholar] [CrossRef]
  26. Wei, L.; He, Y.; Bi, S.; Li, X.; Zhang, J.; Zhang, S. miRNA-199b-3p suppresses growth and progression of ovarian cancer via the CHK1/E-cadherin/EMT signaling pathway by targeting ZEB1. Oncol. Rep. 2021, 45, 569–581. [Google Scholar] [CrossRef]
  27. Liang, G.; Meng, W.; Huang, X.; Zhu, W.; Yin, C.; Wang, C.; Fassan, M.; Yu, Y.; Kudo, M.; Xiao, S.; et al. miR-196b-5p-mediated downregulation of TSPAN12 and GATA6 promotes tumor progression in non-small cell lung cancer. Proc. Natl. Acad. Sci. USA 2020, 117, 4347–4357. [Google Scholar] [CrossRef]
  28. Wan, Y.; Hoyle, R.G.; Xie, N.; Wang, W.; Cai, H.; Zhang, M.; Ma, Z.; Xiong, G.; Xu, X.; Huang, Z.; et al. A Super-Enhancer Driven by FOSL1 Controls miR-21-5p Expression in Head and Neck Squamous Cell Carcinoma. Front. Oncol. 2021, 11, 656628. [Google Scholar] [CrossRef]
  29. Patil, S.; Warnakulasuriya, S. Blood-based circulating microRNAs as potential biomarkers for predicting the prognosis of head and neck cancer-a systematic review. Clin. Oral Investig. 2020, 24, 3833–3841. [Google Scholar] [CrossRef]
  30. Al Rawi, N.; Elmabrouk, N.; Abu Kou, R.; Mkadmi, S.; Rizvi, Z.; Hamdoon, Z. The role of differentially expressed salivary microRNA in oral squamous cell carcinoma. A systematic review. Arch. Oral Biol. 2021, 125, 105108. [Google Scholar] [CrossRef]
  31. Dioguardi, M.; Cantore, S.; Sovereto, D.; La Femina, L.; Caloro, G.A.; Spirito, F.; Scacco, S.; Di Cosola, M.; Lo Muzio, L.; Troiano, G.; et al. Potential Role of miR-196a and miR-196b as Prognostic Biomarkers of Survival in Head and Neck Squamous Cell Carcinoma: A Systematic Review, Meta-Analysis and Trial Sequential Analysis. Life 2022, 12, 1269. [Google Scholar] [CrossRef]
  32. Dioguardi, M.; Spirito, F.; Caloro, G.A.; Lo Muzio, L.; Cantore, S.; Ballini, A.; Scacco, S.; Malcangi, A.; Sembronio, S.; Cascardi, E.; et al. Is the Non-Coding RNA miR-195 a Biodynamic Marker in the Pathogenesis of Head and Neck Squamous Cell Carcinoma? A Prognostic Meta-Analysis. J. Pers. Med. 2023, 13, 275. [Google Scholar] [CrossRef] [PubMed]
  33. Dioguardi, M.; Spirito, F.; Sovereto, D.; La Femina, L.; Campobasso, A.; Cazzolla, A.P.; Di Cosola, M.; Zhurakivska, K.; Cantore, S.; Ballini, A.; et al. Biological Prognostic Value of miR-155 for Survival Outcome in Head and Neck Squamous Cell Carcinomas: Systematic Review, Meta-Analysis and Trial Sequential Analysis. Biology 2022, 11, 651. [Google Scholar] [CrossRef]
  34. Slaughter, D.P.; Southwick, H.W.; Smejkal, W. Field cancerization in oral stratified squamous epithelium; clinical implications of multicentric origin. Cancer 1953, 6, 963–968. [Google Scholar] [CrossRef] [PubMed]
  35. Braakhuis, B.J.; Tabor, M.P.; Kummer, J.A.; Leemans, C.R.; Brakenhoff, R.H. A genetic explanation of Slaughter’s concept of field cancerization: Evidence and clinical implications. Cancer Res. 2003, 63, 1727–1730. [Google Scholar] [PubMed]
  36. Roman, A.; Munger, K. The papillomavirus E7 proteins. Virology 2013, 445, 138–168. [Google Scholar] [CrossRef] [PubMed][Green Version]
  37. Dong, Y.; Zou, J.; Su, S.; Huang, H.; Deng, Y.; Wang, B.; Li, W. MicroRNA-218 and microRNA-520a inhibit cell proliferation by downregulating E2F2 in hepatocellular carcinoma. Mol. Med. Rep. 2015, 12, 1016–1022. [Google Scholar] [CrossRef][Green Version]
  38. Li, T.; Luo, W.; Liu, K.; Lv, X.; Xi, T. miR-31 promotes proliferation of colon cancer cells by targeting E2F2. Biotechnol. Lett. 2015, 37, 523–532. [Google Scholar] [CrossRef]
  39. Zhang, Y.; Han, D.; Wei, W.; Cao, W.; Zhang, R.; Dong, Q.; Zhang, J.; Wang, Y.; Liu, N. MiR-218 Inhibited Growth and Metabolism of Human Glioblastoma Cells by Directly Targeting E2F2. Cell. Mol. Neurobiol. 2015, 35, 1165–1173. [Google Scholar] [CrossRef]
  40. Wang, H.; Zhang, X.; Liu, Y.; Ni, Z.; Lin, Y.; Duan, Z.; Shi, Y.; Wang, G.; Li, F. Downregulated miR-31 level associates with poor prognosis of gastric cancer and its restoration suppresses tumor cell malignant phenotypes by inhibiting E2F2. Oncotarget 2016, 7, 36577–36589. [Google Scholar] [CrossRef][Green Version]
  41. Fang, Z.Q.; Li, M.C.; Zhang, Y.Q.; Liu, X.G. MiR-490-5p inhibits the metastasis of hepatocellular carcinoma by down-regulating E2F2 and ECT2. J. Cell. Biochem. 2018, 119, 8317–8324. [Google Scholar] [CrossRef] [PubMed]
  42. Zhou, X.; Tao, H. Overexpression of microRNA-936 suppresses non-small cell lung cancer cell proliferation and invasion via targeting E2F2. Exp. Ther. Med. 2018, 16, 2696–2702. [Google Scholar] [CrossRef] [PubMed][Green Version]
  43. Cui, X.; Xiao, D.; Cui, Y.; Wang, X. Exosomes-Derived Long Non-Coding RNA HOTAIR Reduces Laryngeal Cancer Radiosensitivity by Regulating microRNA-454-3p/E2F2 Axis. OncoTargets Ther. 2019, 12, 10827–10839. [Google Scholar] [CrossRef] [PubMed][Green Version]
  44. Lin, Q.Y.; Wang, J.Q.; Wu, L.L.; Zheng, W.E.; Chen, P.R. miR-638 represses the stem cell characteristics of breast cancer cells by targeting E2F2. Breast Cancer 2020, 27, 147–158. [Google Scholar] [CrossRef]
  45. Miyamoto, M.; Sawada, K.; Nakamura, K.; Yoshimura, A.; Ishida, K.; Kobayashi, M.; Shimizu, A.; Yamamoto, M.; Kodama, M.; Hashimoto, K.; et al. Paclitaxel exposure downregulates miR-522 expression and its downregulation induces paclitaxel resistance in ovarian cancer cells. Sci. Rep. 2020, 10, 16755. [Google Scholar] [CrossRef]
  46. Feng, H.; Sun, S.Z.; Cheng, F.; Zhang, N.Q. Mediation of circ_RPPH1 on miR-146b-3p/E2F2 pathway to hinder the growth and metastasis of breast carcinoma cells. Aging 2021, 13, 20552–20568. [Google Scholar] [CrossRef]
  47. Zhang, H.; Qiu, X.; Song, Z.; Lan, L.; Ren, X.; Ye, B. CircCUL2 suppresses retinoblastoma cells by regulating miR-214-5p/E2F2 Axis. Anticancer Drugs 2022, 33, e218–e227. [Google Scholar] [CrossRef]
  48. Yin, H.; Sun, Y.; Wang, X.; Park, J.; Zhang, Y.; Li, M.; Yin, J.; Liu, Q.; Wei, M. Progress on the relationship between miR-125 family and tumorigenesis. Exp. Cell Res. 2015, 339, 252–260. [Google Scholar] [CrossRef]
  49. Huang, L.; Luo, J.; Cai, Q.; Pan, Q.; Zeng, H.; Guo, Z.; Dong, W.; Huang, J.; Lin, T. MicroRNA-125b suppresses the development of bladder cancer by targeting E2F3. Int. J. Cancer 2011, 128, 1758–1769. [Google Scholar] [CrossRef] [PubMed]
  50. Feliciano, A.; Castellvi, J.; Artero-Castro, A.; Leal, J.A.; Romagosa, C.; Hernández-Losa, J.; Peg, V.; Fabra, A.; Vidal, F.; Kondoh, H.; et al. miR-125b acts as a tumor suppressor in breast tumorigenesis via its novel direct targets ENPEP, CK2-α, CCNJ, and MEGF9. PLoS ONE 2013, 8, e76247. [Google Scholar] [CrossRef][Green Version]
  51. Zhang, Y.; Yan, L.X.; Wu, Q.N.; Du, Z.M.; Chen, J.; Liao, D.Z.; Huang, M.Y.; Hou, J.H.; Wu, Q.L.; Zeng, M.S.; et al. miR-125b is methylated and functions as a tumor suppressor by regulating the ETS1 proto-oncogene in human invasive breast cancer. Cancer Res. 2011, 71, 3552–3562. [Google Scholar] [CrossRef] [PubMed][Green Version]
  52. Jia, H.Y.; Wang, Y.X.; Yan, W.T.; Li, H.Y.; Tian, Y.Z.; Wang, S.M.; Zhao, H.L. MicroRNA-125b functions as a tumor suppressor in hepatocellular carcinoma cells. Int. J. Mol. Sci. 2012, 13, 8762–8774. [Google Scholar] [CrossRef][Green Version]
  53. Gong, J.; Zhang, J.P.; Li, B.; Zeng, C.; You, K.; Chen, M.X.; Yuan, Y.; Zhuang, S.M. MicroRNA-125b promotes apoptosis by regulating the expression of Mcl-1, Bcl-w and IL-6R. Oncogene 2013, 32, 3071–3079. [Google Scholar] [CrossRef] [PubMed][Green Version]
  54. Guan, Y.; Yao, H.; Zheng, Z.; Qiu, G.; Sun, K. MiR-125b targets BCL3 and suppresses ovarian cancer proliferation. Int. J. Cancer 2011, 128, 2274–2283. [Google Scholar] [CrossRef] [PubMed]
  55. He, J.; Xu, Q.; Jing, Y.; Agani, F.; Qian, X.; Carpenter, R.; Li, Q.; Wang, X.R.; Peiper, S.S.; Lu, Z.; et al. Reactive oxygen species regulate ERBB2 and ERBB3 expression via miR-199a/125b and DNA methylation. EMBO Rep. 2012, 13, 1116–1122. [Google Scholar] [CrossRef] [PubMed][Green Version]
  56. Li, J.; You, T.; Jing, J. MiR-125b inhibits cell biological progression of Ewing’s sarcoma by suppressing the PI3K/Akt signalling pathway. Cell Prolif. 2014, 47, 152–160. [Google Scholar] [CrossRef]
  57. Kong, F.; Sun, C.; Wang, Z.; Han, L.; Weng, D.; Lu, Y.; Chen, G. miR-125b confers resistance of ovarian cancer cells to cisplatin by targeting pro-apoptotic Bcl-2 antagonist killer 1. J. Huazhong Univ. Sci. Technol. Med. Sci. 2011, 31, 543. [Google Scholar] [CrossRef]
  58. Yuan, T.Z.; Zhang, H.H.; Lin, X.L.; Yu, J.X.; Yang, Q.X.; Liang, Y.; Deng, J.; Huang, L.J.; Zhang, X.P. microRNA-125b reverses the multidrug resistance of nasopharyngeal carcinoma cells via targeting of Bcl-2. Mol. Med. Rep. 2017, 15, 2223–2228. [Google Scholar] [CrossRef][Green Version]
  59. Shiiba, M.; Shinozuka, K.; Saito, K.; Fushimi, K.; Kasamatsu, A.; Ogawara, K.; Uzawa, K.; Ito, H.; Takiguchi, Y.; Tanzawa, H. MicroRNA-125b regulates proliferation and radioresistance of oral squamous cell carcinoma. Br. J. Cancer 2013, 108, 181721. [Google Scholar] [CrossRef][Green Version]
  60. Doukas, S.G.; Vagelim, D.P.; Lazopoulos, G.; Spandidos, D.A.; Sasaki, C.T.; Tsatsakis, A. The Effect of NNK, A Tobacco Smoke Carcinogen, on the miRNA and Mismatch DNA Repair Expression Profiles in Lung and Head and Neck Squamous Cancer Cells. Cells 2020, 9, 1031. [Google Scholar] [CrossRef][Green Version]
  61. Chawla, J.P.; Iyer, N.; Soodan, K.S.; Sharma, A.; Khurana, S.K.; Priyadarshni, P. Role of miRNA in cancer diagnosis, prognosis, therapy and regulation of its expression by Epstein-Barr virus and human papillomaviruses: With special reference to oral cancer. Oral Oncol. 2015, 51, 731–737. [Google Scholar] [CrossRef]
  62. Mycko, M.P.; Cichalewska, M.; Cwiklinska, H.; Selmaj, K.W. miR-155-3p Drives the Development of Autoimmune Demyelination by Regulation of Heat Shock Protein 40. J. Neurosci. 2015, 35, 16504–16515. [Google Scholar] [CrossRef][Green Version]
  63. Manikandan, M.; Deva Magendhra Rao, A.K.; Rajkumar, K.S.; Rajaraman, R.; Munirajan, A.K. Altered levels of miR-21, miR-125b-2*, miR-138, miR-155, miR-184, and miR-205 in oral squamous cell carcinoma and association with clinicopathological characteristics. J. Oral Pathol. Med. 2015, 44, 792–800. [Google Scholar] [CrossRef] [PubMed]
  64. Baba, O.; Hasegawa, S.; Nagai, H.; Uchida, F.; Yamatoji, M.; Kanno, N.I.; Yamagata, K.; Sakai, S.; Yanagawa, T.; Bukawa, H. MicroRNA-155-5p is associated with oral squamous cell carcinoma metastasis and poor prognosis. J. Oral Pathol. Med. 2016, 45, 248–255. [Google Scholar] [CrossRef] [PubMed][Green Version]
  65. Wu, M.; Duan, Q.; Liu, X.; Zhang, P.; Fu, Y.; Zhang, Z.; Liu, L.; Cheng, J.; Jiang, H. MiR-155-5p promotes oral cancer progression by targeting chromatin remodeling gene ARID2. Biomed. Pharm. 2020, 122, 109696. [Google Scholar] [CrossRef] [PubMed]
  66. Zheng, Y.J.; Liang, T.S.; Wang, J.; Zhao, J.Y.; Zhai, S.N.; Yang, D.K.; Wang, L.D. MicroRNA-155 acts as a diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma. Artif. Cells Nanomed. Biotechnol. 2020, 48, 977–982. [Google Scholar] [CrossRef]
  67. Zhang, M.; Wang, D.; Zhu, T.; Yin, R. miR-214-5p Targets ROCK1 and Suppresses Proliferation and Invasion of Human Osteosarcoma Cells. Oncol. Res. 2017, 25, 75–81. [Google Scholar] [CrossRef]
  68. Li, H.; Wang, H.; Ren, Z. MicroRNA-214-5p Inhibits the Invasion and Migration of Hepatocellular Carcinoma Cells by Targeting Wiskott-Aldrich Syndrome Like. Cell. Physiol. Biochem. 2018, 46, 757–764. [Google Scholar] [CrossRef][Green Version]
  69. Cao, T.H.; Ling, X.; Chen, C.; Tang, W.; Hu, D.M.; Yin, G.J. Role of miR-214-5p in the migration and invasion of pancreatic cancer cells. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 7214–7221. [Google Scholar]
  70. Yu, Z.W.; Zhong, L.P.; Ji, T.; Zhang, P.; Chen, W.T.; Zhang, C.P. MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010, 46, 317–322. [Google Scholar] [CrossRef]
  71. Yao, Z.; Chen, Q.; Ni, Z.; Zhou, L.; Wang, Y.; Yang, Y.; Huang, H. Long Non-Coding RNA Differentiation Antagonizing Nonprotein Coding RNA (DANCR) Promotes Proliferation and Invasion of Pancreatic Cancer by Sponging miR-214-5p to Regulate E2F2 Expression. Med. Sci. Monit. 2019, 25, 4544–4552. [Google Scholar] [CrossRef] [PubMed]
  72. Patil, R.N.; Karpe, Y.A. Uncovering the Roles of miR-214 in Hepatitis E Virus Replication. J. Mol. Biol. 2020, 432, 5322–5342. [Google Scholar] [CrossRef] [PubMed]
  73. Brunner, M.; Ng, B.C.; Veness, M.J.; Clark, J.R. Comparison of the AJCC N staging system in mucosal and cutaneous squamous head and neck cancer. Laryngoscope 2014, 124, 1598–1602. [Google Scholar] [CrossRef]
  74. Rodrigues, P.C.; Miguel, M.C.; Bagordakis, E.; Fonseca, F.P.; de Aquino, S.N.; Santos-Silva, A.R.; Lopes, M.A.; Graner, E.; Salo, T.; Kowalski, L.P.; et al. Clinicopathological prognostic factors of oral tongue squamous cell carcinoma: A retrospective study of 202 cases. Int. J. Oral Maxillofac. Surg. 2014, 43, 795–801. [Google Scholar] [CrossRef] [PubMed]
  75. El-Naggar, A.K.; Chan, J.K.C.; Grandis, J.R.; Takata, T.; Slootweg, P.J. WHO Classification of Head and Neck Tumours International Agency for Research on Cancer (IARC), 4th ed.; IARC Publications: Lyon, France, 2017. [Google Scholar]
  76. Gołąbek, K.; Rączka, G.; Gaździcka, J.; Miśkiewicz-Orczyk, K.; Zięba, N.; Krakowczyk, Ł.; Misiołek, M.; Strzelczyk, J.K. Expression Profiles of CDKN2A, MDM2, E2F2 and LTF Genes in Oral Squamous Cell Carcinoma. Biomedicines 2022, 10, 3011. [Google Scholar] [CrossRef]
  77. miRCode. Available online: http://www.mircode.org (accessed on 14 September 2022).
  78. miRDB. Available online: http://mirdb.org (accessed on 14 September 2022).
  79. TargetScan. Available online: http://www.targetscan.org/vert_72 (accessed on 14 September 2022).
Ijms 24 06320 g001 550
Figure 1. The E2F2 mRNA expression and E2F2 protein level in tumour and margin samples.
Figure 1. The E2F2 mRNA expression and E2F2 protein level in tumour and margin samples.
Ijms 24 06320 g001
Ijms 24 06320 g002 550
Figure 2. The relative expression levels of tested miRNAs in tumour samples compared to margin samples.
Figure 2. The relative expression levels of tested miRNAs in tumour samples compared to margin samples.
Ijms 24 06320 g002
Ijms 24 06320 g003 550
Figure 3. Correlation between the expressions of E2F2 gene, E2F2 protein, and the tested miRNAs in tumour and margin samples.
Figure 3. Correlation between the expressions of E2F2 gene, E2F2 protein, and the tested miRNAs in tumour and margin samples.
Ijms 24 06320 g003
Ijms 24 06320 g004 550
Figure 4. E2F2 protein level in HPV-positive compared to HPV-negative patients.
Figure 4. E2F2 protein level in HPV-positive compared to HPV-negative patients.
Ijms 24 06320 g004
Ijms 24 06320 g005 550
Figure 5. The relative expression level of miR-125b-5p in HPV-positive compared to HPV-negative patients.
Figure 5. The relative expression level of miR-125b-5p in HPV-positive compared to HPV-negative patients.
Ijms 24 06320 g005
Ijms 24 06320 g006 550
Figure 6. The relative expression level of miR-155-3p in HPV-positive compared to HPV-negative patients.
Figure 6. The relative expression level of miR-155-3p in HPV-positive compared to HPV-negative patients.
Ijms 24 06320 g006
Ijms 24 06320 g007 550
Figure 7. The relative expression level of miR-214-5p in HPV-positive compared to HPV-negative patients.
Figure 7. The relative expression level of miR-214-5p in HPV-positive compared to HPV-negative patients.
Ijms 24 06320 g007
Table
Table 1. Clinical parameters of the OSCC group.
Table 1. Clinical parameters of the OSCC group.
Clinical ParametersPatients, n (%)
Histological grading
G1 (Well differentiated)9 (18)
G2 (Moderately differentiated)23 (46)
G3 (Poorly differentiated)18 (36)
T classification
T110 (20)
T223 (46)
T316 (32)
T41 (2)
Nodal status
N024 (48)
N12 (4)
N220 (40)
N34 (8)
Patient status at 3 years
Alive12 (24)
Dead38 (76)
Table
Table 2. cDNA synthesis procedure using TaqMan® Advanced miRNA cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA) according to manufacturer’s protocol.
Table 2. cDNA synthesis procedure using TaqMan® Advanced miRNA cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA) according to manufacturer’s protocol.
Perform the poly(A) tailing reactionReaction Composition
ComponentVolume
10× Poly(A) Buffer0.5 μL
ATP0.5 μL
Poly(A) enzyme0.3 μL
RNA sample2 μL
RNase-free water1.7 μL
Thermal Profile
StepTemperatureTime
Polyadenylation37 °C45 min
Stop reaction65 °C10 min
Hold4 °CHold
Perform the adaptor ligation reactionReaction Composition
ComponentVolume
5× DNA Ligase Buffer3 μL
50% PEG 80004.5 μL
25× Ligation Adaptor0.6 μL
RNA Ligase1.5 μL
Poly(A) tailing reaction product5 μL
RNase-free water0.4 μL
Thermal Profile
StepTemperatureTime
Ligation 16 °C60 min
Hold4 °CHold
Perform the reverse transcription (RT) reactionReaction Composition
ComponentVolume
5× RT Buffer 6 μL
dNTP Mix (25 mM each)1.2 μL
20× Universal RT primer1.5 μL
10× RT enzyme mix 3 μL
Adaptorligation reaction product15 μL
RNase-free water 3.3 μL
Thermal Profile
StepTemperatureTime
Reverse transcription42 °C15 min
Stop reaction85 °C5 min
Hold4 °CHold
Perform the miR-Amp reactionReaction Composition
ComponentVolume
2× miR-Amp master mix 25 μL
20× miR-Amp primer mix 2.5 μL
RT reaction product5 μL
RNase-free water 17.5 μL
Thermal Profile
StepTemperatureTimeCycles
Enzyme activation95 °C5 min1
Denature95 °C3 s14
Anneal/extend 60 °C30 s
Stop reaction 99 °C10 min1
Hold 4 °CHold1
Table
Table 3. Sequences of analysed miRNAs.
Table 3. Sequences of analysed miRNAs.
miRNAMature miRNA Sequence
miR-125b-5pUCCCUGAGACCCUAACUUGUGA
miR-155-3pCUCCUACAUAUUAGCAUUAACA
miR-214-5pUGCCUGUCUACACUUGCUGUGC
miR-361-5p (Housekeeping control)UUAUCAGAAUCUCCAGGGGUAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gołąbek, K.; Hudy, D.; Świętek, A.; Gaździcka, J.; Dąbrowska, N.; Miśkiewicz-Orczyk, K.; Zięba, N.; Misiołek, M.; Strzelczyk, J.K. miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma. Int. J. Mol. Sci. 2023, 24, 6320. https://doi.org/10.3390/ijms24076320

AMA Style

Gołąbek K, Hudy D, Świętek A, Gaździcka J, Dąbrowska N, Miśkiewicz-Orczyk K, Zięba N, Misiołek M, Strzelczyk JK. miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma. International Journal of Molecular Sciences. 2023; 24(7):6320. https://doi.org/10.3390/ijms24076320

Chicago/Turabian Style

Gołąbek, Karolina, Dorota Hudy, Agata Świętek, Jadwiga Gaździcka, Natalia Dąbrowska, Katarzyna Miśkiewicz-Orczyk, Natalia Zięba, Maciej Misiołek, and Joanna Katarzyna Strzelczyk. 2023. "miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma" International Journal of Molecular Sciences 24, no. 7: 6320. https://doi.org/10.3390/ijms24076320

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop